CN105550570A - Encryption and decryption method and device applied to programmable device - Google Patents
Encryption and decryption method and device applied to programmable device Download PDFInfo
- Publication number
- CN105550570A CN105550570A CN201510872226.5A CN201510872226A CN105550570A CN 105550570 A CN105550570 A CN 105550570A CN 201510872226 A CN201510872226 A CN 201510872226A CN 105550570 A CN105550570 A CN 105550570A
- Authority
- CN
- China
- Prior art keywords
- base units
- cell
- corresponding relation
- system data
- ciphertext
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G06—COMPUTING; CALCULATING OR COUNTING
- G06F—ELECTRIC DIGITAL DATA PROCESSING
- G06F21/00—Security arrangements for protecting computers, components thereof, programs or data against unauthorised activity
- G06F21/30—Authentication, i.e. establishing the identity or authorisation of security principals
- G06F21/45—Structures or tools for the administration of authentication
- G06F21/46—Structures or tools for the administration of authentication by designing passwords or checking the strength of passwords
-
- H—ELECTRICITY
- H04—ELECTRIC COMMUNICATION TECHNIQUE
- H04L—TRANSMISSION OF DIGITAL INFORMATION, e.g. TELEGRAPHIC COMMUNICATION
- H04L9/00—Cryptographic mechanisms or cryptographic arrangements for secret or secure communications; Network security protocols
- H04L9/06—Cryptographic mechanisms or cryptographic arrangements for secret or secure communications; Network security protocols the encryption apparatus using shift registers or memories for block-wise or stream coding, e.g. DES systems or RC4; Hash functions; Pseudorandom sequence generators
- H04L9/0618—Block ciphers, i.e. encrypting groups of characters of a plain text message using fixed encryption transformation
- H04L9/0631—Substitution permutation network [SPN], i.e. cipher composed of a number of stages or rounds each involving linear and nonlinear transformations, e.g. AES algorithms
-
- H—ELECTRICITY
- H04—ELECTRIC COMMUNICATION TECHNIQUE
- H04L—TRANSMISSION OF DIGITAL INFORMATION, e.g. TELEGRAPHIC COMMUNICATION
- H04L9/00—Cryptographic mechanisms or cryptographic arrangements for secret or secure communications; Network security protocols
- H04L9/06—Cryptographic mechanisms or cryptographic arrangements for secret or secure communications; Network security protocols the encryption apparatus using shift registers or memories for block-wise or stream coding, e.g. DES systems or RC4; Hash functions; Pseudorandom sequence generators
- H04L9/065—Encryption by serially and continuously modifying data stream elements, e.g. stream cipher systems, RC4, SEAL or A5/3
- H04L9/0656—Pseudorandom key sequence combined element-for-element with data sequence, e.g. one-time-pad [OTP] or Vernam's cipher
- H04L9/0662—Pseudorandom key sequence combined element-for-element with data sequence, e.g. one-time-pad [OTP] or Vernam's cipher with particular pseudorandom sequence generator
Abstract
The invention discloses an encryption and decryption method and device applied to a programmable device. The encryption method comprises the following steps of according to the corresponding relationship of a preset character unit and a base unit and the corresponding relationship of the base unit and a multi-system data unit, coding data to be encrypted including the preset character unit into a multi-system sequence ciphertext, wherein the multi-system sequence ciphertext comprises at least one multi-system data unit; the character unit comprises at least one character; and the base unit comprises at least one DNA base; and storing or outputting the multi-system sequence ciphertext. The decryption method is matched with the encryption method. According to the invention, in combination with the DNA characteristics, the encryption and decryption technology extremely having the safety and the operability is provided; the method is free from constraint of a secret key; users don't have to worry about that the secret key is stolen any longer; the users can customize the two corresponding relationships; different requirements of the users to safety levels are really realized; the matrix row and column alternative time is reduced; and thus, the encryption time is shortened.
Description
Technical field
The present invention relates to electronic technology field, particularly relate to a kind of be applied to programming device encryption, decryption method and device.
Background technology
Cryptography research be the how concealed information that will transmit, thus not by the true content knowing information that should not know.Nowadays along with scientific-technical progress, cryptography is no longer only for information encryption, has expanded to the numerous areas such as digital signature, authentication, multi-party computations.And in integrated circuits, the cryptographic algorithm for key message also becomes a vital ring in chip secure system.
Typical cryptographic algorithm system can be divided into symmetric key and unsymmetrical key code according to the key number difference used.In symmetric key cryptography system, be encrypted with when deciphering to information, all share a key and complete process.The secure fashion of this single key needs communicating pair all to hold key, the key information and the other side that trusts each other can not be leaked.Can be divided into packet key and stream secrete key for the different symmetric key of processing mode expressly, Fig. 1 a and Fig. 1 b respectively show the encryption and decryption flow process of packet key and stream secrete key.The exemplary of packet key is Data Encryption Standard DES; The typical case of stream cipher is then Trivium, Grain-v1 and MICKEY-v2.
The typical case of unsymmetrical key is the mechanism defect sharing a group key in order to make up symmetrical representative communication both sides, causes key safety not enough and the novel encryption technology of one of generation.Different from the shared key of the typical encryption and decryption of symmetry, asymmetrical typical case adopts the mode of encryption and decryption dual key, avoids the labile factor of communicating pair shared key.Encryption key to public, can use arbitrarily, is referred to as PKI.And decruption key only has decryption side to grasp, be called private key, also only have and grasp the people of private key and could decipher the information that this PKI encrypts, its encryption process as illustrated in figure 1 c.The most famous is RSA Algorithm.
Relatively the system of symmetric and unsymmetric key can be found out after distinguishing, the encryption and decryption of symmetric key use same key, communicating pair all holds key information, and assailant has an opportunity by mathematical analysis cracking trajectory thus obtains key after acquisition encryption or manner of decryption.And Asymmetric encryption one side algorithm structure is enough complicated, attack difficulty is large; Only there is decryption side to hold unique key in dual key mode on the other hand, do not share.Therefore the security of unsymmetrical key is very high.But symmetric key algorithm is encrypted, decrypting process is simple, speed is fast, key length is short, is applicable to being applied in the occasion such as RFID, automobile key.Although unsymmetrical key security is very high, the speed of encryption and decryption is comparatively slow and key length is longer, is mainly used in the field such as digital signature, digital certificate.Both respectively have its points of course, and different according to occasion, the cryptographic algorithm of selection is also different.Key designs personnel are when designing key, and the key designed by wishing on the one hand is enough complicated, can resist existing key distribution method, need again on the other hand to consider that key is convenient to realize on software, hardware and enciphering rate is fast.
In present widely used cryptographic algorithm, its most crucial place is the number of times (as aes algorithm, DES algorithm, 3_DES algorithm etc.) of display ranks rotation or uses different double secret key plain text encryption, to decrypt ciphertext.Front a kind of mode (as AES), encrypting and decrypting process understand by people, key can be obtained easily by mathematical analysis thus obtain the key message of encrypted transmission; Then a kind of mode (RSA) can make the time of encrypting and decrypting increase along with the increase of encrypted information.And along with in recent years, greatly developing of science and technology, the raising at full speed of computing machine computation capability, the encryption system of public-key cryptographic keys (RSA) also can become dangerous.Therefore, symmetric key and unsymmetrical key ink recorder system perfect all not, need propose a kind of brand-new encryption mechanism.
Summary of the invention
The invention provides a kind of be applied to programming device encryption, decryption method and device, solve the problem that existing encryption mechanism is perfect not.
For solving the problems of the technologies described above, the present invention by the following technical solutions:
Be applied to an encryption method for programming device, comprise:
According to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, the be-encrypted data comprising default character cell is encoded into multilevel sequence ciphertext, described multilevel sequence ciphertext comprises at least one multi-system data cell, described character cell comprises at least one character, and described base units comprises at least one DNA base;
Preserve or export described multilevel sequence ciphertext.
In certain embodiments, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, the be-encrypted data comprising default character cell is encoded into multilevel sequence ciphertext, is specially:
According to the character cell preset and the corresponding relation of base units, described be-encrypted data is encoded into DNA single chain ciphertext; According to the corresponding relation of base units and multi-system data cell, described DNA single chain ciphertext is encoded into multilevel sequence ciphertext;
Or, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into multi-system data cell; And form described multilevel sequence ciphertext by each multi-system data cell.
In certain embodiments, according to the corresponding relation of base units and multi-system data cell, before described DNA single chain ciphertext is encoded into multilevel sequence ciphertext, also comprise:
According to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.
In certain embodiments, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into multi-system data cell, comprises:
According to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into the multi-system data cell corresponding to the base units corresponding with character cell, or the multi-system data cell that another the base units one by one character cell in described be-encrypted data being encoded into the base units complementation corresponding with character cell is corresponding.
In certain embodiments, in the corresponding relation of described default character cell and base units, if the character cell preset has X, the base units corresponding from each default character cell is: appoint from DNA base group and take out Z DNA base and sort according to different orders and obtain, described DNA base group by Y kind DNA base and often kind of Z form, Z>=Isosorbide-5-Nitrae>=Y>=1,1≤X≤Y
z.
In certain embodiments, in the corresponding relation of described default character cell and base units, if the character cell preset be respectively each letter in 26 letters, each numeral in 0 to 9, space, comma, fullstop; Then corresponding from each default character cell base units is: from DNA base group, appoint taking-up 3 DNA bases to sort according to different orders and obtain, described DNA base group by 4 kinds of DNA bases and 3 often kind form.
In certain embodiments, in the corresponding relation of described base units and multi-system data cell, the multi-system data cell of answering with each base-pair in each base units comprises two bits.
A kind of decryption method, comprising:
Obtain multilevel sequence ciphertext to be decrypted, described multilevel sequence ciphertext comprises at least one multi-system data cell;
According to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, described multilevel sequence ciphertext is decoded into the clear data comprising default character cell, described character cell comprises at least one character, and described base units comprises at least one DNA base.
In certain embodiments, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, described multilevel sequence ciphertext is decoded into the clear data comprising default character cell, is specially:
According to the corresponding relation of described base units and multi-system data cell, described multilevel sequence ciphertext is decoded into DNA single chain ciphertext; According to the character cell preset and the corresponding relation of base units, described DNA single chain ciphertext is decoded into described clear data;
Or, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into character cell; And form described clear data by each character cell.
In certain embodiments, according to the character cell preset and the corresponding relation of base units, before described DNA single chain ciphertext is decoded into described clear data, also comprise:
According to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.
In certain embodiments, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into character cell, comprises:
According to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to the base units corresponding with multi-system data cell, or one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to another base units of the base units complementation corresponding with multi-system data cell.
In certain embodiments, in the corresponding relation of described default character cell and base units, if the character cell preset has X, then corresponding from each default character cell base units is: appoint from DNA base group and take out Z DNA base and sort according to different orders and obtain, described DNA base group by Y kind DNA base and often kind of Z form, Z>=Isosorbide-5-Nitrae>=Y>=1,1≤X≤Y
z.
In certain embodiments, in the corresponding relation of described base units and multi-system data cell, the multi-system data cell of answering with each base-pair in each base units comprises two bits.
Be applied to an encryption device for programming device, comprise:
Encryption processing module, for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, the be-encrypted data comprising default character cell is encoded into multilevel sequence ciphertext, described multilevel sequence ciphertext comprises at least one multi-system data cell, described character cell comprises at least one character, and described base units comprises at least one DNA base;
And first preserves module, for preserving described multilevel sequence ciphertext; Or output module, for exporting described multilevel sequence ciphertext.
In certain embodiments, encryption processing module comprises the first encryption submodule and/or the second encryption submodule:
First encryption submodule is used for the corresponding relation according to the character cell preset and base units, described be-encrypted data is encoded into DNA single chain ciphertext; According to the corresponding relation of base units and multi-system data cell, described DNA single chain ciphertext is encoded into multilevel sequence ciphertext;
Second encryption submodule is used for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into multi-system data cell; And form described multilevel sequence ciphertext by each multi-system data cell.
In certain embodiments, first encryption submodule is also at the corresponding relation according to base units and multi-system data cell, before described DNA single chain ciphertext is encoded into multilevel sequence ciphertext, according to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.
In certain embodiments, second encryption submodule is specifically for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into the multi-system data cell corresponding to the base units corresponding with character cell, or the multi-system data cell that another the base units one by one character cell in described be-encrypted data being encoded into the base units complementation corresponding with character cell is corresponding.
In certain embodiments, this encryption device being applied to programming device also comprises the second preservation module, for preserving the corresponding relation of described default character cell and base units, in the corresponding relation of described default character cell and base units, if the character cell preset has X, then corresponding from each default character cell base units is: appoint from DNA base group and take out Z DNA base and sort according to different orders and obtain, described DNA base group by Y kind DNA base and often kind of Z form, Z>=1,4>=Y>=1,1≤X≤Y
z;
Also for preserving the corresponding relation of described base units and multi-system data cell, in the corresponding relation of described base units and multi-system data cell, the multi-system data cell of answering with each base-pair in each base units comprises two bits.
A kind of decryption device, comprising:
Acquisition module, for obtaining multilevel sequence ciphertext to be decrypted, described multilevel sequence ciphertext comprises at least one multi-system data cell;
Decryption processing module, for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, described multilevel sequence ciphertext is decoded into the clear data comprising default character cell, described character cell comprises at least one character, and described base units comprises at least one DNA base.
In certain embodiments, decryption processing module comprises the first deciphering submodule and/or the second deciphering submodule:
First deciphering submodule is used for the corresponding relation according to described base units and multi-system data cell, and described multilevel sequence ciphertext is decoded into DNA single chain ciphertext; According to the character cell preset and the corresponding relation of base units, described DNA single chain ciphertext is decoded into described clear data;
Second deciphering submodule is used for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into character cell; And form described clear data by each character cell.
In certain embodiments, first deciphering submodule is also for according to the character cell preset and the corresponding relation of base units, before described DNA single chain ciphertext is decoded into described clear data, according to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.
In certain embodiments, second deciphering submodule is specifically for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to the base units corresponding with multi-system data cell, or one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to another base units of the base units complementation corresponding with multi-system data cell.
In certain embodiments, this decryption device also comprises the 3rd and preserves module, for preserving the corresponding relation of described default character cell and base units, in the corresponding relation of described default character cell and base units, if the character cell preset has X, then corresponding from each default character cell base units is: appoint from DNA base group and take out Z DNA base and sort according to different orders and obtain, described DNA base group by Y kind DNA base and often kind of Z form, Z>=1,4>=Y>=1,1≤X≤Y
z;
Also for preserving the corresponding relation of described base units and multi-system data cell, in the corresponding relation of described base units and multi-system data cell, the multi-system data cell of answering with each base-pair in each base units comprises two bits.
Encryption provided by the invention, decryption method and device, be applicable in various field, be particularly useful in programming device, programming device is including, but not limited to FPGA (Field-ProgrammableGateArray, field programmable gate array) device.In encryption method provided by the invention, by the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, the be-encrypted data comprising default character cell can be encoded into multilevel sequence ciphertext, combine the characteristic of biological DNA (deoxyribonucleic acid) (DNA), and mathematics is combined with biological, a kind of encryption and decryption technology having security and operability is proposed, with the symmetric key that industry is conventional, unsymmetrical key ink recorder system is compared, one, the biological nature of DNA is utilized to combine with programming device, the encryption and decryption of biological angle is realized from the angle of mathematics, its two, utilize the corresponding relation of character cell and base units, base units and multi-system data cell to data encrypting and deciphering, depart from the constraint of " key ", need not worry that key is stolen again, its three, user can self-defined above two kinds of corresponding relations, and the putting in order etc. of base in such as self-defining character unit, self-defined base units, self-defined base units, really realizes the different demands of user to safe class, its four, utilize brand-new coded system to reduce the number of times of matrix ranks rotation, thus reduce encryption times.
Accompanying drawing explanation
Fig. 1 a is the encryption and decryption schematic flow sheet of packet key in existing symmetric key mechanisms;
Fig. 1 b is the encryption and decryption schematic flow sheet of stream secrete key in existing symmetric key mechanisms;
Fig. 1 c is the encryption and decryption schematic flow sheet in existing asymmetric key mechanisms;
The process flow diagram being applied to the encryption method of programming device that Fig. 2 provides for one embodiment of the invention;
The process flow diagram of the decryption method that Fig. 3 provides for one embodiment of the invention;
The schematic diagram being applied to the encryption device of programming device that Fig. 4 provides for one embodiment of the invention;
The schematic diagram of the decryption device that Fig. 5 provides for one embodiment of the invention.
Embodiment
The invention provides a kind of thinking, use and enough do not improve theoretical DNA technique at present to complete whole encryption and decryption, DNA has following characteristics: a) DNA contains four kinds of bases: adenine (A), guanine (G), cytimidine (C) and thymine (T); B) DNA is made up of two molecule long-chains, and two long-chains link together under the effect of hydrogen bond, present double-spiral structure, and wherein each molecule long-chain is a DNA single chain; C) connected mode of double-strand is according to the principle of base pair complementarity, and namely adenine (A) and thymine (T) match all the time and exist, and guanine (G) and cytimidine (C) match existence all the time.The present invention utilizes the above feature of DNA to ensure the security of encrypting from the angle of biological angle and mathematics, and this encryption and decryption technology speed is fast simultaneously.
First the present invention needs to set up following two kinds of corresponding relations:
The first corresponding relation is, the character cell preset and the corresponding relation of base units.Character cell comprises at least one character, and character can be numeral, letter or symbol.Base units comprises at least one DNA base.Can first define default character cell, then configure unique base units for each default character cell.Because DNA base has above four kinds, base kind in base units, base number, put in order in any one is different, the base units formed is just different, if the number of the character cell preset is less, such as be less than or equal 4, then each base units can be made up of a base, and 4 kinds of different bases form the base units that has uniqueness, respectively respectively with 4 character cell one_to_one corresponding.If the number of the character cell preset is more, in order to unique base units can be configured for each character cell, then wherein partly or entirely base units is made up of two or more bases, by base kind, base number, put in order difference configuration corresponding number and there is the base units of uniqueness.Preferably, in this corresponding relation, character cell and base units meet following rule:
If the character cell preset has X, then corresponding from each default character cell base units is: appoint from DNA base group and takes out Z DNA base and sort according to different orders and obtain, and described DNA base group is by Y kind DNA base and often kind of Z is individual forms, Z>=1,4>=Y>=1,1≤X≤Y
z.By this kind of principle configuration base units, can ensure as each in X the character cell preset configures the base units with uniqueness.
As a kind of embodiment, suppose that the character cell preset has 4, each character cell is respectively a numeral, respectively: 1,2,3,4.Configuration 4 is then needed to have the base units of uniqueness, so these 4 base units can respectively: A, G, C, T, and this corresponding relation can as table one, or, these 4 base units can respectively: AA, GG, GC, CG, and this corresponding relation can as table two:
Table one
| The character cell preset | Base units |
| 1 | A |
| 2 | G |
| 3 | C |
| 4 | T |
Table two
| The character cell preset | Base units |
| 1 | AA 6 --> |
| 2 | GG |
| 3 | GC |
| 4 | CG |
As a kind of preferred embodiment, suppose that the character cell preset has 40, each character cell is respectively with character late: each numeral in each character, 0 to 9 in 26 letters, space symbol, comma.; Then need configuration 40 to have the base units of uniqueness, the corresponding relation so set up can as shown in Table 3:
Table three
| A＝CGA | B＝CCA | C＝GTT | D＝TTG | E＝GGC | F＝GGT | G＝TTT | H＝CGC | I＝ATG | J＝AGT |
| K＝AAG | L＝TGC | M＝TCC | N＝TCT | O＝GGA | P＝GTG | Q＝AAC | R＝TCA | S＝ACG | T＝TTC |
| U＝CTG | V＝CCT | W＝CCG | X＝CTA | Y＝AAA | Z＝CTT | ＝ATA | ,＝TCG | .＝GAT | ＝GCT |
| 0＝ACT | 1＝ACC | 2＝TAG | 3＝GCA | 4＝GAG | 5＝AGA | 6＝TTA | 7＝ACA | 8＝AGG | 9＝GCG |
In table three, the character cell preset has 40, and the base units corresponding from each default character cell is: sorting from appointing taking-up 3 DNA bases from DNA base group according to different orders obtains, described DNA base group by 4 kinds of DNA bases and 3 often kind form.
This first corresponding relation can, when programming device initial configuration, utilize the biological nature of DNA to carry out designing and configuring, by it with conventional numerical, letter, symbol be corresponding, forms the coding schedule with DNA biological nature.In use, above corresponding relation can also redefine.
The second corresponding relation is, the corresponding relation of base units and multi-system data cell, and base units comprises at least one DNA base.Multi-system data cell is including, but not limited to scale-of-two, the quaternary, decimal data unit etc.Multi-system data cell is made up of multi-system data certainly, preferably, no matter be a few binary data unit, is all made up of 0 and/or 1 two number.In order to simplify, preferably, multi-system data cell comprises two bits.Such as, encode to four kinds of bases with 00,01,10 and 11 4 binary data units, this coded system has 4 unequal to, 24 kinds of array modes.In four bases, A and T is complementary, C and G is complementary, considers the biological nature that will embody base, adopts the complementary relationship of 0 and 1, and therefore in 4 binary data units, 00 and 11 is complementary, and 01 and 10 is complementary.Therefore the corresponding relation of base units and binary data units can if table four be to any one in table ten one:
Table four
| Binary data units | Base units |
| 00 | C |
| 01 | T |
| 10 | A |
| 11 | G |
Table five
| Binary data units | Base units |
| 00 | C |
| 01 | A 7 --> |
| 10 | T |
| 11 | G |
Table six
| Binary data units | Base units |
| 00 | G |
| 01 | T |
| 10 | A |
| 11 | C |
Table seven
| Binary data units | Base units |
| 00 | G |
| 01 | A |
| 10 | T |
| 11 | C |
Table eight
| Binary data units | Base units |
| 00 | T |
| 01 | C |
| 10 | G |
| 11 | A |
Table nine
| Binary data units | Base units |
| 00 | T |
| 01 | G |
| 10 | C |
| 11 | A |
Table ten
| Binary data units | Base units |
| 00 | A |
| 01 | C |
| 10 | G |
| 11 | T |
Table ten one
| Binary data units | Base units |
| 00 | A |
| 01 | G |
| 10 | C |
| 11 | T |
Table four is in table ten one, for binary data units, certainly also can be other binary data unit in other embodiments, also a multi-system data cell can be formed by plural bit, also can comprise two or more base in base units, and be not limited to the situation only including a base in table.
This second corresponding relation, DNA biological nature is corresponding with multi-system data, the mode of DNA biological nature computer digit is described, forms the numerical coding with DNA mathematical characteristic.
The first corresponding relation above-mentioned and the second corresponding relation, by User Defined or amendment, can input (as OTP) in the inner disposable storer of programming device and preserve.
Below by specific embodiment, design of the present invention is further described.
The process flow diagram being applied to the encryption method of programming device that Fig. 2 provides for one embodiment of the invention, mainly comprises the following steps:
The corresponding relation of the character cell that S201, basis are default and base units, and the corresponding relation of base units and multi-system data cell, the be-encrypted data comprising default character cell is encoded into multilevel sequence ciphertext, described multilevel sequence ciphertext comprises at least one multi-system data cell, described character cell comprises at least one character, and described base units comprises at least one DNA base;
S202, preservation or export described multilevel sequence ciphertext.
Wherein, be-encrypted data comprises at least one character cell preset, and can be such as the series of characters of numeral, letter and/or symbol composition, be-encrypted data also can be made up of 0 and/or 1, and such as be-encrypted data is a string binary data.Multilevel sequence ciphertext can be kept in the internal storage of programming device, as final ciphertext.
Including, but not limited to following two kinds of encryption methods in step S201:
The first encryption method is, according to the character cell preset and the corresponding relation of base units, described be-encrypted data is encoded into DNA single chain ciphertext; According to the corresponding relation of base units and multi-system data cell, described DNA single chain ciphertext is encoded into multilevel sequence ciphertext.
This kind of encipherment scheme is, first each character cell in be-encrypted data be encoded into corresponding base units and conspire to create DNA single chain ciphertext, DNA single chain ciphertext is made up of A, T, C and/or G; Again each base units in DNA single chain ciphertext be encoded into corresponding multi-system data cell afterwards and conspire to create multilevel sequence ciphertext.
The second encryption method is, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into multi-system data cell, and forms described multilevel sequence ciphertext by each multi-system data cell.
This kind of encipherment scheme is, in units of character cell in be-encrypted data, one by one, when taking turns to some character cells, according to above two kinds of corresponding relations are disposable, this character cell is encoded into multi-system data cell, be encoded into corresponding multi-system data cell to character late cell encoding is disposable again, and conspire to create multilevel sequence ciphertext.There is no intermediate product: DNA single chain ciphertext, DNA base.This mode is quicker.
In order to improve security further, preferably, in the first encryption method, after be-encrypted data being encoded into DNA single chain ciphertext, also comprise according to basepairing rule, this DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, this DNA single chain ciphertext is replaced to this another DNA single chain ciphertext and enters subsequent step, that is, afterwards each base units in this another DNA single chain ciphertext be encoded into corresponding multi-system data cell and conspire to create multilevel sequence ciphertext.
In order to improve security further, preferably, in the second encryption method, one by one the character cell in described be-encrypted data is encoded into multi-system data cell and specifically has following two kinds of modes: one by one the character cell in described be-encrypted data is encoded into the multi-system data cell corresponding to the base units corresponding with character cell, or the multi-system data cell that another the base units one by one character cell in described be-encrypted data being encoded into the base units complementation corresponding with character cell is corresponding.In front a kind of mode, the multi-system data cell be finally encoded into is, the multi-system data cell corresponding to the base units that the character cell in be-encrypted data is corresponding; In rear a kind of mode, the multi-system data cell be finally encoded into is, the multi-system data cell corresponding to another base units of the base units complementation that the character cell in be-encrypted data is corresponding.
Above embodiment, by the participation of the biological nature of DNA, increases the difficulty that ciphertext cracks, and decreases this number of encryption rotation, thus accelerates encryption times; Do not need to use secret key encryption, thus reduce risk (as key is stolen); In addition, be also easy to expansion, freely can define above two kinds of corresponding relations, thus deepen the degree of encryption.
Below so that be-encrypted data 123AFKPUCHMRW.COM is encrypted to binary sequence ciphertext, adopt the first encryption method in above embodiment, its ciphering process comprises:
First according to table three, 123AFKPUCHMRW.COM is encoded into a DNA single chain, i.e. DNA single chain ciphertext, this is first time encrypted result, as follows:
ACCTAGGCACGAGGTAAGGTGCTGGCTGTTCGCTCCTCACCGGATGTTGGATCC；
Again according to basepairing rule, above-mentioned DNA single chain ciphertext is converted to another DNA single chain with its complementation, i.e. another DNA single chain ciphertext, this is second time encrypted result:
TGGATCCGTGCTCCATTCCACGACCTACAAGCGAGGAGTGGCCTACAACCTAGG
Suppose option table four again, so in conjunction with above-mentioned second time encrypted result, we just can draw third time encrypted result, i.e. binary sequence ciphertext:
0111111001000011011100010000100101000010001110000001100010101100111011111011011111000001100011110000011011110000
Finally, be one group with 8 bit binary data and export or preserve, not enough mends 00 at end, thus forms third time ciphertext, as final ciphertext.
The present embodiment, when programming device initial configuration, biological nature design table three and the table four of DNA can be utilized, be kept in the inner disposable storer of programming device, table three by it with conventional numerical, letter, symbol be corresponding, forms the coding schedule with DNA biological nature; Table four is corresponding with binary data by DNA biological nature, forms the numerical coding with DNA mathematical characteristic; After determining be-encrypted data, table three is utilized first to carry out first time coding formation DNA single chain, complete first time encryption, recycling DNA complementary base pairing rules, the strand formed after first time encryption is encoded into another strand by complementary mode, completes second time encryption, recycling table four, this another DNA single chain encoding formed after second time coding is become binary form, completes third time encryption; The bit stream finally will formed after third time encryption, leaves in the internal storage of programming device, as final ciphertext, or exports.Certainly, in other embodiments, also can save second time encryption, directly be encrypted according to table four based on first time encrypted result and obtain final binary sequence ciphertext.
The present invention is directed to above encryption method, a kind of decryption method matched with it be also provided, this decryption method as shown in Figure 3, comprises following flow process:
S301, obtain multilevel sequence ciphertext to be decrypted, described multilevel sequence ciphertext comprises at least one multi-system data cell;
The corresponding relation of the character cell that S302, basis are default and base units, and the corresponding relation of base units and multi-system data cell, described multilevel sequence ciphertext is decoded into the clear data comprising default character cell, described character cell comprises at least one character, and described base units comprises at least one DNA base.
Clear data comprises at least one character cell preset, and can be such as the series of characters of numeral, letter and/or symbol composition, clear data also can be made up of 0 and/or 1, and such as clear data is a string binary data.The corresponding relation of the character cell preset and the corresponding relation of base units, base units and multi-system data cell can with reference to the table one in above encryption method to table ten one.
Including, but not limited to following two kinds of decryption methods in step S302:
The first decryption method is, according to the corresponding relation of described base units and multi-system data cell, described multilevel sequence ciphertext is decoded into DNA single chain ciphertext; According to the character cell preset and the corresponding relation of base units, described DNA single chain ciphertext is decoded into described clear data.
This kind of decrypt scheme is, first each multi-system data cell in multilevel sequence ciphertext is decoded into corresponding base units and conspires to create DNA single chain ciphertext, the more each base units in DNA single chain ciphertext is decoded into corresponding character cell and conspires to create clear data.
The second decryption method is, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into character cell; And form described clear data by each character cell.
This kind of decrypt scheme is, in units of multi-system data cell in multilevel sequence ciphertext, one by one, when taking turns to some multi-system data cells, according to above two kinds of corresponding relations are disposable, this multi-system data cell is decoded into character cell, be decoded into corresponding character cell to next multi-system data cell is disposable again, and conspire to create clear data.There is no intermediate product: DNA single chain ciphertext, DNA base.This mode is quicker.
In certain embodiments, in the first decryption method, at the corresponding relation according to the character cell preset and base units, before described DNA single chain ciphertext is decoded into described clear data, also comprise:
According to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.That is, afterwards each base units in this another DNA single chain ciphertext be decoded into corresponding character cell and conspire to create clear data.
In certain embodiments, in the second decryption method, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into character cell and specifically has following two kinds of modes: one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to the base units corresponding with multi-system data cell, or one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to another base units of the base units complementation corresponding with multi-system data cell.In front a kind of mode, the character cell be finally decoded into is, the character cell corresponding to base units that the multi-system data cell in multilevel sequence ciphertext is corresponding; In rear a kind of mode, the character cell be finally decoded into is, the character cell corresponding to another base units of the base units complementation that the multi-system data cell in multilevel sequence ciphertext is corresponding.
The schematic diagram being applied to the encryption device of programming device that Fig. 4 provides for one embodiment of the invention, be applied to the encryption device of programming device for performing above-mentioned encryption method, this device comprises:
Encryption processing module 41, for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, the be-encrypted data comprising default character cell is encoded into multilevel sequence ciphertext, described multilevel sequence ciphertext comprises at least one multi-system data cell, described character cell comprises at least one character, and described base units comprises at least one DNA base;
And first preserves module 42, for preserving described multilevel sequence ciphertext; Or output module (not shown), for exporting described multilevel sequence ciphertext.First preserves the internal storage that module 42 can be programming device.
In certain embodiments, encryption processing module 41 comprises the first encryption submodule (not shown) and/or the second encryption submodule (not shown):
First encryption submodule is used for the corresponding relation according to the character cell preset and base units, described be-encrypted data is encoded into DNA single chain ciphertext; According to the corresponding relation of base units and multi-system data cell, described DNA single chain ciphertext is encoded into multilevel sequence ciphertext;
In order to security of deducting a percentage, preferably, first encryption submodule is also at the corresponding relation according to base units and multi-system data cell, before described DNA single chain ciphertext is encoded into multilevel sequence ciphertext, according to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.
Second encryption submodule is used for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into multi-system data cell; And form described multilevel sequence ciphertext by each multi-system data cell.
Preferably, second encryption submodule is specifically for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into the multi-system data cell corresponding to the base units corresponding with character cell, or the multi-system data cell that another the base units one by one character cell in described be-encrypted data being encoded into the base units complementation corresponding with character cell is corresponding.
In certain embodiments, this device also comprises the second preservation module (not shown), for preserving the corresponding relation of described default character cell and base units, in the corresponding relation of described default character cell and base units, if the character cell preset has X, then corresponding from each default character cell base units is: appoint from DNA base group and take out Z DNA base and sort according to different orders and obtain, described DNA base group by Y kind DNA base and often kind of Z form, Z>=1,4>=Y>=1,1≤X≤Y
z;
Also for preserving the corresponding relation of described base units and multi-system data cell, in the corresponding relation of described base units and multi-system data cell, the multi-system data cell of answering with each base-pair in each base units comprises two bits.
The configuration of above two kinds of corresponding relations can with reference to the description in above-mentioned encryption method.
The present invention also provides a kind of decryption device, for performing above-mentioned decryption method.The schematic diagram of the decryption device that Fig. 5 provides for one embodiment of the invention, this device comprises:
Acquisition module 51, for obtaining multilevel sequence ciphertext to be decrypted, described multilevel sequence ciphertext comprises at least one multi-system data cell;
Decryption processing module 52, for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, described multilevel sequence ciphertext is decoded into the clear data comprising default character cell, described character cell comprises at least one character, and described base units comprises at least one DNA base.
In certain embodiments, decryption processing module 52 comprises the first deciphering submodule (not shown) and/or the second deciphering submodule (not shown):
First deciphering submodule is used for the corresponding relation according to described base units and multi-system data cell, and described multilevel sequence ciphertext is decoded into DNA single chain ciphertext; According to the character cell preset and the corresponding relation of base units, described DNA single chain ciphertext is decoded into described clear data.Preferably, first deciphering submodule is also for according to the character cell preset and the corresponding relation of base units, before described DNA single chain ciphertext is decoded into described clear data, according to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.
Second deciphering submodule is used for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into character cell; And form described clear data by each character cell.
Preferably, second deciphering submodule is specifically for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to the base units corresponding with multi-system data cell, or one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to another base units of the base units complementation corresponding with multi-system data cell.
In certain embodiments, this decryption device also comprises the 3rd and preserves module (not shown), for preserving the corresponding relation of described default character cell and base units, in the corresponding relation of described default character cell and base units, appoint from DNA base group and take out Z DNA base and obtain according to the sequence of different orders, described DNA base group is by Y kind DNA base and often kind of Z is individual forms, Z>=1,4>=Y>=1,1≤X≤Y
z;
Also for preserving the corresponding relation of described base units and multi-system data cell, in the corresponding relation of described base units and multi-system data cell, the multi-system data cell of answering with each base-pair in each base units comprises two bits.
The configuration of above two kinds of corresponding relations can with reference to the description in above-mentioned encryption method.
Present invention incorporates the characteristic of biological DNA (deoxyribonucleic acid) (DNA), and mathematics is combined with biological, propose a kind of encryption and decryption technology having security and operability; Utilize the corresponding relation of character cell and base units, base units and multi-system data cell to data encrypting and deciphering, depart from the constraint of " key ", need not worry that key is stolen again; User can self-defined above two kinds of corresponding relations, really realize the different demands of user to safe class; And encryption and decryption scheme provided by the invention decreases the number of times of matrix ranks rotation, thus decreases encryption times.
Obviously, those skilled in the art should be understood that, each module of the invention described above or each step can realize with general calculation element, they can concentrate on single calculation element, or be distributed on network that multiple calculation element forms, alternatively, they can realize with the executable program code of calculation element, thus, they can be stored in storage medium (ROM/RAM, magnetic disc, CD) in performed by calculation element, and in some cases, step shown or described by can performing with the order being different from embodiment, or they are made into each integrated circuit modules respectively, or the multiple module in them or step are made into single integrated circuit module to realize.So the present invention is not restricted to any specific hardware and software and combines.
Above content is in conjunction with concrete embodiment further description made for the present invention, can not assert that specific embodiment of the invention is confined to these explanations.For general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, some simple deduction or replace can also be made, all should be considered as belonging to protection scope of the present invention.
Claims (23)
1. be applied to an encryption method for programming device, it is characterized in that, comprising:
According to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, the be-encrypted data comprising default character cell is encoded into multilevel sequence ciphertext, described multilevel sequence ciphertext comprises at least one multi-system data cell, described character cell comprises at least one character, and described base units comprises at least one DNA base;
Preserve or export described multilevel sequence ciphertext.
2. be applied to the encryption method of programming device as claimed in claim 1, it is characterized in that, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, the be-encrypted data comprising default character cell is encoded into multilevel sequence ciphertext, is specially:
According to the character cell preset and the corresponding relation of base units, described be-encrypted data is encoded into DNA single chain ciphertext; According to the corresponding relation of base units and multi-system data cell, described DNA single chain ciphertext is encoded into multilevel sequence ciphertext;
Or, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into multi-system data cell; And form described multilevel sequence ciphertext by each multi-system data cell.
3. be applied to the encryption method of programming device as claimed in claim 2, it is characterized in that, according to the corresponding relation of base units and multi-system data cell, before described DNA single chain ciphertext is encoded into multilevel sequence ciphertext, also comprise:
According to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.
4. be applied to the encryption method of programming device as claimed in claim 2, it is characterized in that, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into multi-system data cell, comprises:
According to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into the multi-system data cell corresponding to the base units corresponding with character cell, or the multi-system data cell that another the base units one by one character cell in described be-encrypted data being encoded into the base units complementation corresponding with character cell is corresponding.
5. the encryption method being applied to programming device as described in any one of Claims 1-4, it is characterized in that, in the corresponding relation of described default character cell and base units, if the character cell preset has X, the base units corresponding from each default character cell is: appoint from DNA base group and takes out Z DNA base and sort according to different orders and obtain, and described DNA base group is by Y kind DNA base and often kind of Z is individual forms, Z>=1,4>=Y>=1,1≤X≤Y
z.
6. be applied to the encryption method of programming device as claimed in claim 5, it is characterized in that, in the corresponding relation of described default character cell and base units, if the character cell preset be respectively each letter in 26 letters, each numeral in 0 to 9, space, comma, fullstop; Then corresponding from each default character cell base units is: from DNA base group, appoint taking-up 3 DNA bases to sort according to different orders and obtain, described DNA base group by 4 kinds of DNA bases and 3 often kind form.
7. the encryption method being applied to programming device as described in any one of Claims 1-4, it is characterized in that, in the corresponding relation of described base units and multi-system data cell, the multi-system data cell of answering with each base-pair in each base units comprises two bits.
8. a decryption method, is characterized in that, comprising:
Obtain multilevel sequence ciphertext to be decrypted, described multilevel sequence ciphertext comprises at least one multi-system data cell;
According to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, described multilevel sequence ciphertext is decoded into the clear data comprising default character cell, described character cell comprises at least one character, and described base units comprises at least one DNA base.
9. decryption method as claimed in claim 8, it is characterized in that, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, described multilevel sequence ciphertext is decoded into the clear data comprising default character cell, is specially:
According to the corresponding relation of described base units and multi-system data cell, described multilevel sequence ciphertext is decoded into DNA single chain ciphertext; According to the character cell preset and the corresponding relation of base units, described DNA single chain ciphertext is decoded into described clear data;
Or, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into character cell; And form described clear data by each character cell.
10. decryption method as claimed in claim 9, is characterized in that, according to the corresponding relation of the character cell preset and base units, before described DNA single chain ciphertext is decoded into described clear data, also comprises:
According to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.
11. decryption methods as claimed in claim 9, it is characterized in that, according to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into character cell, comprises:
According to the character cell preset and the corresponding relation of base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to the base units corresponding with multi-system data cell, or one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to another base units of the base units complementation corresponding with multi-system data cell.
12. decryption methods as described in any one of claim 8 to 11, it is characterized in that, in the corresponding relation of described default character cell and base units, if the character cell preset has X, then corresponding from each default character cell base units is: appoint from DNA base group and takes out Z DNA base and sort according to different orders and obtain, and described DNA base group is by Y kind DNA base and often kind of Z is individual forms, Z>=1,4>=Y>=1,1≤X≤Y
z.
13. decryption methods as described in any one of claim 8 to 11, it is characterized in that, in the corresponding relation of described base units and multi-system data cell, the multi-system data cell of answering with each base-pair in each base units comprises two bits.
14. 1 kinds of encryption devices being applied to programming device, is characterized in that, comprising:
Encryption processing module, for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, the be-encrypted data comprising default character cell is encoded into multilevel sequence ciphertext, described multilevel sequence ciphertext comprises at least one multi-system data cell, described character cell comprises at least one character, and described base units comprises at least one DNA base;
And first preserves module, for preserving described multilevel sequence ciphertext; Or output module, for exporting described multilevel sequence ciphertext.
15. encryption devices being applied to programming device as claimed in claim 14, is characterized in that, encryption processing module comprises the first encryption submodule and/or the second encryption submodule:
First encryption submodule is used for the corresponding relation according to the character cell preset and base units, described be-encrypted data is encoded into DNA single chain ciphertext; According to the corresponding relation of base units and multi-system data cell, described DNA single chain ciphertext is encoded into multilevel sequence ciphertext;
Second encryption submodule is used for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into multi-system data cell; And form described multilevel sequence ciphertext by each multi-system data cell.
16. encryption devices being applied to programming device as claimed in claim 15, it is characterized in that, first encryption submodule is also at the corresponding relation according to base units and multi-system data cell, before described DNA single chain ciphertext is encoded into multilevel sequence ciphertext, according to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.
17. encryption devices being applied to programming device as claimed in claim 15, it is characterized in that, second encryption submodule is specifically for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the character cell in described be-encrypted data is encoded into the multi-system data cell corresponding to the base units corresponding with character cell, or one by one the character cell in described be-encrypted data is encoded into the multi-system data cell that another base units of the base units complementation corresponding with character cell is corresponding.
18. encryption devices being applied to programming device as described in any one of claim 14 to 17, it is characterized in that, also comprise the second preservation module, for preserving the corresponding relation of described default character cell and base units, in the corresponding relation of described default character cell and base units, if the character cell preset has X, then corresponding from each default character cell base units is: appoint from DNA base group and take out Z DNA base and sort according to different orders and obtain, described DNA base group by Y kind DNA base and often kind of Z form, Z>=1, 4>=Y>=1, 1≤X≤Y
z,
Also for preserving the corresponding relation of described base units and multi-system data cell, in the corresponding relation of described base units and multi-system data cell, the multi-system data cell of answering with each base-pair in each base units comprises two bits.
19. 1 kinds of decryption devices, is characterized in that, comprising:
Acquisition module, for obtaining multilevel sequence ciphertext to be decrypted, described multilevel sequence ciphertext comprises at least one multi-system data cell;
Decryption processing module, for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, described multilevel sequence ciphertext is decoded into the clear data comprising default character cell, described character cell comprises at least one character, and described base units comprises at least one DNA base.
20. decryption devices as claimed in claim 19, is characterized in that, decryption processing module comprises the first deciphering submodule and/or the second deciphering submodule:
First deciphering submodule is used for the corresponding relation according to described base units and multi-system data cell, and described multilevel sequence ciphertext is decoded into DNA single chain ciphertext; According to the character cell preset and the corresponding relation of base units, described DNA single chain ciphertext is decoded into described clear data;
Second deciphering submodule is used for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into character cell; And form described clear data by each character cell.
21. decryption devices as claimed in claim 19, it is characterized in that, first deciphering submodule is also for according to the character cell preset and the corresponding relation of base units, before described DNA single chain ciphertext is decoded into described clear data, according to basepairing rule, described DNA single chain ciphertext is converted to another DNA single chain ciphertext with its complementation, described DNA single chain ciphertext is replaced to another DNA single chain ciphertext described and enter subsequent step.
22. decryption devices as claimed in claim 19, it is characterized in that, second deciphering submodule is specifically for the corresponding relation according to the character cell preset and base units, and the corresponding relation of base units and multi-system data cell, one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to the base units corresponding with multi-system data cell, or one by one the multi-system data cell in described multilevel sequence ciphertext is decoded into the character cell corresponding to another base units of the base units complementation corresponding with multi-system data cell.
23. decryption devices as described in any one of claim 19 to 22, it is characterized in that, also comprise the 3rd and preserve module, for preserving the corresponding relation of described default character cell and base units, in the corresponding relation of described default character cell and base units, if the character cell preset has X, then corresponding from each default character cell base units is: appoint from DNA base group and take out Z DNA base and sort according to different orders and obtain, described DNA base group by Y kind DNA base and often kind of Z form, Z>=1,4>=Y>=1,1≤X≤Y
z;
Also for preserving the corresponding relation of described base units and multi-system data cell, in the corresponding relation of described base units and multi-system data cell, the multi-system data cell of answering with each base-pair in each base units comprises two bits.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510872226.5A CN105550570A (en) | 2015-12-02 | 2015-12-02 | Encryption and decryption method and device applied to programmable device |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510872226.5A CN105550570A (en) | 2015-12-02 | 2015-12-02 | Encryption and decryption method and device applied to programmable device |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105550570A true CN105550570A (en) | 2016-05-04 |
Family
ID=55829757
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510872226.5A Pending CN105550570A (en) | 2015-12-02 | 2015-12-02 | Encryption and decryption method and device applied to programmable device |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105550570A (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106022006A (en) * | 2016-06-02 | 2016-10-12 | 广州麦仑信息科技有限公司 | Storage method for conducting binary representation on gene information |
| CN107070927A (en) * | 2017-04-19 | 2017-08-18 | 中国石油大学(华东) | A kind of saltus step concealed communication method encrypted based on DNA |
| CN107798219A (en) * | 2016-08-30 | 2018-03-13 | 清华大学 | Data are subjected to biometric storage and the method reduced |
| CN106055927B (en) * | 2016-05-31 | 2018-08-17 | 广州麦仑信息科技有限公司 | The binary storage method of mRNA information |
| WO2020042582A1 (en) * | 2018-08-28 | 2020-03-05 | 华为技术有限公司 | Dna data storage method and device |
| CN111279422A (en) * | 2017-10-25 | 2020-06-12 | 深圳华大生命科学研究院 | Encoding/decoding method, encoding/decoding device, and storage method and device |
| CN112242978A (en) * | 2019-07-18 | 2021-01-19 | 京东数字科技控股有限公司 | Method and device for processing data |
| CN113099234A (en) * | 2021-04-09 | 2021-07-09 | 中国矿业大学 | DNA quick coding method based on precomputation |
| CN113139203A (en) * | 2020-01-19 | 2021-07-20 | 上海臻客信息技术服务有限公司 | User information leakage prevention method |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004077206A2 (en) * | 2003-02-27 | 2004-09-10 | Koninklijke Philips Electronics N.V. | Data processing system having a plurality of processing elements, a method of controlling a data processing system having a plurality of processing elements |
| CN101706947A (en) * | 2009-11-26 | 2010-05-12 | 大连大学 | Image fusion encryption method based on DNA sequences and multiple chaotic mappings |
| CN101706946A (en) * | 2009-11-26 | 2010-05-12 | 大连大学 | Digital image encryption method based on DNA sequence and multi-chaotic mapping |
| CN103473733A (en) * | 2013-09-12 | 2013-12-25 | 东北林业大学 | Image encryption algorithm based on DNA encoding and chaotic mapping |
| CN104734848A (en) * | 2015-03-02 | 2015-06-24 | 郑州轻工业学院 | Recombinant DNA technology based information encrypting and hiding method and application |
-
2015
- 2015-12-02 CN CN201510872226.5A patent/CN105550570A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004077206A2 (en) * | 2003-02-27 | 2004-09-10 | Koninklijke Philips Electronics N.V. | Data processing system having a plurality of processing elements, a method of controlling a data processing system having a plurality of processing elements |
| CN101706947A (en) * | 2009-11-26 | 2010-05-12 | 大连大学 | Image fusion encryption method based on DNA sequences and multiple chaotic mappings |
| CN101706946A (en) * | 2009-11-26 | 2010-05-12 | 大连大学 | Digital image encryption method based on DNA sequence and multi-chaotic mapping |
| CN103473733A (en) * | 2013-09-12 | 2013-12-25 | 东北林业大学 | Image encryption algorithm based on DNA encoding and chaotic mapping |
| CN104734848A (en) * | 2015-03-02 | 2015-06-24 | 郑州轻工业学院 | Recombinant DNA technology based information encrypting and hiding method and application |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106055927B (en) * | 2016-05-31 | 2018-08-17 | 广州麦仑信息科技有限公司 | The binary storage method of mRNA information |
| CN106022006B (en) * | 2016-06-02 | 2018-08-10 | 广州麦仑信息科技有限公司 | A kind of storage method that gene information is carried out to binary representation |
| CN106022006A (en) * | 2016-06-02 | 2016-10-12 | 广州麦仑信息科技有限公司 | Storage method for conducting binary representation on gene information |
| CN107798219A (en) * | 2016-08-30 | 2018-03-13 | 清华大学 | Data are subjected to biometric storage and the method reduced |
| CN107798219B (en) * | 2016-08-30 | 2021-07-13 | 清华大学 | Method for biologically storing and restoring data |
| CN107070927B (en) * | 2017-04-19 | 2020-12-04 | 中国石油大学(华东) | Jump covert communication method based on DNA encryption |
| CN107070927A (en) * | 2017-04-19 | 2017-08-18 | 中国石油大学(华东) | A kind of saltus step concealed communication method encrypted based on DNA |
| CN111279422A (en) * | 2017-10-25 | 2020-06-12 | 深圳华大生命科学研究院 | Encoding/decoding method, encoding/decoding device, and storage method and device |
| CN111279422B (en) * | 2017-10-25 | 2023-12-22 | 深圳华大生命科学研究院 | Encoding/decoding method, encoding/decoding device, storage method and storage device |
| WO2020042582A1 (en) * | 2018-08-28 | 2020-03-05 | 华为技术有限公司 | Dna data storage method and device |
| CN112242978A (en) * | 2019-07-18 | 2021-01-19 | 京东数字科技控股有限公司 | Method and device for processing data |
| CN112242978B (en) * | 2019-07-18 | 2023-04-07 | 京东科技控股股份有限公司 | Method and device for processing data |
| CN113139203A (en) * | 2020-01-19 | 2021-07-20 | 上海臻客信息技术服务有限公司 | User information leakage prevention method |
| CN113099234A (en) * | 2021-04-09 | 2021-07-09 | 中国矿业大学 | DNA quick coding method based on precomputation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105550570A (en) | Encryption and decryption method and device applied to programmable device | |
| Sajisha et al. | An encryption based on DNA cryptography and steganography | |
| CN101447870A (en) | Safe storage method of private key based on technology of distributed password | |
| CN104333446A (en) | Novel ultra-lightweight QTL (Quasi-Transmission Line) block cipher implementation method | |
| Zhang et al. | Deciphering an image cipher based on 3-cell chaotic map and biological operations | |
| Hamad | Novel Implementation of an Extended 8x8 Playfair Cipher Using Interweaving on DNA-encoded Data. | |
| CN105007154B (en) | A kind of encrypting and decrypting device based on aes algorithm | |
| CN104348625A (en) | Encryption and decryption device and encryption and decryption method thereof | |
| CN109861809A (en) | A kind of random encipher-decipher method of grouping of functionization | |
| Anwar et al. | DNA cryptography based on symmetric key exchange | |
| Majumder et al. | Secure data communication and cryptography based on DNA based message encoding | |
| CN116418481A (en) | Text privacy data double encryption protection method, device and equipment | |
| CN103310157B (en) | Based on the image encryption method of RT-DNA cellular automaton | |
| CN109344627A (en) | A kind of novel Shannon perfection time slot scrambling | |
| Mavanai et al. | Message transmission using DNA crypto-system | |
| CN109257161A (en) | Binary data encrypts equipment and encryption method | |
| Sultana et al. | Keyless lightweight encipher using homomorphic and binomial coefficients for smart computing applications | |
| CN110061832B (en) | Method for realizing symmetric cipher algorithm using Chinese character as cipher | |
| Padmapriya et al. | A technique of data security using DNA cryptography with optimized data storage | |
| RU2503135C1 (en) | Method for cryptographic transformation of information and apparatus for realising said method | |
| Thangavel et al. | A comparative study on DNA-based cryptosystem | |
| Goyal et al. | A new modified Playfair algorithm using CBC | |
| CN105515849A (en) | Method and device for configuring programmable device, identification information and programming data flow | |
| Bevi et al. | Information Coding and its Retrieval using DNA Cryptography. | |
| Shehab et al. | An Image Encryption Technique based on DNA Encoding and Round-reduced AES Block Cipher |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 518057 Guangdong city of Shenzhen province Nanshan District high tech Industrial Park Road eight South South technology Howare Technology Building 16 Applicant after: Shenzhen Pango Microsystems Co., Ltd. Address before: 518057 Guangdong city of Shenzhen province Nanshan District high tech Industrial Park Road eight South South technology Howare Technology Building 16 Applicant before: SHENZHEN PANGO MICROSYSTEMS CO., LTD. |
|
| COR | Change of bibliographic data | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160504 |
|
| RJ01 | Rejection of invention patent application after publication |