CN105525002A - Primer and method for detecting APOE gene polymorphism - Google Patents
Primer and method for detecting APOE gene polymorphism Download PDFInfo
- Publication number
- CN105525002A CN105525002A CN201610043844.3A CN201610043844A CN105525002A CN 105525002 A CN105525002 A CN 105525002A CN 201610043844 A CN201610043844 A CN 201610043844A CN 105525002 A CN105525002 A CN 105525002A
- Authority
- CN
- China
- Prior art keywords
- primer
- stage
- apoe
- apoe gene
- snapshotpcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biological detection, and particularly relates to a primer and method for detecting APOE gene polymorphism. The primer for detecting the APOE gene polymorphism provided by the invention comprises a PCR (Polymerase Chain Reaction) amplification primer and an SNaPshot PCR primer, and has the advantages of high specificity, no cross reaction and high accuracy. The APOE gene polymorphism detection is realized; the risk or reference basis is provided for early-stage prevention of diseases such as coronary heart diseases, apoplexy and Alzheimer's diseases; meanwhile, the primer and the method can also be used for assisting the diagnosis of III type hyperlipoprotememia; and great clinical significance is realized.
Description
Technical field
The invention belongs to technical field of biological, be specifically related to a kind of primer and the method thereof that detect APOE gene pleiomorphism.
Background technology
Apo E (apolipoproteinE, ApoE) is one of lipophorin important in blood plasma, and its assignment of genes gene mapping is on the 19th pair of chromosome long arm, and long 37kb, it comprises 4 exons and 3 introns.ApoE has three kinds of structure body (isoform) i.e. E2, E3 and E4.112 of aminoacid sequence of ApoE and the exchange of 158 two seed amino acid residues and arginine (Arg) and halfcystine (Cys) determine the kind of isomer.ApoE4 is Arg on these two positions; E2 is Cys; 112 is ApoE3 isomer for Cys and 158 is Arg person, and in general population, gene frequency E3 distribution is the highest, ApoE3/3 Phenotype Distribution about 70%.The phenotype that six kinds different can be had: three kinds of homozygotes (E2/2, E3/3, E4/4) and three kinds of heterozygotes (E2/3, E2/4, E3/4) in crowd.
ApoE mainly in liver synthesis, secretion and metabolism, participates in the transport of lipid, storage and excretion, has the effect such as repair tissue, anticoagulant, immunomodulatory.Li Dongmeis etc. have delivered the paper that one section of exercise question is " correlation research of APOE gene pleiomorphism Ahl tribulus sea silent sickness ", this paper shows APOE ε 4 allelotrope, HDL-C is relevant with sporadic AD, APOE ε 4 may be the Hazard Factor that sporadic AD falls ill, and suggestion is using the biomarker as sporadic AD such as APOE ε 4 and HDL-C.Modern study finds, ApoE gene pleiomorphism also has close relationship with the disease such as coronary heart disease (coronaryheartdisease, CHD), hyperlipidaemia, cerebral infarction, Alzheimer disease (AD) and chronic hepatitis B.Therefore, method or the test kit of researching and developing out detection ApoE gene pleiomorphism are significant to clinical.
Chinese patent application 201110446186.X discloses APOE gene detecting kit and amplification method and detection method, described test kit comprises the primer and internal reference primer that detect Gene A POErs429358 site and rs7412 site, and the primer in described detection APOE gene rs429358 site comprises forward wild primers and forward mutation type primer; The primer in described detection APOE gene rs7412 site comprises forward wild primers and forward mutation type primer; Described APOE gene internal reference primer comprises forward internal reference primer and reverse general primer.Described APOE gene detecting kit increases with wild-type and sudden change amplification buffer respectively to examined samples DNA, 2 object fragments and 1 internal reference fragment are increased in each anti-amplified reaction simultaneously, the product band distinguished according to clip size is seen under ultraviolet light through gel electrophoresis, according to the genotype of presence or absence judgement 2 SNP site of band after amplification.
Chinese patent application 201510288426.6 discloses the primer, test kit and the PCR method thereof that detect ApoE gene pleiomorphism, and the primer of described detection ApoE gene pleiomorphism comprises the two groups of primers detecting rs429358 site and rs7412 site.This detection kit can increase the ability that allele-specific primers PCR distinguishes not isoallele site greatly, the non-specific possibility of intersecting amplification between different loci is made to drop to minimum, the amplification of real " all or none " formula can be accomplished, not only there is good specificity, also there is extraordinary sensitivity, the genotype distribution situation in 1ng genomic dna can be detected.
But the detection primer of above-mentioned ApoE gene pleiomorphism is more complicated, and detecting step is more loaded down with trivial details, be unfavorable for popularization and the utilization of this detection method.Therefore, study and send out and output detection method simply, simple operation, primer specificity is high, and the detection method of the ApoE gene pleiomorphism that detected result tolerance range is high is still the emphasis of research at present.
Summary of the invention
In order to solve the defect existed in prior art, the invention provides a kind of primer and the method thereof that detect APOE gene pleiomorphism, this primer is mainly for detection of two sites of APOE_T112Ch and APOE_C158T in APOE gene, there is the advantages such as specificity is good, highly sensitive, accuracy is good, for APOE gene pleiomorphism provides a kind of simple and effective detection method.
The invention provides a kind of primer detecting APOE gene pleiomorphism, comprise pcr amplification primer and SNaPshotPCR primer; Described pcr amplification primer is: for upstream primer 5 '-GCCTACAAATCGGAACTGGA-3 ' (SEQIDNO.1) and the downstream primer 5 '-ACCTGCTCCTTCACCTCGT-3 ' (SEQIDNO.2) of APOE; Described SNaPshotPCR primer comprises: for SNaPshotPCR the primer 5 '-GCGCGGACATGGAGGACGTG-3 ' (SEQIDNO.3) of APOE_T112C; For SNaPshotPCR the primer 5 '-TTTTTTTTTTTTTTTTTTGCGATGCCGATGACCTGCAGAAG-3 ' (SEQIDNO.4) of APOE_C158T.
Further, in described SNaPshotPCR primer, the primer concentration ratio of APOE_T112C and APOE_C158 is 1:1.
In addition, present invention also offers a kind of method detecting APOE gene pleiomorphism, comprise the steps:
S1 extracts DNA sample;
The DNA sample that S2 extracts with step S1, for template, adopts the pcr amplification primer described in claim 1 to carry out multiplexed PCR amplification, and carries out purifying to amplified production;
S3 for template with the pcr amplification product after step S2 purifying, adopts the SNaPshotPCR primer described in claim 1 to carry out SNaPshotPCR amplification, and carries out purifying to SNaPshotPCR amplified production;
S4 adopts capillary electrophoresis technique to detect, and analyzes, determine SNP site and genotype thereof to detected result.
Further, the DNA sample in described step S1 is the DNA sample of EDTA anticoagulation cirumferential blood.
Further, the multiplexed PCR amplification reaction conditions in described step S2 comprises: stage 1:98 DEG C 3min; Stage 2:98 DEG C 10s; Stage 3:58 DEG C 30s; Stage 4:72 DEG C 1min; Stage 5: turn back to stage 2,29 circulation; Stage 6:72 DEG C 5min; Stage 7:25 DEG C of insulation.
Further, the SNaPshotPCR amplification reaction condition in described step S3 comprises: stage 1:96 DEG C 10s; Stage 2:55 DEG C 5s; Stage 3:60 DEG C 30s; Stage 4: turn back to stage 1,25 circulation; Stage 5:4 DEG C of insulation.
Further, GENEMAPPERIDV4.1 software is adopted to analyze detected result in described step S4.
In addition, the primer of detection APOE gene pleiomorphism provided by the invention detects the purposes in APOE gene pleiomorphism reagent in preparation.
Compared with prior art, technical scheme provided by the invention has following advantage: it is good that the primer of detection APOE gene pleiomorphism provided by the invention has specificity, cross reaction can not be there is, the advantage that accuracy is high, achieve the detection of APOE gene pleiomorphism, for the diseases such as coronary heart disease, apoplexy and alzheimer's disease early prevention provide risk or reference frame, the diagnosis of broad beta disease can also be assisted simultaneously, there is great clinical meaning.
Accompanying drawing explanation
Fig. 1 is the amplified fragments of APOE gene primer provided by the invention;
Fig. 2 is the detected result figure of APOE gene SNaPshotPCR primer provided by the invention.
Embodiment
Below in conjunction with drawings and Examples, the present invention is described in further details.
Embodiment one, primer
APOE gene primer provided by the invention is as shown in table 1, comprises pcr amplification primer and SNaPshotPCR primer, and described pcr amplification primer and SNaPshotPCR primer are corresponding.All primer sequences provided by the invention all by the comparison of UCSC database, without known SNP site.
Table 1 primer provided by the invention
The specificity of embodiment two, primer
Primer provided by the invention is carried out Blasting in UCSC, and result is as follows:
1) APOE gene specific primer carries out Blast in UCSC, the amplified fragments of all primers all covers corresponding detection site, and without other homologous gene, its amplified fragments is positioned at chr19:45411824+45412314, length is 491bp, and extension increasing sequence figure is as Fig. 1.
2) use SNaPshotPCR primer in table 1, SNaPshot method detects, and as shown in Figure 2, the base that the relative position at each product peak and sequencing reaction mix conforms to expection result.
The detection of embodiment three, APOE gene pleiomorphism
1) extract the DNA sample of EDTA anticoagulation cirumferential blood, extracting method with reference to TIANampBloodDNAKit(purchased from Tiagen, article No. DP318) specification sheets, DNA sample is diluted to 100ng/ μ L, for subsequent use.
2) prepare primer mixture: by APOE_T112C and APOE_C158T primer by concentration ratio be 1:1 mixing, concussion mix; Of short duration centrifugal rear for subsequent use; Pcr amplification adopts Q5
?warm start surpasses fidelity 2XMasterMix(purchased from NEB company, article No. M0494L), reaction system is as shown in table 2, concussion mixing, of short duration centrifugal after, packing 18.0 μ L is to the PCR reaction tubes that marked; Add primer mixture 5.0 μ L toward the PCR reaction tubes marked, carry out pcr amplification according to following program: stage 1:98 DEG C 3min; Stage 2:98 DEG C 10s; Stage 3:58 DEG C 30s; Stage 4:72 DEG C 1min; Stage 5: turn back to stage 2,2:9 circulation; Stage 6:72 DEG C 5min; Stage 7:25 DEG C of insulation.
Table 2, PCR reagent preparation form
3) in SNaPshotPCR product, add 1.0 μ LSAP enzymes, react according to following program: 37 DEG C, 15min; 80 DEG C, 15min; 4 DEG C, insulation.After completion of the reaction, capillary electrophoresis technique detects, and adopt GENEMAPPERIDV4.1 software to analyze to detected result, determine SNP site and genotype thereof, result as shown in Figure 2.
The specificity of the method for embodiment four, detection APOE gene pleiomorphism
Detection specificity of the present invention is defined as negative match-rate.The present invention is optimized SNaPshot sequencing to 20 routine samples altogether and detects, and detected result adopts Sanger sequencing to verify.The result that the negative findings that SNaPshot sequencing detects shows with Sanger sequencing conforms to, without sample (feminine gender) totally 9 examples of sudden change, as shown in table 3.Detection specificity of the present invention is 100%.
Table 3, the specific testing data of APOE gene test
The sensitivity of the method for embodiment five, detection APOE gene pleiomorphism
Detection sensitivity of the present invention is defined as positive coincidence rate.The present invention is optimized SNaPshot sequencing to 20 routine samples altogether and detects, and detected result adopts Sanger sequencing to verify.The result that the positive findings that SNaPshot sequencing detects shows with Sanger sequencing conforms to, sample (positive) totally 11 examples of sudden change, as shown in table 4.Detection sensitivity of the present invention is 100%.
The testing data of table 4, APOE gene test sensitivity
The accuracy of the method for embodiment six, detection APOE gene pleiomorphism
Accuracy of the present invention is defined as the consistence of different methods detected result.The present invention carries out the detection of SNaPshot sequencing to 20 routine samples altogether, and detected result all adopts Sanger sequencing to verify.Different methods detected result is consistent, as shown in table 5.The accuracy of this detection is 100%.
The testing data of table 5, APOE gene 2SNPs site accuracy in detection
The precision of the method for embodiment seven, detection APOE gene pleiomorphism
Precision of the present invention is defined as carries out to sample the ability that duplicate detection obtains same result.Invention has been between personnel, simultaneous test between the different hole of different time, different instrument, same sample, result is as shown in table 6, and all results all show unanimously, and this detection precision is 100%.
Table 6, APOE gene test precision test data
Above content is in conjunction with concrete preferred implementation further description made for the present invention, can not assert that specific embodiment of the invention is confined to these explanations.For general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, some simple deduction or replace can also be made, all should be considered as belonging to protection scope of the present invention.
SEQUENCELISTING
Science and Technology Co., Ltd. is detected in gold territory, <110> Guangzhou
<120> mono-kind detects primer and the method thereof of APOE gene pleiomorphism
<130>
<160>4
<170>PatentInversion3.3
<210>1
<211>20
<212>DNA
<213> artificial sequence
<400>1
gcctacaaatcggaactgga20
<210>2
<211>19
<212>DNA
<213> artificial sequence
<400>2
acctgctccttcacctcgt19
<210>3
<211>20
<212>DNA
<213> artificial sequence
<400>3
gcgcggacatggaggacgtg20
<210>4
<211>41
<212>DNA
<213> artificial sequence
<400>4
ttttttttttttttttttgcgatgccgatgacctgcagaag41
Claims (8)
1. detect a primer for APOE gene pleiomorphism, it is characterized in that: comprise pcr amplification primer and SNaPshotPCR primer; Described pcr amplification primer is: for upstream primer 5 '-GCCTACAAATCGGAACTGGA-3 ' and the downstream primer 5 '-ACCTGCTCCTTCACCTCGT-3 ' of APOE; Described SNaPshotPCR primer comprises: for SNaPshotPCR the primer 5 '-GCGCGGACATGGAGGACGTG-3 ' of APOE_T112C; For SNaPshotPCR the primer 5 '-TTTTTTTTTTTTTTTTTTGCGATGCCGATGACCTGCAGAAG-3 ' of APOE_C158T.
2. the primer of detection APOE gene pleiomorphism according to claim 1, is characterized in that: in described SNaPshotPCR primer, the primer concentration of APOE_T112C and APOE_C158 is than being 1:1.
3. detect a method for APOE gene pleiomorphism, it is characterized in that: comprise the steps:
S1 extracts DNA sample;
The DNA sample that S2 extracts with step S1, for template, adopts the pcr amplification primer described in claim 1 to carry out multiplexed PCR amplification, and carries out purifying to amplified production;
S3 for template with the pcr amplification product after step S2 purifying, adopts the SNaPshotPCR primer described in claim 1 to carry out SNaPshotPCR amplification, and carries out purifying to SNaPshotPCR amplified production;
S4 adopts capillary electrophoresis technique to detect, and analyzes, determine SNP site and genotype thereof to detected result.
4. the method for detection APOE gene pleiomorphism according to claim 3, is characterized in that: the DNA sample in described step S1 is the DNA sample of EDTA anticoagulation cirumferential blood.
5. the method for detection APOE gene pleiomorphism according to claim 3, is characterized in that: the multiplexed PCR amplification reaction conditions in described step S2 comprises: stage 1:98 DEG C 3min; Stage 2:98 DEG C 10s; Stage 3:58 DEG C 30s; Stage 4:72 DEG C 1min; Stage 5: turn back to stage 2,29 circulation; Stage 6:72 DEG C 5min; Stage 7:25 DEG C of insulation.
6. the method for detection APOE gene pleiomorphism according to claim 3, is characterized in that: the SNaPshotPCR amplification reaction condition in described step S3 comprises: stage 1:96 DEG C 10s; Stage 2:55 DEG C 5s; Stage 3:60 DEG C 30s; Stage 4: turn back to stage 1,25 circulation; Stage 5:4 DEG C of insulation.
7. the method for detection APOE gene pleiomorphism according to claim 3, is characterized in that: adopt GENEMAPPERIDV4.1 software to analyze detected result in described step S4.
8. the primer of detection APOE gene pleiomorphism according to claim 1 detects the purposes in APOE gene pleiomorphism reagent in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610043844.3A CN105525002A (en) | 2016-01-22 | 2016-01-22 | Primer and method for detecting APOE gene polymorphism |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610043844.3A CN105525002A (en) | 2016-01-22 | 2016-01-22 | Primer and method for detecting APOE gene polymorphism |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105525002A true CN105525002A (en) | 2016-04-27 |
Family
ID=55767525
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610043844.3A Pending CN105525002A (en) | 2016-01-22 | 2016-01-22 | Primer and method for detecting APOE gene polymorphism |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105525002A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110358808A (en) * | 2019-08-16 | 2019-10-22 | 上海百傲科技股份有限公司 | Method, kit, primer pair and probe for detecting ApoE gene |
| WO2021037027A1 (en) * | 2019-08-29 | 2021-03-04 | The Hong Kong University Of Science And Technology | Genetic variants for diagnosis of alzheimer's disease |
| CN113943790A (en) * | 2021-10-25 | 2022-01-18 | 北京华夏时代基因科技发展有限公司 | Method for detecting ApoE single nucleotide polymorphism |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103184266A (en) * | 2011-12-28 | 2013-07-03 | 协和干细胞基因工程有限公司 | APOE gene detection kit, amplification method and detection method |
| CN104862402A (en) * | 2015-05-29 | 2015-08-26 | 沈阳优吉诺生物科技有限公司 | Primers for detecting ApoE gene polymorphism, kit and PCR (polymerase chain reaction) method for primers or kit |
-
2016
- 2016-01-22 CN CN201610043844.3A patent/CN105525002A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103184266A (en) * | 2011-12-28 | 2013-07-03 | 协和干细胞基因工程有限公司 | APOE gene detection kit, amplification method and detection method |
| CN104862402A (en) * | 2015-05-29 | 2015-08-26 | 沈阳优吉诺生物科技有限公司 | Primers for detecting ApoE gene polymorphism, kit and PCR (polymerase chain reaction) method for primers or kit |
Non-Patent Citations (1)
| Title |
|---|
| SUHNG WOOK KIM等: "Rapid and Direct Detection of Apolipoprotein E Genotypes Using Whole Blood from Humans", 《JOURNAL OF TOXICOLOGY AND ENVIRONMENTAL HEALTH》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110358808A (en) * | 2019-08-16 | 2019-10-22 | 上海百傲科技股份有限公司 | Method, kit, primer pair and probe for detecting ApoE gene |
| CN110358808B (en) * | 2019-08-16 | 2024-01-19 | 上海百傲科技股份有限公司 | Method, kit, primer pair and probe for detecting ApoE gene |
| WO2021037027A1 (en) * | 2019-08-29 | 2021-03-04 | The Hong Kong University Of Science And Technology | Genetic variants for diagnosis of alzheimer's disease |
| CN113943790A (en) * | 2021-10-25 | 2022-01-18 | 北京华夏时代基因科技发展有限公司 | Method for detecting ApoE single nucleotide polymorphism |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104975081B (en) | Detect amplimer, kit and its detection method of PKD1 gene mutation | |
| WO2018133546A1 (en) | CONSTRUCTION METHOD, DETECTION METHOD AND KIT FOR NON-INVASIVE PRENATAL FETAL α-THALASSEMIA GENE MUTATION DETECTION LIBRARY | |
| TW201639967A (en) | Method, kit, device and system of detecting fetal genetic information | |
| CN104109716B (en) | A kind of human HLA-B27 genotyping kit | |
| Shokouhi et al. | Association between PGC-1alpha gene polymorphisms and type 2 diabetes risk: a case-control study of an Iranian population | |
| CN104830966A (en) | Method of direct DNA sequencing for screening hepatolenticular degeneration disease gene mutation site through PCR amplification | |
| CN105525002A (en) | Primer and method for detecting APOE gene polymorphism | |
| CN102816839A (en) | Kit for detecting hot spot mutation sites in colorectal cancer PIK3CA gene | |
| CN105803054A (en) | Kit and use thereof in detection of orofacial clefts related genes | |
| CN104293932A (en) | Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR | |
| CN102586404B (en) | Kit for specifically detecting genotype of ApoE4 and application of kit | |
| CN112226440A (en) | Pathogenic mutation of hereditary primary infertility and detection reagent thereof | |
| CN117187380A (en) | One-tube APOE genotyping detection kit and detection method thereof | |
| CN107190071A (en) | A kind of SNP marker for being used to detect RhD variation phenotypes | |
| CN110938685A (en) | Gene detection probe set for neonatal hereditary metabolic disease and hemoglobinopathy and application thereof | |
| CN105316349A (en) | Mycobacterium tuberculosis KatG mutant gene and application thereof | |
| CN104988146A (en) | Primer and method for detecting ERCC1 gene polymorphism | |
| CN103667439B (en) | Real-time quantitative polymerase chain reaction (PCR) method using double probe and capable of distinguishing B-type and non-B-type hepatitis B virus (HBV) | |
| CN105154545A (en) | Primers and method for detecting MPL gene mutation | |
| CN105838720A (en) | PTPRQ gene mutant and application thereof | |
| CN108342488B (en) | Kit for detecting gastric cancer | |
| CN114032303A (en) | Oligonucleotide and method for detecting new mutation of gene ABCB11 | |
| CN104099338A (en) | MYO15A gene mutant and application thereof | |
| CN105506090A (en) | Primer and method for detecting ADH1B gene*2 polymorphism | |
| CN102732625B (en) | Bovine leukocyte adhesion deficiency (BLAD) pyrosequencing detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160427 |