CN105543220A - Tea tree snRNA U6 gene and application thereof - Google Patents

Tea tree snRNA U6 gene and application thereof Download PDF

Info

Publication number
CN105543220A
CN105543220A CN201610087703.1A CN201610087703A CN105543220A CN 105543220 A CN105543220 A CN 105543220A CN 201610087703 A CN201610087703 A CN 201610087703A CN 105543220 A CN105543220 A CN 105543220A
Authority
CN
China
Prior art keywords
gene
tea tree
mirna
pcr
snrna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610087703.1A
Other languages
Chinese (zh)
Inventor
韦朝领
宋慧
吴艾琳
王双双
张冉
何雅贤
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui Agricultural University AHAU
Original Assignee
Anhui Agricultural University AHAU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui Agricultural University AHAU filed Critical Anhui Agricultural University AHAU
Priority to CN201610087703.1A priority Critical patent/CN105543220A/en
Publication of CN105543220A publication Critical patent/CN105543220A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Abstract

The invention relates to a tea tree snRNA U6 gene and application thereof. The cDNA nucleotide sequence of the tea tree snRNA U6 gene is shown as SEQ ID NO:1. By means of the qRT-PCR method, reference gene screening is conducted on differently processed microRNAs (miRNA) of a tea tree, and a candidate reference gene U6 is analyzed through geNorm reference screening software. It is verified that the candidate reference gene U6 can be stably expressed in different organs of the tea tree, on different leaf positions and in different processing through Northern blot hybridization, accordingly it is proved that the expression level of the snRNA U6 gene is not affected by different organs, different leaf positions and different processing. Essential features of the reference gene are achieved, and accordingly it is also proved that the U6 gene is suitable for serving as a reference of tea tree miRNA expression analysis.

Description

Tea tree snRNA U6 gene and application thereof
Technical field
The present invention relates to biology field, specifically, relate to tea tree snRNAU6 gene and application thereof.
Background technology
SnRNA is the main component that eukaryote transcribes RNA spliceosome (Spliceosome) in post-treatment process, participates in the course of processing of mRNA precursor.SnRNAU6 is different from other snRNA in a lot.SnRNAU6 between different plant species conservative property all higher than other known snRNA.
Real-time fluorescence quantitative PCR (qRT-PCR) technology adds fluorescence dye or fluorescent probe in PCR reaction system, fluorescent signal is utilized to accumulate the whole PCR reaction process of monitoring in real time, finally by typical curve, quantitative analysis is carried out to unknown template, there is ease-to-operate, have a wide range of applications in a lot of fields.One of real-time quantitative fluorescence PCR (qRT-PCR) gene expression detection amount important prerequisite is used to be must have the gene of a stably express as internal reference.SnRNAU6 is wide expression in the various tissue of eukaryote and cell, and expression level is relatively stable, therefore, is often selected as the quantitative expression analysis of reference gene for microRNA.
Northernblot hybridization technique is the standard method of a kind of monitoring and quantitative miRNA expression level in plant, its ultimate principle is first at the upper fixing miRNA sample of carrier (as slide or nylon membrane), again with the probe hybridization through marking, after washing unnecessary hybridization probe, carry out signal detection; Also can first fix the DNA probe with the complementation of target miRNA sequence on carrier, then hybridize with the sample miRNA through marking, carrying out signal detection.Because it is highly sensitive, specificity is good and be widely applied in checking miRNA detection by quantitative.SnRNAU6 also presents and expresses stable characteristic in Northernblot crossover process, is therefore also often selected as reference gene in Northernblot hybridization.
Summary of the invention
The object of this invention is to provide tea tree snRNAU6 gene and the application thereof of the reference gene that can be used as tea tree miRNA quantitative expression analysis.
In order to realize the object of the invention, the present invention is according to the snRNAU6cDNA sequence of the plant of having announced in ncbi database, carry out sequence analysis, the snRNAU6 sequence filtering out high conservative (carries out homology contrast with the U6 gene of the plants such as corn, French beans, potato, result shows this gene and guards at different plant species camber, homology is up to 96.67%, Fig. 1).Utilize RACE technology to obtain tea tree snRNAU6 full length gene, the nucleotide sequence of its cDNA is as shown in SEQIDNO:1.
The present invention also provides described gene as the application in the reference gene of tea tree miRNA quantitative expression analysis, and the effect of reference gene corrects the experimental error existed in applied sample amount, loading process, ensures the accuracy of experimental result.
The present invention also provide according to described gene design for based on the internal reference primer in the miRNA relative quantification method of quantitative fluorescent PCR, internal reference primer sequence is as follows:
F:5′-CGGGGACATCCGATAAAATTG-3′
R:5′-GGACCATTTCTCGATTTGTGC-3′
The present invention also provides the detection kit for the miRNA relative quantification method based on quantitative fluorescent PCR containing described primer.ThermoScript II M-MLV, dNTPs, Taq DNA polymerase, Mg is also comprised in described test kit 2+, at least one in PCR reaction buffer etc.
The present invention also provides described gene as the application of the reference gene in relative quantification in the tea tree microRNA expression analysis of real-time fluorescence quantitative PCR.
The present invention also provide according to described gene design for based on the hybridization probe in the miRNA relative quantification method of Northernblot technology, probe sequence is as follows: 5'-GGGCCATGCTAATCTTCTCTGTATCGTT-3'.Be preferably digoxin labelled probe.
The present invention further provides described gene as the reference gene in relative quantification based on the application in the tea tree microRNA expression analysis of Northernblot technology.
The present invention clones the cDNA sequence obtaining tea tree snRNAU6 gene first, devise fluorescence quantification PCR primer and Northernblot digoxigenin-probe, the microRNA (miRNA) of qRT-PCR method to tea tree different treatment is adopted to carry out reference gene screening, use geNorm internal reference screening software to analyze candidate's reference gene U6, and express with Absorbable organic halogens equal in its Different Organs tea tree of Northernblot hybridization verification, various position leaves and different treatment.Thus the expression level demonstrating tea tree snRNAU6 gene is not subject to the impact of Different Organs, various position leaves and different treatment, meets the essential characteristic as reference gene, can be used as the reference gene of tea tree microRNA expression analysis.
The present invention has the following advantages:
(1) method provided by the invention is applicable to the expression analysis of tea tree miRNA, and operation is relatively simple, and cost is lower, highly sensitive.
(2) the present invention clone obtains tea tree snRNAU6 gene complete sequence, can be used for the reference gene of the quantitative expression analysis of miRNAqRT-PCR.By geNorm software analysis, the M value of snRNAU6 gene is less than 1.5, thus circumstantial evidence U6 gene is suitable as the internal reference of miRNA expression analysis.
(3) tea tree snRNAU6 gene of the present invention can be used for the reference gene in miRNANorthernblot technology, and it is not by the impact of Different Organs, various position leaves and different treatment, and expression amount is constant.
Accompanying drawing explanation
Fig. 1 is tea tree snRNAU6 gene and corn, French beans, potato, oranges and tangerines U6 genetic homology comparison result in the embodiment of the present invention 1.
Fig. 2 is the melting curve figure of U6 internal reference primer extension product in the embodiment of the present invention 2.
Fig. 3 is that the qRT-PCR amplified production of U6 in the embodiment of the present invention 2 is through 2.5% agarose gel electrophoresis detected result; Wherein, M is DNA molecular amount standard, and 1-4 is amplified production, and electrophoresis result display is without non-specific amplification.
Fig. 4 is Cq value and Log (initial template copy number) graph of a relation in the embodiment of the present invention 2.
Fig. 5 utilizes geNorm software analysis tea tree snRNAU6 internal reference stability result in the embodiment of the present invention 3.
Fig. 6 utilizes tea tree snRNAU6 gene internal reference to the Northernblot result under tea tree Different Organs, various position leaves and different treatment in the embodiment of the present invention 4.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.If do not specialize, embodiment is experiment condition all conveniently, as Sambrook equimolecular Cloning: A Laboratory Manual (SambrookJ & RussellDW, Molecularcloning:alaboratorymanual, 2001) condition of, or according to manufacturer's specification sheets advising.
The acquisition of embodiment 1 tea tree snRNAU6 gene
According to the snRNAU6cDNA sequence of the plant of having announced in ncbi database, carry out sequence analysis, filter out the snRNAU6 sequence of high conservative, at its conservative region design primer, RACE technology is utilized to obtain tea tree snRNAU6 full length gene, its nucleotide sequence is as shown in SEQIDNO:1, and sequence information is as follows:
Sequence signature
Length: 105nt
Type: nucleic acid
Molecule type: cDNA
Property name: snRNA (1-105)
Source: tea tree
Sequence description:
GTCCCTTCGGGGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCACAAATCGAGAAATGGTCCAAATTTTTTT
According to the sequence analysis of other species (carrying out homology contrast, Fig. 1 with the U6 gene of the plant such as corn, French beans, potato), result shows this gene at different plant species camber and guards, and homology is up to 96.67%.
The qRT-PCR primer of embodiment 2 tea tree snRNAU6 gene
Utilize PrimerPremier5 software, design a pair fluorescent quantitation primer according to the cDNA sequence of tea tree snRNAU6 gene.This is high to primer specificity, and amplification efficiency is 97.3%, and normal amplification efficiency scope is 95%-105%, primer sequence following (SEQIDNO:2-3):
F:5′-CGGGGACATCCGATAAAATTG-3′
R:5′-GGACCATTTCTCGATTTGTGC-3′
This is as follows to the specific embodiments of primer PCR amplification:
1, experiment material: the tea shoot kind used in the present embodiment relaxes tea early for breeding, life in 2 years from Liuan City, Anhui Province Shucheng County 916 tea plantation are relaxed tea cuttage seeding morning.
Test sheet:
(1) different treatment of blade:
1. tea geometrid takes food process: get two ages, three age tea geometrid larvae be discharged on the blade that launches completely tea shoot 2-3 position, till treating that the blade of 1/3 is taken food.
2. mechanical treatment: the medical scissors crossed by sterilization aseptically process, along the edge of tea leaf, the mode that imitation tea geometrid takes food and speed, cut off leaf tissue, until cut off 1/3 of blade.
3. 100 μMs of ABA (dormin) solution-treated: spray in the tea leaf back side with ABA dissolution homogeneity.
4. 1mMMeJA (methyl jasmonate) solution-treated: spray in the tea leaf back side with MeJA dissolution homogeneity, above process is all at 6h post-sampling.
Through above-mentioned different treatment, all gather the blade of same position, and put into liquid nitrogen rapidly, be placed in-80 DEG C of refrigerator storage for subsequent use.
(2) to the sampling of tea leaf various position leaves, bud, a leaf, two leaves, three leaves, four leaves, five leaves are gathered respectively.
(3) tea tree Different Organs is sampled, gather flower, fruit, root, leaf respectively.
2, RNA extracts
The smallRNAs (RNA of small-molecular-weight) extracting < 200nt with miRcutemiRNAisolationkit (test kit is purchased from Tian Gen company) is for subsequent use as sample.By specification operation is carried out.
1) homogenized: will be organized in liquid nitrogen and grind.Every 100mg plant tissue adds 1ml lysate MZ, and sample volume should not exceed 1/10th of lysate MZ volume.
2) measure transfer liquid to amass, slowly add the dehydrated alcohol that transfer liquid amasss 1.5 times, mixing.Proceed in adsorption column miRspin by the solution obtained together with precipitation, the centrifugal 30sec of room temperature 12000rpm, if once complete soln and mixture can not be added adsorption column miRspin, please proceeds at twice, discards effluent liquid after centrifugal, retains adsorption column miRspin.
3) in adsorption column miRspin, add 500 μ l protein liquid removal MRD, room temperature leaves standstill 2min, and the centrifugal 30sec of room temperature 12000rpm, abandons waste liquid.
4) in adsorption column miRspin, add 600 μ l rinsing liquid RW, room temperature leaves standstill 2min, and the centrifugal 30sec of room temperature 12000rpm, abandons waste liquid.
5) repetitive operation step 4)
6) adsorption column miRspin is put into 2ml collection tube, room temperature 12000rpm, centrifugal 1min, remove residual liquid.
7) adsorption column miRspin is proceeded to a new RNase-Free1.5ml centrifuge tube, add 30 ~ 100 μ lRNase-FreeddH 2o, room temperature places the centrifugal 2min of 2min, room temperature 12000rpm, obtains RNA solution.
3, the synthesis of the first chain cDNA
With rTreagentKit test kit add to specifications the smallRNAs that step 2 is obtained add stem ring after reverse transcription become cDNA sequence.
1) 10 μ l reaction systems are prepared: 0.5 μ lRandom6mers, 2 μ l5 × PrimeScriptBuffer, 0.5 μ l stem ring primer, 0.1 μ l ThermoScript II M-MLV, 5.9 μ lRNaseFreeH 2o, 1 μ l (100ng/ μ l) smallRNAs.
2) reaction conditions: the reaction soln of mixing is placed in 65 DEG C of heating 5min, puts into ice 2min afterwards.Be placed on BioRadPCR instrument (PCR instrument is purchased from BioRad company) 16 DEG C of 30min; 30 DEG C of 30sec; 42 DEG C of 30sec; 50 DEG C of 1sec; Circulate 60 times; 85 DEG C of 5min; 16 DEG C of preservations.
4, qRT-PCR reaction
1) 10 μ l reaction systems: 5 μ l premixExTaq tMiI kit (TaKaRa), 0.5 μ lcDNA, 2.5 μ lddH 2o, 0.01nM primers F and each 1 μ l of R.
2) pcr amplification program is: 95 DEG C of denaturation 30sec; 95 DEG C of sex change 3sec, 58 DEG C of renaturation 30sec, circulate 40 times; Instrument makes melting curve automatically.
3) by observing the melting curve (Fig. 2) of CFX96realtimedetectionsystemPCR instrument generation after PCR reaction for unimodal, this is judged to primer without non-specific amplification; And, see that glue instrument is taken pictures by ultraviolet, observe qRT-PCR band single after 95V electrophoresis 30min with the qRT-PCR product of 2 μ l in 2.5% sepharose, thus determine that this is to primer special amplification (Fig. 3) nothing but further.
4) RNaseFreeddH is used 2first chain cDNA template of the O5 times of above-mentioned preparation of gradient dilution, carries out real time fluorescent quantitative qRT-PCR according to step 4.Suppose that the highest template concentrations is 1000000 copies, Cq value (cycle number experienced when fluorescent signal namely in each reaction tubes arrives the threshold value of setting) and the relation of Log (initial template copy number) are mapped (Fig. 4, R 2for relation conefficient), slope=-3.389, amplification efficiency (E)=10 -1/ slope -1, calculate amplification efficiency E=0.973.
Embodiment 3 tea tree snRNAU6 gene is as the expression stability analysis (based on qRT-PCR method) of reference gene
Using miR159a, miR6149, miR5368n, U4,5S, 5.8S, U6 as tea tree miRNAqRT-PCR candidate reference gene, respectively stability expression analysis is carried out to above-mentioned candidate's reference gene.First quantitative fluorescent PCR raw data is analyzed, calculate the average Cq value of each gene, then Cq value is converted into relative quantification data, adopt geNorm software to be further analyzed, and comprehensive evaluation is carried out to the expression stability of reference gene.
GeNorm program progressively can remove the least stable reference gene of expression, and calculate each reference gene of each step average expression stability numerical value M, when only having M<1.5, this gene just can use as reference gene, and M value is less, genetic expression more stable (Fig. 5).
Result shows, tea tree snRNAU6 gene is suitable as the reference gene of the tea tree miRNAqRT-PCR method in tea tree different treatment situation.
Embodiment 4 tea tree snRNAU6 gene as internal reference to tea tree miRNA quantitative expression (based on Northernblot technology)
Under tea tree Different Organs, different treatment and various position leaves, use miRNANorthernblot method to verify, result shows that tea tree U6 stable gene does not rely on the change of experiment condition, can be used as the reference gene of tea tree miRNANorthernblot method.
Northernblot techniqueflow is as follows:
1, main agents: miRcutemiRNAisolationkit is purchased from Tian Gen company; DEPC, BCIP, NBT available from Sigma; NylonMembrances purchased from American GEAmersham; Gelloadingbuffer II is purchased from Ambion company; DIGWashandBlockBufferSet, DIGEasyHybGranules, Antidigoxigenin-AP etc. are purchased from German Roche company.
2, working method:
1) experiment material and RNA extraction method are with embodiment 2.Mixed with 2 × loadingbuffer of Ambionlife company by 3 ~ 4 μ gsmallmiRNA, the water used in whole experimentation is the DEPC water after sterilizing.
2) sex change: boil 2min in boiling water, puts 2min on ice immediately.
3) with 14% polyacrylamide glue leakage of electricity swimming.
4) electrophoresis carries out in ice bath, with 1 × TBE as electrophoretic buffer.
5) about 3 ~ 4 hours glue time is run.
3, Northern offset plate is made:
Table 1Northern glue formula
According to the formulated Northern glue of table 1, the equipment of Northern glue processed is all with DEPC process, and agents useful for same all uses DEPC water to prepare.After gelling admittedly, sheet glass short slab inwardly, and short slab fastening glue frame groove, tightly puts into electrophoresis chamber (water jacket is on the rocks) with holding.With the liquid-transfering gun of 100 μ l, glue impurity broken in glue hole is blown out, then use 10 μ l rifles instead, carry out application of sample.
(1) electrophoresis
The RNA of extraction is put into after well heater arranges 100 DEG C of 5min, put cooled on ice 10min rapidly, then loading.Electrophoresis, first with 5mA, treats that electric current is heightened (maximum 30mA) by sample Article 1 band offset plate 3/4 moment of passing by.
(2) transferring film
Electrophoresis terminates rear taking-up offset plate and cuts no part, the NC film getting corresponding size soaks 2 minutes in TBE, according to the order of negative pole-sponge-glue-film-sponge-positive pole, glue and film are placed, put into electric turn trough, be 1 × tbe buffer liquid in inside groove, water jacket is mixture of ice and water, and the time is strict controlled in 1 hour.
(3) UV-crosslinked with hybridization
After transferring film terminates, film is placed on PE gloves, first film front uv irradiating 2min, then film reverse side uv irradiating 2min.Film is placed in 15ml centrifuge tube, adds hybridization solution (DIGEasyHybGranules) the prehybridization 30-60min of 5ml42 DEG C of preheating.Renew fresh hybridization solution after prehybridization terminates, the probe hybridization adding 10 μ l digoxigenin labeleds spends the night.
(4) blockade
Film is placed on plate shakes with Washingsolution and washes 3 times, each 5-10min.Add blockingbuffer (as added the horse Lay acid of 90ml in the blockingbuffer of 10ml) and hatch 1-4h.
(5) digoxin antibody in combination
Namely Anti-Digoxigenin-Ap is made into antibodysolution according to the dilution proportion of 1:10000 in blockingsolution.Blockade after terminating, outwell confining liquid, add antibodysolution, in plate, hatch 1-4h.
(6) balance film
Film is washed 3 times, each 10min with Washingsolution.With Detectionbuffer balance film 2min, then add nitrite ion.Detectionbuffer, NBT, BCIP of configuring are mixed according to the ratio of 10ml, 32 μ l, 16 μ l, notes keeping in Dark Place.
(7) develop the color
After membrane equilibrium, outwell Detectionbuffer, film and plate are put into lucifuge place and adds nitrite ion, lucifuge develops the color.
Experimental result is as shown in 6 figure, and result shows that tea tree snRNAU6 gene is suitable as the reference gene of tea tree miRNANorthern hybridization.
Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.

Claims (9)

1. tea tree snRNAU6 gene, is characterized in that, the nucleotide sequence of its cDNA is as shown in SEQIDNO:1.
2. gene described in claim 1 is as the application in the reference gene of tea tree miRNA quantitative expression analysis.
3. according to claim 1 gene design for based on the internal reference primer in the miRNA relative quantification method of quantitative fluorescent PCR, it is characterized in that, internal reference primer sequence is as follows:
F:5′-CGGGGACATCCGATAAAATTG-3′
R:5′-GGACCATTTCTCGATTTGTGC-3′。
4. gene described in claim 1 is as the application of the reference gene in relative quantification in the tea tree microRNA expression analysis of real-time fluorescence quantitative PCR.
5. the detection kit for the miRNA relative quantification method based on quantitative fluorescent PCR containing primer described in claim 3.
6. test kit according to claim 5, is characterized in that, also comprises ThermoScript II M-MLV, dNTPs, Taq DNA polymerase, Mg in described test kit 2+, at least one in PCR reaction buffer.
7. according to claim 1 gene design for based on the hybridization probe in the miRNA relative quantification method of Northernblot technology, it is characterized in that, probe sequence is as follows:
5'-GGGCCATGCTAATCTTCTCTGTATCGTT-3'。
8. probe according to claim 7, is characterized in that, it is digoxin labelled probe.
9. gene described in claim 1 as the reference gene in relative quantification based on the application in the tea tree microRNA expression analysis of Northernblot technology.
CN201610087703.1A 2016-02-16 2016-02-16 Tea tree snRNA U6 gene and application thereof Pending CN105543220A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610087703.1A CN105543220A (en) 2016-02-16 2016-02-16 Tea tree snRNA U6 gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610087703.1A CN105543220A (en) 2016-02-16 2016-02-16 Tea tree snRNA U6 gene and application thereof

Publications (1)

Publication Number Publication Date
CN105543220A true CN105543220A (en) 2016-05-04

Family

ID=55822778

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610087703.1A Pending CN105543220A (en) 2016-02-16 2016-02-16 Tea tree snRNA U6 gene and application thereof

Country Status (1)

Country Link
CN (1) CN105543220A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108034657A (en) * 2018-01-31 2018-05-15 山东省葡萄研究院 A kind of grape snRNA U6 genes and its primer and application
CN108424913A (en) * 2018-04-23 2018-08-21 山东省农业科学院蔬菜花卉研究所 Muskmelon U6 genes and its application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105132417A (en) * 2015-09-07 2015-12-09 安徽农业大学 Tea tree miRNA fluorescent quantitative PCR reference gene under low temperature stress as well as screening method and application of reference gene

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105132417A (en) * 2015-09-07 2015-12-09 安徽农业大学 Tea tree miRNA fluorescent quantitative PCR reference gene under low temperature stress as well as screening method and application of reference gene

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
封冰等: "小菜蛾U6 snRNA基因的克隆及作为miRNA定量表达分析内参基因的评价", 《昆虫学报》 *
谢小芳等: "茶树低温胁迫下microRNA实时定量PCR内参基因的筛选", 《茶叶科学》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108034657A (en) * 2018-01-31 2018-05-15 山东省葡萄研究院 A kind of grape snRNA U6 genes and its primer and application
CN108424913A (en) * 2018-04-23 2018-08-21 山东省农业科学院蔬菜花卉研究所 Muskmelon U6 genes and its application

Similar Documents

Publication Publication Date Title
Kou et al. Selection and validation of suitable reference genes for miRNA expression normalization by quantitative RT-PCR in citrus somatic embryogenic and adult tissues
Feng et al. Selection of suitable inner reference genes for relative quantification expression of microRNA in wheat
Luo et al. Genome-wide transcriptome analysis of Chinese pollination-constant nonastringent persimmon fruit treated with ethanol
Dombrowski et al. Evaluation of reference genes for quantitative RT-PCR in Lolium temulentum under abiotic stress
Bester et al. Differential expression of miRNAs and associated gene targets in grapevine leafroll-associated virus 3-infected plants
CN107400715B (en) Development and application of special molecular marker and probe of decaploid elytrigia elongata
CN104178585A (en) Potato virus detection primers and potato virus detection method
CN106521024A (en) Medicago-truncatula-gaertn microRNA-SSR molecular marker primer and application to alfalfa variety identification
CN104480202A (en) Towel gourd reference gene and application thereof
CN103924000A (en) LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant
CN105543220A (en) Tea tree snRNA U6 gene and application thereof
CN102304587A (en) Method for rapidly identifying erect panicle of rice
CN106701960A (en) Medicago sativa.L ILP (Intron Length Polymorphism) molecular marker primer and application in Medicago sativa.L variety identification
Fulvio et al. Selection and validation of reference genes for RT-qPCR normalization in different tissues of milk thistle (Silybum marianum, Gaert.)
Echevarría-Zomeño et al. Simple, rapid and reliable methods to obtain high quality RNA and genomic DNA from Quercus ilex L. leaves suitable for molecular biology studies
CN103773867A (en) LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method
Song et al. Differential expression of microRNAs may regulate pollen development in Brassica oleracea
CN108396026B (en) Development and application of tenfold-length scion elytrigia repens blue-particle trait specialized molecular marker and fluorescent in-situ hybridization probe
Li et al. Selection of reference genes for quantitative real-time PCR normalization in Narcissus pseudonarcissus in different cultivars and different organs
CN107893129A (en) The method for detecting apple green wrinkle fruit disease poison
CN106755389B (en) For identifying the gene order and its application of tapiscia sinensis gender
CN101812445B (en) Kit for quickly extracting paddy DNA
KR101144988B1 (en) SCAR markers for discrimination of apple cultivars and use thereof
WO2016090965A1 (en) Hmg1 gene and uses thereof in microsporidium molecular detection
Falistocco et al. Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana)

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20160504

RJ01 Rejection of invention patent application after publication