CN105535013A - Application of gracilariopsis lemaneiformis polysaccharide - Google Patents
Application of gracilariopsis lemaneiformis polysaccharide Download PDFInfo
- Publication number
- CN105535013A CN105535013A CN201610082951.7A CN201610082951A CN105535013A CN 105535013 A CN105535013 A CN 105535013A CN 201610082951 A CN201610082951 A CN 201610082951A CN 105535013 A CN105535013 A CN 105535013A
- Authority
- CN
- China
- Prior art keywords
- polysaccharide
- thallus gracilariae
- cell
- apply
- apoptosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/88—Liliopsida (monocotyledons)
- A61K36/90—Smilacaceae (Catbrier family), e.g. greenbrier or sarsaparilla
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/88—Liliopsida (monocotyledons)
- A61K36/896—Liliaceae (Lily family), e.g. daylily, plantain lily, Hyacinth or narcissus
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
- C08B37/006—Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence; Gellans; Succinoglycans; Arabinogalactans; Tragacanth or gum tragacanth or traganth from Astragalus; Gum Karaya from Sterculia urens; Gum Ghatti from Anogeissus latifolia; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/30—Extraction of the material
- A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
- A61K2236/331—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones using water, e.g. cold water, infusion, tea, steam distillation, decoction
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/50—Methods involving additional extraction steps
- A61K2236/51—Concentration or drying of the extract, e.g. Lyophilisation, freeze-drying or spray-drying
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/50—Methods involving additional extraction steps
- A61K2236/53—Liquid-solid separation, e.g. centrifugation, sedimentation or crystallization
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/50—Methods involving additional extraction steps
- A61K2236/55—Liquid-liquid separation; Phase separation
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Alternative & Traditional Medicine (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Botany (AREA)
- Medical Informatics (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Organic Chemistry (AREA)
- Polymers & Plastics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Materials Engineering (AREA)
- Biochemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses an application of gracilariopsis lemaneiformis polysaccharide in preparing a preparation for inducing expression of FADD and GADD genes in cells. The gracilariopsis lemaneiformis polysaccharide preparation can obviously induce the apoptosis of tumor cells, and has an effect of inducing apoptosis of human stomach cancer, lung cancer and murine melanoma cells. Specifically, the gracilariopsis lemaneiformis polysaccharide preparation can serve as an apoptosis inducer. The gracilariopsis lemaneiformis polysaccharide preparation disclosed by the invention has an application prospect in preparation of antitumor drugs or anti-cancer health products, and also provides a new choice for development of medicaments for treating or preventing tumors.
Description
Technical field
The invention belongs to biomedicine technical field, relate to a kind of tangleweed source as the Thallus Gracilariae polysaccharide of cell death inducer and the application in antitumor thereof, be specifically related to a kind of to extract in red algae Thallus Gracilariae and the polysaccharide of purification, it has the up-regulated impelling apoptosis-inducing related gene FADD and GADD, and the effect of final inducing apoptosis of tumour cell.
Background technology
From development original new drug angle, the research of marine drug is one of the focus and important directions of developing with Chinese medicine the new type natural active medicine being source.Tangleweed Thallus Gracilariae (Gracilariopsislemaneiformis) is Rhodophyta, true Rhodophyceae, Gigartinales, Gracilaria tenuistipitata section, Gracilaria, be mainly distributed in the coastal areas such as China Shandong, Liaoning, Jiangsu, Fujian, Hainan.Thallus Gracilariae nature and flavor are sweet, mainly enter Liver Channel, have aid digestion, to separate long-pending greasy, bowel relieving harmonization of the stomach hemostasis blood pressure lowering, softening and eliminating sputum, clearing away heat and promoting diuresis, antalgic effect.Thallus Gracilariae is rich in active polysaccharide, phycoerythrin and dietary fiber and nutrient etc., has various biological activity and the medicinal health effects such as immunoregulatory activity, antitumor, antioxidation, antiviral.Thallus Gracilariae polysaccharide is as marine pharmaceutical resource, there is good antitumous effect, there is no obvious toxic and side effects simultaneously, this dual function is conducive to Comprehensive Treatment and the rehabilitation of tumour patient, be suitable for drug combination, be worth researching and developing into Pharmaceutical Polysaccharides or health product polysaccharide further, to improve the economic use value of Thallus Gracilariae.
The immortality of tumor cell is one of marked feature of tumor.Theory of Chinese medical science thinks that the generation of cancer may be because body yin and yang imbalance causes.Cell proliferation and the dead wane and wax of yin and yang being similar to the traditional Chinese medical science, it is one of reason of causing cancer to occur that this wane and wax of yin and yang balance is broken.Apoptosis is one of important channel of Normal cell death, but in a lot of tumor tissues, apoptosis is often out of hand, the generation development of tumor and apoptosis out of control closely related.Apoptosis is the target spot of a lot of cancer therapy drug.The albumen participating in apoptosis regulation has a lot, Fas associated death domain protein (Fasassociateddeathdomain, FADD) be a class adaptor proteins important in death receptor pathway *, it can by the apoptosis signal transduction after Fas/FasL combination to downstream albumen, activate Caspase8 and cause downstream Caspase3 and Caspase6 cascade reaction, thus causing apoptosis.On the other hand, when cell is subject to extraneous factor damage, retarded growth and DNA damage gene (growtharrestandDNAdamagegene, GADD) high expressed is induced, and then repair related gene by raising the DNA damage such as P21, P27, P57, activation P38 and JNK path effectively promotes apoptosis.This development for treatment tumor newtype drug provides new approaches, and also enriched the theory of Chinese medicine right supporting anticancer, the treatment being further used for tumor for China's Chinese Traditional Medicine provides theoretical foundation.
Be a kind of easy acquisition in view of Thallus Gracilariae and grow fast marine algae resource, in order to make full use of this algae resource, those skilled in the art is devoted to the purposes opening up its bioactive substance further.
Summary of the invention
In order to open up the purposes of Thallus Gracilariae polysaccharide further, the invention provides the application of Thallus Gracilariae polysaccharide in the preparation of the expression for the preparation of FADD and the GADD gene in inducing cell.
Further, the preparation method of the Thallus Gracilariae polysaccharide in said method is: utilize trichloroacetic acid method to extract from Thallus Gracilariae (Gracilariopsislemaneiformis), comprise the following steps:
1) with water dissolution Thallus Gracilariae dry powder, and regulate pH value of solution to 9-11 with NaOH, centrifugal acquisition first supernatant and the first precipitation;
2) in step 1) in add water dissolution in centrifugal the first precipitation obtained, and regulate pH value of solution to 9-11 with NaOH, and recentrifuge, obtains the second supernatant;
3) merge the first supernatant and the second supernatant, and add trichloroacetic acid and precipitate, centrifugal acquisition the 3rd supernatant;
4) in the 3rd supernatant, add dehydrated alcohol to precipitate, centrifugal acquisition second precipitates;
5) precipitate with washing with acetone second, and lyophilization, obtain and slightly carry Thallus Gracilariae polysaccharide;
6) by step 5) in slightly to carry Thallus Gracilariae polysaccharide water-soluble, carry out stepwise elution by ion exchange column, after vacuum drying, obtain the Thallus Gracilariae polysaccharide of purification.Preferably, ion exchange column is DEAESephadexA-25 ion exchange column; Stepwise elution is carried out with distilled water, 0.3mol/LNaCl and 1.2mol/LNaCl solution; Obtain 3 kinds of fraction after stepwise elution, the most significant fraction is carried out subsequent experimental as the Thallus Gracilariae polysaccharide of purification.
Preferably, step 1) and step 2) in, regulate pH value of solution to 10 with NaOH.
Further, step 3) in the mass concentration of trichloroacetic acid that adds be 2%-5%.The mass concentration of preferred trichloroacetic acid is 3%.
Further, the monosaccharide components of the Thallus Gracilariae polysaccharide in above-mentioned application is D-galactose and 3,6-inner ether galactose.
Preferably, above-mentioned D-galactose content is 25%-30%, and described 3,6-inner ether galactose contents are 27%-34%.
Further, above-mentioned D-galactose content is 27.36%, and described 3,6-inner ether galactose contents are 29.38%.
Above-mentioned preparation provided by the invention, preferably, as cell death inducer.
Further, above-mentioned cell is tumor cell.
Further, the apoptosis of described tumor cell is induced in above-mentioned application by the expression of induction FADD and GADD gene.
Further, the above-mentioned tumor one that to be tumor cell be in gastric carcinoma cells, human lung carcinoma cell, mouse melanin tumor cell.
The Thallus Gracilariae of applying in the present invention is rich in active polysaccharide, there is the function of inducing apoptosis of tumour cell, it is a kind of new cell death inducer, there is anti-tumor biological and medical value, can further medicine source be enriched, the Thallus Gracilariae polysaccharide of safety non-toxic is developed as antitumor drug or prevention and health care product.
Be described further below with reference to the technique effect of accompanying drawing to design of the present invention, concrete structure and generation, to understand object of the present invention, characteristic sum effect fully.
Accompanying drawing explanation
Fig. 1 is the extraction of Thallus Gracilariae polysaccharide, the result schematic diagram of purification of a preferred embodiment of the present invention.
Fig. 2 is the photo of the Microscopic observation morphological change of the Thallus Gracilariae polysaccharide induced apoptosis in gastric cancer of a preferred embodiment of the present invention;
Fig. 3 is the Thallus Gracilariae polysaccharide DAPI staining examine induction apoptosis in gastric cancer of a preferred embodiment of the present invention and the photo of DNA damage;
Fig. 4 is that the two dye of Thallus Gracilariae polysaccharide AnnexinV-FITC/PI of a preferred embodiment of the present invention detects the photo of inducing apoptosis in gastric cancer state;
Fig. 5 is the result schematic diagram of the apoptosis rate of the Thallus Gracilariae polysaccharide Flow cytometry induction stomach cancer cell of a preferred embodiment of the present invention;
Fig. 6 is the result schematic diagram of the up-regulated of Thallus Gracilariae polysaccharide RT-qPCR detection induction Cell Apoptosis Relative Gene In Human Gastric Carcinoma FADD and GADD of a preferred embodiment of the present invention;
Fig. 7 is the photo of the Microscopic observation morphological change of the Thallus Gracilariae polysaccharide induced Increase Apoptosis of Lung Cancer Cells of a preferred embodiment of the present invention;
Fig. 8 is the Thallus Gracilariae polysaccharide DAPI staining examine induction Increase Apoptosis of Lung Cancer Cells of a preferred embodiment of the present invention and the photo of DNA damage;
Fig. 9 is that the two dye of Thallus Gracilariae polysaccharide AnnexinV-FITC/PI of a preferred embodiment of the present invention detects the photo of inducing Increase Apoptosis of Lung Cancer Cells state;
Figure 10 is the result schematic diagram of the apoptosis rate of the Thallus Gracilariae polysaccharide Flow cytometry induction lung carcinoma cell of a preferred embodiment of the present invention;
Figure 11 is that the Thallus Gracilariae polysaccharide RT-qPCR of a preferred embodiment of the present invention detects the result schematic diagram of inducing Increase Apoptosis of Lung Cancer Cells related gene FADD and GADD gene expression to raise;
Figure 12 is the photo of the Microscopic observation morphological change of the Thallus Gracilariae polysaccharide induced mouse melanin tumor cell apoptosis of a preferred embodiment of the present invention;
Figure 13 is the result schematic diagram of the apoptosis rate of the Thallus Gracilariae polysaccharide Flow cytometry inducing mouse melanoma cell of a preferred embodiment of the present invention;
Figure 14 is the Thallus Gracilariae polysaccharide RT-qPCR detection inducing mouse melanoma FADD of a preferred embodiment of the present invention and the result schematic diagram of GADD gene expression rise.
Detailed description of the invention
The various reagent used in the present invention, except there being special mark, all directly can buy acquisition.
Thallus Gracilariae polysaccharide of the present invention extracts from class red algae plant Thallus Gracilariae (Gracilariopsislemaneiformis) and the polysaccharide that obtains of preliminary purification, and Thallus Gracilariae picks up from Wenzhou District of Zhejiang Province.
The extraction of embodiment 1 Thallus Gracilariae polysaccharide and purification
Extract: Thallus Gracilariae picks up from Wenzhou District of Zhejiang Province in October, 2014, through repeatedly cleaning, removing the foreign material such as silt, pulverizing of drying in the shade, freshness protection package stored refrigerated.Take 100g Thallus Gracilariae dry powder, add 700mLddH
2o, with in NaOH and regulate pH to 10.In the water-bath of 80 DEG C, be incubated 4 hours, period intermittently stirs.By above-mentioned solution in the centrifugal 15min of 8000rpm/min, get supernatant.For reducing polysaccharide loss, in precipitation, add 5mLddH again
2o, and with NaOH regulate pH to 10, in 80 DEG C of water-baths be incubated 4 hours, period intermittently stirs, then by solution in the centrifugal 15min of 8000rpm/min, again get supernatant.The supernatant of first time and the centrifugal acquisition of second time is merged to improve polysaccharide extract rate, with careless acid for adjusting pH to 7,3% and the isopyknic trichloroacetic acid (Trichloroaceticacid of polysaccharide aqueous extract is dripped in polysaccharide Aqueous extracts, TCA), mixing, in 25 DEG C of standing 1h, the solution after being precipitated by TCA removes gelatinous precipitate after the centrifugal 15min of 8000rpm/min, obtains protein-free polysaccharide.Precipitate 2 times with washing with acetone, lyophilization obtains white powder and slightly carries Thallus Gracilariae polysaccharide.
Purification: the Powdered polysaccharide of slightly carrying extracted by said method is answered water-soluble, get 3ml sample and cross DEAESephadexA-25 ion exchange column, gradient elution is carried out with distilled water and 3mol/LNaCl solution, flow velocity 0.5ml/min, often pipe 5ml collects 100 pipes, measures often pipe polysaccharide concentration by anthrone-sulfuric acid process.On this basis, then use distilled water, 0.3mol/LNaCl and 1.2mol/LNaCl solution stepwise elution, flow velocity 0.5ml/min, often pipe 5ml collects, and after eluent concentrating under reduced pressure higher for sugar content, dialysis is desalted, and vacuum drying obtains each polysaccharide component.Result shows: utilize DEAE-SephadexA-25 ion exchange column to carry out stepwise elution, can obtain 3 obvious absworption peaks (Fig. 1), shows that the Thallus Gracilariae polysaccharide extracted in this embodiment of the present invention and purification obtains at least contains 3 kinds of fraction.Collect this 3 kinds of fraction, successively called after P-1, P-2 and P-3,3 kinds of fraction account for the ratio difference 3.56%, 69.37%, 18.29% of applied sample amount.The most significant fraction P-2 obtained after above-mentioned vacuum drying is added ddH
2o is made into 1mg/mL mother solution, filtration sterilization, subpackage, and 4 DEG C save backup.
The method of monosaccharide component and assay thereof and result in embodiment 2 Thallus Gracilariae polysaccharide
1. the determination step of monosaccharide component in polysaccharide:
1) hydrolysis of polysaccharide: the Thallus Gracilariae polysaccharide sample getting 4.85mg embodiment 1 obtained is placed in 25mL reaction bulb, adds 2mol/L trifluoroacetic acid aqueous solution 4mL, heated and stirred 3 hours in 98 DEG C of brine baths.In reactant liquor, add water pump vacuum rotary steam at 3mL methanol 40 DEG C, after steaming without obvious liquid, then add 3mL methanol and reduce pressure, repeat operation 5 times.Finally, by thorough for the water in residue lyophilizing.
2) column front derivation of sugared sample: polysaccharide hydrolysis thing and D-galactose; 3; 6-inner ether galactose standard substance carry out sugared nitrilation, acetylizad column front derivation; concrete grammar is: the sugared sample getting 0.4-5mg; mix with 10mg oxammonium hydrochloride., 0.6mL pyridine; capping bottle, is placed in 90 DEG C of water-bath heating 30 minutes.After mixture is chilled to room temperature, then add 1.0mL acetic anhydride, capping bottle, be again placed in 90 DEG C of water-bath heating 30 minutes, obtain the test sample of GC-MS.
3) GC-MS detects: sample corresponding to polysaccharide hydrolysis thing is with the molecular weight of mass detector detected components, and the sample corresponding with standard monosaccharide is compared, (comprising molecular weight and retention time) is to determine component.
2. the determination step of contents of monosaccharides in polysaccharide:
1) drafting of standard curve:
A) standard solution of gradient concentration is configured: accurate weighing 10.0mgD-galactose and 10.0mg3,6-inner ether galactose standard substance are dissolved in 20mL deionized water, obtain 0.4mg/mL standard solution with 25mL volumetric flask standardize solution.Get 1 respectively, 2,3,4,5mL is placed in 5 10mL reaction bulbs and thoroughly lyophilizing.
B) column front derivation of sugared sample: get the test sample that operation that above-mentioned lyophilized products repeats the column front derivation of sugared sample obtains 5 GC-MS.
C) GC-MS detects: according to the peak area fit standard curve of mass spectrum response.
2) content of monosaccharide in polysaccharide: the absolute mass being calculated monosaccharide component in polysaccharide hydrolysis thing by standard curve, calculates the content of monosaccharide component, shown in result table 1 relative to polysaccharide gross mass:
The key component of monosaccharide and content in table 1 Thallus Gracilariae polysaccharide hydrolysis thing
| Monosaccharide component | Retention time | Type | Width | Area | Time started | End time | Content % |
| 3,6 inner ether galactose | 12.463 | rm | 0.344 | 7337566 | 12.361 | 12.704 | 27.3606 |
| D-galactose | 15.986 | rm | 0.967 | 105120930 | 15.792 | 16.759 | 29.3845 |
Analysis result shows, the principal monosaccharides composition of Thallus Gracilariae polysaccharide is D-galactose and 3,6-inner ether galactose.Wherein D-galactose content is 27.36%, 3,6-inner ether galactose content is 29.38%.
Embodiment 3 Thallus Gracilariae polysaccharide is as the detection method of inducing apoptosis of tumour cell derivant
(1) morphological change of Microscopic observation cell
Take the logarithm the tumor cell of trophophase, with 0.25% trypsinization, counting, with the RPMI-1640 culture fluid diluting cells containing 10% hyclone, making concentration is 1x10
5individual cells/well, is inoculated in 6 orifice plates being equipped with sterilizing slide.After cell attachment 24h, add Thallus Gracilariae polysaccharide effect 48h and 72h of 0mg/ml and IC50 respectively in tumor cell.Two groups of cellular morphology changes are observed under inverted phase contrast microscope.
(2) DAPI staining examine DNA damage
Need before dyeing to use paraformaldehyde fixed cell, operate as follows: PBS rinses each group of cell 2-3 time gently, add the paraformaldehyde of appropriate concentration 4%, after room temperature fixed cell 30min, every hole adds the appropriate DAPI dyeing liquor of 1ml (1 μ g/ml), and room temperature lucifuge hatches 10-15min.The impact of Thallus Gracilariae polysaccharide on DNA integrity is observed under inverted fluorescence microscope.
(3) the two dye method of AnnexinV-FITC/PI detects apoptosis
Paving 6 orifice plate is operated according to as above (1) is middle, cell attachment after 24h, add 0mg/ml and IC50 Thallus Gracilariae polysaccharide respectively, after drug effect 48h, after PBS cleans slide, every hole adds the BindingBuffer500 μ l containing 5 μ lAnnexinV-FITC dyeing liquors and 10 μ lPI dyeing liquors, after room temperature lucifuge hatches 15 minutes, observes under inverted fluorescence microscope.Because FITC and PI excitation wavelength is inconsistent, therefore want separate detection: after first excitation wavelength being transferred to FITC detection range, adjusting wavelength, to PI detection range, merges figure after imaging respectively.Observe each group of cell state change, differentiate normal cell and apoptotic cell.The epicyte protein phosphatidyl serine of apoptotic cell can be combined with AnnexinV and then be dyed green by FITC, and nucleus then can be dyed redness by PI, and normal cell then can not be caught color.
(4) Flow Cytometry detects apoptosis rate
Paving 6 orifice plate is operated according to as above (1) is middle, after cell is completely adherent, add Thallus Gracilariae polysaccharide, after Dual culture 48h, pancreatin (not containing EDTA) digestion, culture medium re-suspended cell, 2000g, 4 DEG C of low-speed centrifugal 3-5min, after pre-cooling PBS cleans 2 times, often pipe adds 1ml70% pre-cooled ethanol, even and fine born of the same parents are blown with liquid-transfering gun,-20 DEG C of placements are spent the night, 2000g4 DEG C of low-speed centrifugal 3-5min, carefully discard 70% ethanol, often pipe adds 1ml pre-cooling PBS, re-suspended cell, 2000g again, 5min is centrifugal, sedimentation cell, careful supernatant discarded, attack centrifuge tube is with suitable cell dispersion gently, avoid cell agglomerating.Add the 1xBindingBuffer re-suspended cell of 500 μ l, lucifuge adds 5 μ lAnnexinV-FITC dyeing liquors, with liquid-transfering gun pressure-vaccum mixing gently.37 DEG C hatch 5min after, add 10 μ lPI dyeing liquors, mix gently, room temperature lucifuge hatches 15min, machine in preparation, note open flow cytometer and related software in advance.With cell sieve, cell suspension is filtered in 5ml flow cytometer detection pipe before upper machine, flow cytometer detection, use simultaneously without apoptosis induction process cell in contrast, regulate fluorescence to compensate, the position of setting cross door.
(5) Real-timeqPCR method detects the changes in gene expression relevant to apoptosis
Extract the tumor cell total serum IgE before and after the process of Thallus Gracilariae polysaccharide with TRIzol reagent, Nanodrop2000 ultramicron detector detects RNA concentration and purity.Getting each experimental group 1 μ g total serum IgE, is cDNA according to the reverse transcription of SuperscriptIIIReverseTranscriptase description.Real-timeqPCR (RT-qPCR) detects apoptosis-inducing before and after the effect of Thallus Gracilariae polysaccharide and to be correlated with the change of important gene FADD and GADD expression, amplimer sequence is as follows: GADD-F:CTGGAGAGCAGAAGACCGAA, GADD-R:ACCCCGACAGTGATCGTG, FADD-F:CTGGGGAAGAAGACCTGTGT, FADD-R:CTGACGAGCCAGCCTTCTC.PCR reaction condition is: SYBRGreenPCRMasterMix (2 ×) 5 μ l, ForwardPrimer (10 μMs) 0.4 μ l, ReversePrimer (10 μMs) 0.4 μ l, cDNA2 μ l; Moisturizing to 10 μ l.Pcr amplification: 95 DEG C, 2min; 95 DEG C, 10s; 60 DEG C, 30s; 72 DEG C, 30s.ABIStepOne instrument and software detection is used to analyze each destination gene expression situation.Using GAPDH as reference gene, Foldchange according to
Δ Δct method calculates.
Embodiment 4 as the Thallus Gracilariae polysaccharide of cell death inducer to the apoptosis-induced effect of Gastric cancer cell MKN45
By In vitro culture human gastric adenocarcinoma MKN45, detect Thallus Gracilariae polysaccharide to the apoptosis-induced effect of stomach cancer cell.After Thallus Gracilariae polysaccharide (50 μ g/mL) obtained for embodiment 1 and MKN45 Dual culture 48h, Microscopic observation is visible: the growth conditions not adding the matched group MKN45 cell of Thallus Gracilariae polysaccharide is good, and cell is fine and close growth regularity, and contact condition is good.And irregular change occurs the cellular morphology after the effect of Thallus Gracilariae polysaccharide, contact growth conditions reduces, and quantity obviously reduces, and has many floating cells in culture fluid, shows as significant anti-tumor activity (Fig. 2).DAPI coloration result showed cell spacing increases, and nucleus is impaired, occurs karyorrhexis, and particulate material increases, chromatin pyknosis coagulation, and part cell is apoptotic body or dead shape (Fig. 3).After the two dye of AnnexinV-FITC/PI, result display cellular control unit is AnnexinV-FITC pole weak green fluorescence labelling and the extremely weak red fluorescence labelling of PI; And the cell membrane of experimental group apoptotic cell is dyed green by AnnexinV-FITC, nucleus is dyed redness (Fig. 4) by PI.Flow Cytometry detects apoptosis rate, and after finding Thallus Gracilariae polysaccharide and MKN45 co-culture of cells 48h, the percentage ratio of apoptotic cell rises to 26.5% (Fig. 5) by 1.14% of matched group.Further employing RT-qPCR method detects Thallus Gracilariae polysaccharide and to be correlated with on cell death inducing the impact of expression of important gene FADD and GADD, find that FADD and GADD gene expression is all raised (Fig. 6), show that apoptotic pathways that Thallus Gracilariae polysaccharide mediates by FADD and GADD is to reach the effect of inducing apoptosis of tumour cell.Visible above, Thallus Gracilariae polysaccharide has obvious cell death inducing effect to adenocarcinoma of stomach MKN45.
Embodiment 5 as the Thallus Gracilariae polysaccharide of cell death inducer to the apoptosis-induced effect of lung cell A549
Substantially the same manner as Example 24, difference is that tumor cell adopts human lung cancer cell A549.By In vitro culture A549, detect Thallus Gracilariae polysaccharide to the apoptosis-induced effect of lung carcinoma cell.After Thallus Gracilariae polysaccharide (50 μ g/mL) obtained for embodiment 1 and A549 Dual culture 48h, Microscopic observation is visible: control group A 549 cell not adding Thallus Gracilariae polysaccharide is fine and close growth regularity, and contact condition is good, rarely seen a little floating cells.And the cell quantity after the effect of Thallus Gracilariae polysaccharide obviously reduces, there is irregular change in form, has many floating morular cells in culture fluid, shows as significant anti-tumor activity (Fig. 7).DAPI coloration result showed cell quantity obviously reduces, and occurs that particulate material increases in cell; Nucleus sustains damage, and occurs karyorrhexis, chromatin pyknosis coagulation, and part cell is dead shape or forms apoptotic body (Fig. 8).The cell membrane of AnnexinV-FITC/PI two dye result display apoptotic cell is dyed green by AnnexinV-FITC, and nucleus is dyed redness (Fig. 9) by PI.Adopt Flow Cytometry to detect apoptosis rate, find that apoptosis rate rises to 27.06% (Figure 10) by 1.02% of matched group.Further employing RT-qPCR method detects Thallus Gracilariae polysaccharide to the impact of the expression of FADD and the GADD gene that cell death inducing is correlated with, find that the expression of the important gene FADD relevant to apoptosis and GADD is all raised (Figure 11), show that apoptotic pathways that Thallus Gracilariae polysaccharide mediates by FADD and GADD is to reach the effect of inducing apoptosis of tumour cell.Visible, experimental group is compared with matched group apoptosis testing result, and Thallus Gracilariae polysaccharide has obvious cell death inducing effect to lung cancer A549 cell.
Embodiment 6 is as the effect of the Thallus Gracilariae Polysaccharides on Mice melanoma cell B16 of cell death inducer
Substantially the same manner as Example 4, difference is that tumor cell adopts B16 mouse melanoma cell line.By In vitro culture B16, detect the melanomatous apoptosis-induced effect of Thallus Gracilariae Polysaccharides on Mice.After Thallus Gracilariae polysaccharide (50 μ g/mL) obtained for embodiment 1 and B16 Dual culture 48h, Microscopic observation is visible: the matched group B16 cell not adding Thallus Gracilariae polysaccharide is fine and close growth regularity, and the cell quantity after the effect of Thallus Gracilariae polysaccharide obviously reduces, there are many floating cells in culture fluid, show as significant anti-tumor activity (Figure 12).Adopt Flow Cytometry to detect apoptosis rate, find that apoptosis rate rises to 22.64% (Figure 13) by 1.36%.Further employing RT-qPCR method detects Thallus Gracilariae polysaccharide to the impact of the expression of FADD and the GADD gene that cell death inducing is correlated with, find that the expression of the important gene FADD relevant to apoptosis and GADD is all raised (Figure 14), show that apoptotic pathways that Thallus Gracilariae polysaccharide mediates by FADD and GADD is to reach the effect of inducing apoptosis of tumour cell.Visible, experimental group is compared with matched group apoptosis testing result, and Thallus Gracilariae Polysaccharides on Mice melanoma cell B16 has obvious cell death inducing effect.
More than describe preferred embodiment of the present invention in detail.Should be appreciated that those of ordinary skill in the art just design according to the present invention can make many modifications and variations without the need to creative work.Therefore, all technical staff in the art, all should by the determined protection domain of claims under this invention's idea on the basis of existing technology by the available technical scheme of logical analysis, reasoning, or a limited experiment.
Claims (10)
1. the application of Thallus Gracilariae polysaccharide in the preparation of the expression for the preparation of FADD and the GADD gene in inducing cell.
2. apply as claimed in claim 1, it is characterized in that, the preparation method of described Thallus Gracilariae polysaccharide is: utilize trichloroacetic acid method to extract from Thallus Gracilariae (Gracilariopsislemaneiformis).
3. apply as claimed in claim 2, it is characterized in that, described preparation method comprises the following steps:
1) with water dissolution Thallus Gracilariae dry powder, and regulate pH value of solution to 9-11 with NaOH, centrifugal acquisition first supernatant and the first precipitation;
2) in step 1) in add water dissolution in centrifugal described first precipitation obtained, and regulate pH value of solution to 9-11 with NaOH, and recentrifuge, obtains the second supernatant;
3) merge described first supernatant and described second supernatant, and add trichloroacetic acid and precipitate, centrifugal acquisition the 3rd supernatant;
4) in described 3rd supernatant, add dehydrated alcohol to precipitate, centrifugal acquisition second precipitates;
5) by the second precipitation described in washing with acetone, and lyophilization, obtain and slightly carry Thallus Gracilariae polysaccharide;
6) by step 5) in slightly to carry Thallus Gracilariae polysaccharide water-soluble, carry out stepwise elution by ion exchange column, after vacuum drying, obtain the Thallus Gracilariae polysaccharide of purification.
4. apply as claimed in claim 3, it is characterized in that, step 3) in the mass concentration of described trichloroacetic acid that adds be 2%-5%.
5. apply as claimed in claim 3, it is characterized in that, the monosaccharide components of described Thallus Gracilariae polysaccharide comprises D-galactose and 3,6-inner ether galactose.
6. apply as claimed in claim 5, it is characterized in that, described D-galactose mass content is 25%-30%, and described 3,6-inner ether galactose mass content are 27%-34%.
7. apply as claimed in claim 5, it is characterized in that, described D-galactose mass content is 27.36%, 3,6-inner ether galactose mass content is 29.38%.
8. apply as claimed in claim 1, it is characterized in that, described cell is tumor cell.
9. apply as claimed in claim 8, it is characterized in that, described application comprises: the apoptosis of being induced described tumor cell by the expression of induction FADD and GADD gene.
10. apply as claimed in claim 8, it is characterized in that, described tumor cell is the one in gastric carcinoma cells, human lung carcinoma cell, mouse melanin tumor cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610082951.7A CN105535013A (en) | 2016-02-05 | 2016-02-05 | Application of gracilariopsis lemaneiformis polysaccharide |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610082951.7A CN105535013A (en) | 2016-02-05 | 2016-02-05 | Application of gracilariopsis lemaneiformis polysaccharide |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105535013A true CN105535013A (en) | 2016-05-04 |
Family
ID=55814939
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610082951.7A Pending CN105535013A (en) | 2016-02-05 | 2016-02-05 | Application of gracilariopsis lemaneiformis polysaccharide |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105535013A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105902561A (en) * | 2016-05-31 | 2016-08-31 | 上海交通大学 | Application of Gracilariopsis lemaneiformis polysaccharide as antitumor chemotherapy drug synergist and antitumor drug |
-
2016
- 2016-02-05 CN CN201610082951.7A patent/CN105535013A/en active Pending
Non-Patent Citations (1)
| Title |
|---|
| 康亚妮等: "龙须菜多糖对肺癌细胞增殖能力及形态的影响", 《水产学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105902561A (en) * | 2016-05-31 | 2016-08-31 | 上海交通大学 | Application of Gracilariopsis lemaneiformis polysaccharide as antitumor chemotherapy drug synergist and antitumor drug |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101654485B (en) | Spreading hedvotis herb polysaccharide for curing malignant tumor and preparation method thereof | |
| CN109276576A (en) | The purposes of plain boiled pork ganoderma lucidum polysaccharide in the preparation of antitumor drugs | |
| CN104106763A (en) | Application of polygonatum polysaccharide in preparation of drugs for assisting inhibition of colon cancer | |
| CN106084087A (en) | A kind of preparation method of Fructus Trichosanthis polysaccharide | |
| CN110041441B (en) | Safflower polysaccharide, preparation method thereof and application thereof in antitumor drugs | |
| JP6681466B2 (en) | Homogeneous polysaccharide having immunomodulatory activity and method for preparing the same | |
| CN106581090B (en) | Myricetin extract, pharmaceutical composition containing myricetin extract and application of myricetin extract | |
| CN101264110A (en) | Water chestnut polysaccharide and its extracting method and pharmaceutical use | |
| CN106834404B (en) | Enzymolysis polypeptide and application thereof in preparing medicament for treating lung adenocarcinoma | |
| CN105535013A (en) | Application of gracilariopsis lemaneiformis polysaccharide | |
| CN109593140B (en) | Gracilaria crispatus polysaccharide and preparation method and application thereof | |
| CN109232756B (en) | Suaeda salsa polysaccharide extract and preparation method and application thereof | |
| CN103118686B (en) | The purposes of Banlangen Polysaccharide in the medicine preparing resisiting influenza virus | |
| CN115490780B (en) | Extraction method and application of crude extract of gulfweed fucoidin | |
| CN110156904A (en) | Purple sweetpotato polysaccharide is preparing the application in anti-lung-cancer medicament | |
| CN105943523A (en) | Application of dendrophenol in preparing medicines for inhibiting proliferation of cervical carcinoma cells and for inducing autophagic apoptosis of cervical carcinoma cells | |
| CN101167755B (en) | Method for preparing centipede polysaccharide protein composition with anti-tumor activity and use | |
| CN112237588B (en) | Application of oyster mushroom polysaccharide selenoside-III anticancer active ingredient in preparation of medicine for resisting prostate cancer | |
| CN104491834B (en) | Anti-gastric cancer health product containing european bird cherry polysaccharide | |
| CN103554289A (en) | Rhizoma atractylodis sinensis polysaccharide and extraction method and applications thereof in preparing anti-tumor medicaments | |
| CN104116024B (en) | Herba Cistanches polysaccharides has the application in the functional food of auxiliary suppression colon cancer effect in preparation | |
| CN100589812C (en) | Plant worms mycelium extracat fraction and composition for oral intake | |
| CN110522760B (en) | Application of ascosan from Ascophyllum nodosum | |
| CN104366192A (en) | Laryngeal-cancer-resistant health product containing bird cherry polysaccharide | |
| CN112321736B (en) | Oyster mushroom polysaccharide selenoside-III anticancer active ingredient, preparation thereof and application thereof in preparation of anti-liver cancer drugs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160504 |