CN105524156A - Application method of stress tolerance related gene ZmHDZIV14 in regulation and control of plant stress resistance - Google Patents

Abstract

The invention relates to a plant stress resistance enhancement related protein named as ZmHDZIV14. The protein is derived from a maize (Zea mays L.) inbred line B73, the amino acid sequence of the protein is represented as a sequence table SEQ ID NO:2, and an encoding gene sequence of the protein is a nucleotide sequence represented as SEQ ID NO:1. The invention further provides an application method of an encoding gene of the plant stress resistance enhancement related protein. According to the application method of the encoding gene of the plant stress resistance enhancement related protein, an expression vector carrying the ZmHDZIV14 gene is used for converting plant cells or tissue by the aid of conventional biological methods including application of Ti plasmids, Ri plasmids and plant virus vectors, direct DNA transformation, microinjection, electric conduction, agrobacterium tumefaciens mediated transformation and the like, a plant is cultured from the converted plant through tissue culture, and the plant with improved drought resistance and stress resistance is obtained. The expression vector carrying the ZmHDZIV14 gene is used for converting the plant cells or tissue by the aid of the conventional biological methods including application of Ti plasmids, Ri plasmids and plant virus vectors, direct DNA transformation, microinjection, electric conduction, agrobacterium tumefaciens mediated transformation and the like, the plant is cultured from the converted plant through tissue culture, and the plant with the improved stress resistance is obtained.

Description

The application method of anti contravariance related gene ZmHDZIV14 in regulating plant resistance

Technical field

The present invention relates to a kind of gene strengthening plant drought resistance; The invention still further relates to described gene improvement plant to the application method in drought stress resistance.

Background technology

Homeodomain-leucine zipper (HD-Zip) is a class transcription factor specific to plant, extensively be present in various plants, not only grow higher plant, play a significant role in morphogenesis, regulating plant is to the response process of the adverse circumstances such as biological and abiotic stress simultaneously.AtHDG11 genes encoding in Arabidopis thaliana one belongs to the transcription factor of HD-ZipIV class family, the expression of this gene can promote the elongation of root and stomatal closure thus improve drought resistance in plants, and existing research shows to turn the Arabidopis thaliana of AtHDG11 gene, tobacco and turfgrass and all shows stronger drought tolerance.Identified corn HD-ZipIV class transcription factor gene 17 at present, evolutionary analysis shows that the homology of ZmHDZIV14 gene and AtHDG11 gene is higher, infers that these two genes have similar function to AtHDG11 gene.But it is also less for the research of corn HD-ZipIV gene family at present, mainly its expression pattern at plant different tissues and the research in plant exterior skin and hairly root growth course, the physiological function of its physiological function particularly in environment-stress have not been reported.This research according in ncbi database with the cDNA sequence of the corn HD-ZipIV gene ZmHDZIV14 of AtHDG11 DNA homolog.Have studied ZmHDZIV14 gene clone, bioinformatic analysis and plant expression vector construction, and by this gene transferred plant, thus obtain the transgenic plant with degeneration-resistant proterties fast.

Summary of the invention

The object of this invention is to provide a kind of enhancing plant anti-adversity associated protein and encoding gene thereof; The second object of the present invention is to provide a kind of application method strengthening plant anti-adversity associated protein and encoding gene thereof.

The object of the invention is to be achieved through the following technical solutions: a kind ofly strengthen plant anti-adversity associated protein, name is called ZmHDZIV14, derives from corn (ZeamaysL.) self-mating system B73, is the protein with one of following amino acid residue sequences:

(1) SEQ ID: 2;

(2) SEQ ID: the amino acid residue sequence of 2 is through the replacement of one or several amino-acid residues and/or disappearance and/or interpolation and the protein relevant to plant stress-resistance.

Wherein, sequence SEQID:2 is made up of 692 amino-acid residues.

The replacement of one or several amino-acid residues described and/or disappearance and/or interpolation refer to no more than ten amino acid whose replacements and/or disappearance and/or interpolation.Amino acid preferentially replaces as shown in table 1.

The encoding gene that above-mentioned ZmHDZIV14 strengthens plant anti-adversity associated protein also belongs to protection scope of the present invention.

The encoding gene that above-mentioned ZmHDZIV14 strengthens plant anti-adversity associated protein has one of following nucleotide sequence:

(1) nucleotide sequence of SEQ ID NO:1;

(2) DNA of SEQIDNO:2 protein sequence in polynucleotide;

(3) with the DNA sequence dna of SEQ ID NO:1, there is more than 90% homology, cut coding identical function protein DNA sequence;

(4) nucleotide sequence that the DNA sequence dna that can limit with the SEQIDNO:1 in sequence table under high high stringency conditions is hybridized.

Above-mentioned high high stringency conditions is at 0.1 × SSC, in the solution of 0.1 × SDS, hybridizes and wash film at 65 DEG C; Wherein, the SEQIDNO:1 in sequence table is made up of 2079 deoxynucleotides.

All protection scope of the present invention is belonged to containing the recombinant expression vector of gene of the present invention, transgenic cell and engineering.

The second object of the present invention is achieved through the following technical solutions: a kind of application method strengthening the encoding gene of plant anti-adversity associated protein; It is characterized in that: will the expression vector of ZmHDZIV14 gene of the present invention be carried, by using Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, conventional biological processes transformed plant cells or the tissue such as agriculture bacillus mediated, and the plant of conversion is become plant through tissue cultivating, obtain the plant that drought resisting resistance improves.

ZmHDZIV14 gene of the present invention can be building up in existing plant expression vector by existing method, any one promotor can add before it transcribes super beginning Nucleotide and comprise constitutive promoter, strengthening promotor, inducible promoter, tissue-specific promoter, etap specificity promoter.For the ease of identifying ZmHDZIV14 gene plant cell or plant and screening, made carrier can be processed, as added the antibiotin marker (gentamicin, kantlex etc.) that plant alternative marks (bar gene, gus gene, luciferase gene etc.) or has resistance.The plant host be converted both can be monocotyledons, also can make dicotyledons, as: paddy rice, wheat, corn, tobacco, Arabidopis thaliana etc.

The expression vector carrying ZmHDZIV14 gene of the present invention is by using Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, conventional biological processes transformed plant cells or the tissue such as agriculture bacillus mediated, and the plant of conversion is become plant through tissue cultivating, obtain the plant that resistance improves.

Experiment proves, under adverse environmental factor, turns ZmHDZIV14 Arabidopis thaliana and has stronger drought resistance than wildtype Arabidopsis thaliana.Under drought stress conditions, transgenic arabidopsis survival rate, biomass and relative water content are all higher than nontransgenic plants, and proline content is improved simultaneously, and mda content reduces.

The encoding gene of plant adversity resistance related protein of the present invention is proceeded in other plant according to a conventional method, the drought resistance of plant can be strengthened.

Accompanying drawing explanation

Fig. 1 is corn ZmHDZIV14 full length gene pcr amplification product;

Fig. 2 is that the enzyme of carrier pUCm-T-ZmHDZIV14 cuts qualification;

Fig. 3 is that the enzyme of carrier pCAMBIA3300-35S-ZmHDZIV14-bar cuts qualification;

Fig. 4 is the comparison diagram that 6 Restriction Enzymes BamHI, EcoRI, HindIII, SmaI, XbaI, SacI digest arabidopsis gene group;

Fig. 5 is the evolutionary analysis of corn and Arabidopis thaliana HD-ZipIV type transcription factor gene proteins encoded;

Fig. 6 is the tetraploid rice of corn ZmHDZIV14 and Arabidopis thaliana AtHDG11 gene coded protein sequence;

Fig. 7 is the building process of plant expression vector PCAMBIA3300-35S-ZmHDZIV14-bar;

Fig. 8 is that (A represents that wild Arabidopis thaliana is planted to corn ZmHDZIV14 gene transgenic Arabidopis thaliana acquisition process; B represents that inflorescence infects rear Arabidopis thaliana; C represents T0 generation mixed sowing; D represents that T1 is for resistance seedling; E represents that T2 is for resistance seedling; F represents that T3 is for resistance seedling);

Fig. 9 is that the PCR of transgenic arabidopsis identifies that (M is DNAMarkerD5000; CK ⁺for positive control; CK ^-for negative control; 1-10 is resistant plant);

Figure 10 is the Northernblot analytical results of the positive transgenic Arabidopsis plant that part detects through PCR, and results of hybridization shows that SEQIDNO:1 nucleotide sequence can be expressed in transgenic arabidopsis;

Figure 11 is the impact of 20%PEG on ZmHDZIV14 transgenic arabidopsis growth of seedling;

Figure 12 is the impact that 20%PEG coerces lower ZmHDZIV14 transgenic arabidopsis survival rate;

Figure 13 is the impact that 20%PEG coerces lower ZmHDZIV14 transgenic arabidopsis biomass;

Figure 14 is the impact that 20%PEG coerces lower ZmHDZIV14 transgenic arabidopsis relative water content;

Figure 15 is that 20%PEG coerces mda content in lower ZmHDZIV14 transgenic arabidopsis and wild Arabidopis thaliana;

Figure 16 is that 20%PEG coerces proline content in lower ZmHDZIV14 transgenic arabidopsis and wild Arabidopis thaliana.

Embodiment

Method in following enforcement, if no special instructions, is ordinary method.

The acquisition of embodiment 1, ZmHDZIV14 albumen and encoding gene thereof

Wildtype Arabidopsis thaliana (Arabidopsisthaliana, Col) seed is that arid habitat Crop Science corn key lab of Gansu Province preserves.

Bacterial strain: intestinal bacteria (Eschrichiacoli) DH5a, agrobacterium tumefaciens (Agrobacteriumtumefaciens) for Arabidopis thaliana genetic transformation is LBA4404, and two bacterial strains are arid habitat Crop Science corn key lab of Gansu Province and preserve.

Plasmid: T/A cloning vector pUCm-T is purchased from Sangon Biotech (Shanghai) Co., Ltd., and plant expression vector pCAMBIA3300-35S-PROIIMCS-bar is the transformation of arid habitat Crop Science corn key lab of Gansu Province, blocks that resistance and clones for T/A.

Embodiment 1; The acquisition of SEQIDNO:2 albumen and encoding gene thereof

Bacterial strain: intestinal bacteria (Eschrichiacoli) DH5a, agrobacterium tumefaciens (Agrobacteriumtumefaciens) for tobacco genetic transformation is LBA4404, and two bacterial strains are arid habitat Crop Science corn key lab of Gansu Province and preserve.

Plasmid: T/A cloning vector pUCm-T is purchased from Sangon Biotech (Shanghai) Co., Ltd., and plant expression vector pCAMBIA3300-35S-PROIIMCS-bar is this experiment oneself transformation, blocks that resistance and clones for T/A.

One, the cloning process of nucleotide sequence SEQIDNO:1 is as follows:

(1) extraction and purification of corn total serum IgE

The extraction (Trizol method) of corn RNA:

Preparation work before experiment: the configuration of DEPC water: the DEPC(DEPC volume parts adding 1ml in 1L water is 0.1%), 37 DEG C of temperature bath 12h.Autoclaving is 20min at least, sterilizing 2 times, makes the thorough inactivation of DEPC.PCR pipe, 1.5ml centrifuge tube, 2ml centrifuge tube, various rifle first-class DEPC water (non-sterilizing) soaks, and 37 DEG C are spent the night, and next day, sterilizing was for subsequent use.

Reagent: trizol, chloroform, Virahol, 75% ethanol (configuration of DEPC water), DEPC.

(1) get about 0.1g corn prematurity tassel to put into mortar and grind rapidly, period constantly adds liquid nitrogen;

(2) ground material is put into centrifuge tube, adds rapidly the trizol reagent of 1ml, vortex mix, room temperature leave standstill 5min(room temperature too high time also can place on ice);

The centrifugal 15min of 12000rpm under (3) 4 DEG C of conditions, gets supernatant liquor 1ml.Add 200 μ l chloroforms in supernatant liquor, vortex oscillation 15S, room temperature leaves standstill 3min;

The centrifugal 15min of 12000rpm under (4) 4 DEG C of conditions.Moved in another centrifuge tube by colourless for sample upper strata aqueous phase (about 500 μ l), add isopyknic Virahol, vibration mixing, room temperature leaves standstill 10min;

The centrifugal 15min of 12000rpm under (5) 4 DEG C of conditions, abandons supernatant liquor;

(6) 1ml75% ethanol (RNasefree) washing precipitation is added in centrifuge tube;

The centrifugal 5min of 5000rpm under (7) 4 DEG C of conditions, abandons supernatant liquor;

(8) repeating step (6), (7);

(9) precipitation is placed in Bechtop, air-dry about 10min, becomes translucent to precipitation;

(10) add 60-80 μ lRNasefreeddH2O in centrifuge tube, under 4 DEG C of conditions, dissolve 30min;

(11) 3 μ lRNA solution electrophoresis detection RNA quality on the sepharose of 1% is got.

(2) RT-PCR amplification corn ZmHDZIV14 gene

The synthesis of the first chain cDNA:

(1) according to the explanation of Sheng Gong biotech firm M-MuLV first chain cDNA synthetic agent box, set up 20 μ l reaction systems: added successively in the PCR pipe of RNasefree by following component: RNA solution 5 μ l, Oligod (T) 18Primer (0.5 μ g/ μ l) 1 μ l, RNasefreeddH2O add to 12 μ l.Gently after mixing, centrifugal 3-5S; 65 DEG C of temperature bath 5min;

(2) after temperature bath, PCR pipe puts cooled on ice 30s rapidly, adds following component successively: W5 × ReactionBuffer4 μ l, RNaseInhibitor (20U/ μ l) 1 μ l, dNTP (10mmol/L) 2 μ l after centrifugal 3-5s;

(3) rearmounted 37 DEG C of water-bath 5min are mixed gently.Add M-MuLV reversed transcriptive enzyme (20U/ μ l) 1 μ l, make final volume be 20 μ l;

(4) said mixture is placed in 42 DEG C of water-bath 60min.Hatch 10min termination reaction for 72 DEG C, obtain reverse transcription cDNA.

(3) clone of goal gene

The cDNA that previous step reverse transcription obtains is diluted 20 times for subsequent use.Design a pair PCR Auele Specific Primer according to the ZmHDZIV14 genome sequence checked order, increase complete nucleotide sequence from cDNA.Reaction conditions is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 57.5 DEG C of annealing 30s, 72 DEG C extend 2min; Sex change, annealing, extension repeat 35 circulations; 72 DEG C of 10min, 4 DEG C are terminated program and preserve.1.0% agarose gel electrophoresis detects, and result shows the fragment (see figure 1) obtaining 2079bp.

ZmHDZIV14 has the nucleotide sequence of sequence SEQIDNO:1.From Maize genome, the full length cDNA sequence of ZmHDZIV14 gene is cloned into, the long 2079bp of sequence by the method for RT-PCR.Be that ncbi database searched for by probe with cDNA sequence, obtain the full length DNA sequence (GenBank accession number: BK008039) of this gene, sequence alignment finds that this gene comprises 10 exons and 9 introns.With the DNA sequence dna of ZmHDZIV14 gene for probe search Maize genome database (MaizeGDB), find that this gene is positioned at the position near telomere on No. 5 chromosome long arm.Protparam tool analysis shows ZmHDZIV14 genes encoding 692 amino acid, and predicted molecular weight is 7.58kD, and molecular formula is C ₃₂₈₈h ₅₂₅₃n ₉₆₃o ₁₀₀₂s ₄₇, iso-electric point pI=6.15, the theory deduction transformation period is 30h, instability index 48.09, liposoluble index 82.47.Protein amino acid sequence analysis shows ZmHDZIV14 albumen not containing pyrrolysine (Pyl) and selenocystein (Sec); Serine (Ser) content mostly is 10.0% most; Next is leucine (Leu), and content is 9.5%.Total negative electricity residue (Asp+Glu) is 78, and charged residues (Arg+Lys) is 69, and hydrophobicity mean coefficient (GRAVY) is-0.205.

Two, the tetraploid rice of ZmHDZIV14 Arabidopis thaliana AtHDG11 gene coded protein sequence

The Arabidopis thaliana being probe retrieval NCBI with AtHDG11 protein amino acid sequence and corn protein database obtain 17 corn HD-Zip transcription factor sequence and 12 Arabidopis thaliana HD-Zip transcription factor sequence, these sequences are compared and build evolutionary tree (see figure 5).The target gene of this HD-ZipIV type transcription factor gene of ZmHDZIV14 as us is chosen according to the result of sequence alignment.This protein amino acid sequence is carried out sequence analysis with Arabidopis thaliana AtHDG11 protein amino acid sequence respectively, and result shows that the Argine Monohydrochloride homology of ZmHDZIV14 and AtHDG11 is respectively 54.09%(and sees Fig. 6).By searching GenBank database, find the full length cDNA sequence of ZmHDZIV14 gene, GenBank accession number is BK008039, and designs the method for special primer by RT-PCR with this from Maize genome, clone ZmHDZIV14 gene, and is connected in pUCm-T cloning vector.

Embodiment 2; The functional verification of ZmHDZIV14 and encoding gene thereof

One, the structure of ZmHDZIV14 expression vector

(1) object fragment is connected with pUCm-T carrier

Biological according to the raw work of pUCm-Tvector() specification sheets configures following solution: 10 × LigationBuffer1.0 μ l, 50%PEG1.0 μ l, pUCm-Tvector1.0 μ l, the PCR primer 4.0 μ l of purifying, T4DNALigase1.0 μ l, ddH ₂o2 μ l.16 DEG C connect 6 hours.

(2) preparation (adopting the preparation of 1.5ml centrifuge tube) of competent escherichia coli cell

Bacterium liquid proceeds in the 1.5ml centrifuge tube of precooling, and 4 DEG C of centrifugal 10min of 3500rpm, remove supernatant liquor.The resuspended thalline of CaCl2 solution of the ice-cold 0.1mol/L of 300 μ l is added, ice bath 30min in centrifuge tube.The centrifugal 10min of 3500rpm under 4 DEG C of conditions.Remove supernatant liquor, thalline is suspended in the CaCl2 solution of the ice-cold 0.1mol/L of 60 μ l, add 10 μ l glycerine, preserve in-80 DEG C of refrigerators after liquid nitrogen flash freezer, take out during use, be placed in thawed on ice.

(3) product conversion intestinal bacteria are connected

Getting 100 μ l competent cells is placed on ice, gently by cell even suspension after thawing completely.Add 5 μ l connecting fluids, mix gently.Place 30min on ice.Add 400 μ lLB liquid nutrient mediums, 37 DEG C, 250rpm shaking culture 1h.By centrifuge tube content mix, draw 200 μ l bacterium liquid be coated in advance with 20 μ l100mMIPTG and 100 μ l20mg/mlX-gal coating ampicillin plate on.Flat board forward at 37 DEG C places 1 hour with the liquid of hyperabsorption, is then inverted overnight incubation.

(4) alkaline lysis extracts e. coli plasmid dna in a small amount

(1) single bacterium colony on picking flat board, be inoculated in 5ml and add in the LB liquid nutrient medium of penbritin, 37 DEG C, 250rpm shaking culture is spent the night.

(2) getting 1.5ml nutrient solution pours in 1.5ml centrifuge tube, 4 DEG C of centrifugal 30s of 12000rpm.

(3) abandon supernatant, centrifuge tube is inverted in several minutes on filter paper, liquid is flow to end.

(4) bacterial sediment is resuspended in 100 μ l solution I, thermal agitation, and room temperature places 10min.

(5) add the solution II 200 μ l of new configuration, cover tightly the mouth of pipe, gentle vibration centrifuge tube is for several times fast, to mix content, and ice bath 5min.

(6) add the solution III of 150 μ l precoolings, cover tightly the mouth of pipe and be inverted centrifuge tube, gentle vibration 10s, ice bath 5min, under 4 DEG C of conditions, the centrifugal 5min of 12000rpm.

(7) supernatant liquor (about 400 μ l) is moved in another clean centrifuge tube, add 200 μ ltris-saturation balance phenol and 200 μ l chloroform/primary isoamyl alcohol (24/1) vibration mixing, the centrifugal 5min of 12000rpm under 4 DEG C of conditions.

(8) colourless for upper strata aqueous phase (about 400 μ l) is moved in a new clean centrifuge tube, adds 1ml(2.5 times of volume) dehydrated alcohol of precooling, vibration mixing is placed on 20min in-20 DEG C of refrigerators, the then centrifugal 5min of 12000rpm under 4 DEG C of conditions.

(9) outwell supernatant liquor, all liquid is flow to end unlimited for the mouth of pipe being inverted on filter paper, add 70% washing with alcohol precipitation of 1ml precooling, under 4 DEG C of conditions, 12000rpm, centrifugal 5min.

(10) repeating step 9.

(11) sucking-off supernatant liquor, is inverted in centrifuge tube on toilet paper, liquid is flow to end, drying at room temperature.

(12) precipitation be dissolved in 20 μ lTE damping fluids, 37 DEG C of water-bath 1h, are stored in-20 DEG C of refrigerators.

(5) the PCR checking of plasmid DNA

Take e. coli plasmid dna as template (diluting 10 times), amplification ZmHDZIV14, and introduce restriction enzyme site.It is as follows that PCR reacts 25.0 μ l systems: ddH ₂o9.5 μ l, PremixEXTaq12.5 μ l, 5 ' primer (10 μm of ol/L) 1.0 μ l, 3 ' primer (10 μm of ol/L) 1.0 μ l, plasmid DNA 1.0 μ l.Reaction conditions is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 57.5 DEG C of annealing 30s, 72 DEG C extend 1min; Sex change, annealing, extension repeat 30 circulations; 72 DEG C of 10min, 4 DEG C are terminated program and preserve.1.0% agarose gel electrophoresis detects.Select positive colony bacterium liquid and send to order-checking.Sequencing result shows that the fragment of 2079bp has by the 1 to 2079 of 5 ' of sequence 1 the nucleotide sequence that deoxynucleotide forms.

(6) pUCm-T-ZmHDZIV14 carrier digestion verification

The ZmHDZIV14 gene linear fragment (see figure 2) of 2115bp is obtained with XbaI and SmaI double digestion pUCm-T-ZmHDZIV14; Double digestion CPB(pCAMBIA3300-35S-PROIIMCS-bar) obtain the linear fragment that single size is 9580bp, two linear fragments connections obtain pCAMBIA3300-35S-ZmHDZIV14-bar expression vector (see figure 7); XbaI and SmaI double digestion pCAMBIA3300-35S-ZmHDZIV14-bar expression vector is identified, result shows that plant expression vector pCAMBIA3300-35S-ZmHDZIV14-bar builds correct (see figure 3).

Two, qualification and the functional analysis of ZmHDZIV14 gene Arabidopis thaliana is turned

(1) acquisition and the screening of ZmHDZIV14 gene Arabidopis thaliana is turned

(1) colored method arabidopsis thaliana transformation is stained with in utilization, and Baste Herbicid resistant screens

The plasmid PCAMBIA3300-35S-ZmHDZIV14-bar of structure is proceeded to Agrobacterium LBA4404, and with being stained with colored method arabidopsis thaliana transformation, method is as follows:

The cultivation of Arabidopsis plant and conversion thereof: seed first uses the ethanol disinfection 1min of 75%, then uses 0.5%NaClO(v/v) sterilize 10min, finally uses the ddH2O rinsing 6 times of sterilizing.With rifle head by seed dibbling on 1/2MS solid medium, 4 DEG C of vernalization 2 ~ 3d, are positioned over phytotron (22 DEG C, 16h illumination, 8h is dark).Be transplanted to when Arabidopis thaliana grows 2 true leaves after one week and the peat composed of rotten mosses is housed: continued growth in the little basin of plastics of vermiculite=2:1.When the side tongue of Arabidopsis plant forms 1 ~ 2 angle fruit, Agrobacterium-mediated Transformation can be carried out.

(2) Agrobacterium inflorescence dip method mediation pCAMBIA3300-35S-ZmHDZIV14-bar genetic transformation

Choosing bacterium is inoculated in containing 50 μ g/mlKan, and in 50 μ g/mlRifYEP bases, can add 100 μm of ol/LAS, 28 DEG C, 220rpm shakes bacterium and spends the night simultaneously, and the centrifugal 10min of 4000rpm, room temperature, abandons supernatant, is diluted to OD with 10% sucrose (containing 0.02%silwet) ₆₀₀be about about 0.8 ~ 1.0 namely to use (10% sucrose solution is contrast).During conversion, flower is soaked 2-5s in the solution, wrap up Arabidopis thaliana with thieving paper, blot unnecessary bacterium liquid gently, wrap preservative film to keep humidity, 16 DEG C of lucifuges are cultivated.

(3) management after transforming

Use humidifier moisturizing, flowerpot is placed in pallet, and after covering plant light culture 16 ~ 24h with black plastics bag, remove black plastics bag, water sufficient hangland nutritive medium trying to get to the heart of a matter, recover normally to cultivate.In order to improve transformation efficiency, after removing plastics bag 3d, draw the fresh conversion fluid of appropriate resuspended object plasmid with suction pipe, the libation at an ancient wedding ceremony is stained with bud one by one, collects the Arabidopis thaliana seed after conversion after plant maturation, and transgenic arabidopsis obtains main process and sees Fig. 8.

(4) screening of transgenic Arabidopsis plants and Resistance detecting

By transgenic arabidopsis T ₀for planting seed in MS screening culture medium (containing 300 μ g/LBasta weedicides), 22 DEG C/18 DEG C, cultivate about 7d under 16h/8h photoperiod condition, most of seedling starts chrysanthemum, withered death gradually, the continued growth of minority energy, and blade is green, table shape normal (D see in Fig. 8).Through the positive plant of PCR qualification, point individual plant system results seed, the seed obtained is T1 generation (E see in Fig. 8), and obtaining seed through herbicide screening individual plant results is T2 generation (F see in Fig. 8), then identifies that obtaining T3 strain is homozygote through herbicide screening.This research obtains 53 strain ZmHDZIV14T altogether ₃for homozygous lines, therefrom random selecting 10 strains carry out phenotypic evaluation respectively.

(2) the PCR qualification of transgenic Arabidopsis plants

ZIV14-F1：5′ATGGACTTCGGCGACGACGTCA3′

ZIV14-R1:5 ' TCAATGGCTGGCGCAATTCAAGG3 ' is primer, is that the positive PCAMBIA3300-35S-ZmHDZIV14-barT2 that turns carries out PCR detection for arabidopsis gene group to Basta herbicide screening, with the Arabidopis thaliana of wild-type (CK in Fig. 9 ^-) and PCAMBIA3300-35S-ZmHDZIV14-bar(Fig. 9 in CK ⁺) PCR be detected as contrast, result shows that L1 ~ L10 all can increase the band of 2079bp, and does not have amplified production to occur in wild-type.

(3) the Southern hybridization verification of PCAMBIA3300-35S-ZmHDZIV14-bar Arabidopis thaliana is turned

Be that the positive PCAMBIA3300-35S-ZmHDZIV14-bar Arabidopis thaliana individual plant that turns extracts DNA by Basta herbicide screening and PCR, with special primer ZIV14-F1, ZIV14-R1 of ZmHDZIV14 gene, carry out Southern hybridization to turn PCAMBIA3300-35S-ZmHDZIV14-bar arabidopsis thaliana genomic dna for masterplate amplification obtains 2079bp gene fragment for probe, concrete grammar is as described below:

3.1 the purifying of probe and labeling effciency detect

The suitableeest concentration and probe concentration and detection probes susceptibility when probe labelling efficiency detection is to determine to hybridize.According to the concentration and probe concentration estimating synthesis, the probe of mark and positive control are diluted to 1ng/ μ l, with this concentration for initial concentration, carry out serial dilution, be diluted to 10pg/ μ L, 3pg/ μ L, 1pg/ μ L, 0.3pg/ μ L, 0.1pg/ μ L, 0.03pg/ μ L, 0.01pg/ μ L, 0pg/ μ L respectively, probe and the positive control one-to-one point of mark are in same a line of nylon membrane, and what selection strength of signal was suitable is multiplied by corresponding extension rate, calculates the ultimate density of probe.The more difficult grasp of suitable concentration and probe concentration, can finely tune according to crossbreeding effect, if background value is higher, original hybridization solution can be carried out suitable dilution, when signal is lower, then add a small amount of probe.

The extraction of 3.2 Arabidopis thaliana DNA and quantitatively

Sample gene group DNA content can affect the result of Southern hybridization.A Southern hybridization about needs 10 μ g STb gene (OD260/OD280=1.8 ~ 2.1).Plant tissue genome is comparatively large, and obtain stronger hybridization signal, sample DNA amount is advisable at 30 μ about g.This experiment adopts modified CTAB method to extract DNA, and water bath time is to 3h in 55 DEG C of extracting solutions to extend sample, and the cotton genomic dna amount of extraction is large, and integrity is good.Extract multiple sample and need ensure that the DNA content between each sample is substantially identical by electrophoresis or ultraviolet spectrophotometer, make hybridization signal intensities consistent, have comparability.

The selection of 3.3 restriction enzymes

The recovery of 3.4 digestion products and electrophoresis

Enzyme gets 5 μ l electrophoresis observation Arabidopis thaliana DNA after cutting 16h whether enzyme is cut thoroughly, if enzyme has satellite band after cutting, shows that enzyme is cut comparatively thorough.Then add the sodium acetate of 1/10 times of volume 3mol/L, the Virahol of 0.6 ~ 1 times of volume precooling, mixing, the centrifugal 10min of 12000rpm, precipitate with 35 μ lddH ₂o dissolves, and adds 5 μ lloadingbuffer and mixes gently, 65 DEG C of water-bath 10min, and rapid 2 ~ 5min extremely on ice, is loaded in 1% gel pore, 40V electrophoresis 12h by DNA.

3.5 transferring films are with fixing

Glue is cut into 5.0 × 4.0cm size, rinses once, add the hydrochloric acid depurination of 100ml0.25mol/L in plate with ddH2O, room temperature concussion 15-30min, to tetrabromophenol sulfonphthalein yellowing; DdH2O rinses twice, adds sex change liquid mixed solution (1.5mol/LNaCL, 0.5mol/LNaOH); Room temperature concussion 20-30min, can extend to 90min, return to original blueness to tetrabromophenol sulfonphthalein; Use ddH ₂o rinses 2 times, adds 2 × SSC balanced gel 5min.

3.5.1 siphon marking method transferring film

In the square plate cleaned up, place a sheet glass, placement one filter paper on it, in filter paper two ends immersion dish in 10 × SSC, drives the bubble between filter paper and flat board away with glass stick; Gel is inverted on sheet glass, face down, cuts away one jiao as mark, and with preservative film by all round closure in case thieving paper contact gel edge cause liquid short circuit; Nylon membrane is placed in above balanced gel, drives bubble away; Preservative film is put two filter paper, it is put 20 layers of thieving paper again; Thieving paper is put a sheet glass, it is put the weight of about 600g, set up liquid from liquid pool through the uplink of gel as nylon membrane, make it gather on nylon membrane with the DNA in wash-out gel; More than overnight at room temperature transferring film 16h, period changes 2-3 thieving paper; After transferring film, EB dyeing, observes transferring film effect, and the molecular weight standard position of marking serial numbers, well position and correspondence; With 2 × SSC rinsing nylon membrane 1 time, filter paper blots, static 10min.

3.5.2 fixing

If 120 DEG C of baking nylon membrane 30min(test after a while: the nylon of drying is not stored in 2 ~ 8 DEG C, and the used time soaks 5min with 2 × SSC)

3.6 hybridization

Points 2 times careful by 64mlddH ₂o joins in test kit DIGEasyHybGranules, stirring 5min immediately to dissolving completely, dissolving final volume 100ml at 37 DEG C.

Prehybridization: the efficient hybridization solution of DIGEasyHybGranules getting 8.0ml65 DEG C of preheating adds in hybrid pipe, emptying bubble, prehybridization 2h(8-15rpm in 65 DEG C of hybrid heaters).

Probe sex change: by sex change 5-10min in the probe boiling water bath of mark, put cooled on ice 10min immediately.

Hybridization: emptying prehybridization solution, adds the good probe of the new sex change of 4.0 μ l (1 ~ 3 μ l/ film, 5 ~ 20ng/ml hybridization solution) at the new DIGEasyHybGranules of 8.0ml, mixing, hybridizes 20h(8 ~ 15rpm in 65 DEG C of hybridization instruments); After having hybridized, hybridization solution is reclaimed be placed in one can low temperature resistant again can the pipe of resistance to boiling water bath, be stored in-15 ~-20 DEG C in order to reusing.Thaw during use and at 65 DEG C sex change 10min.

3.7 wash film

(1), under the rear room temperature of hybridization, 20ml2 × SSC/0.1 washes film 2 times, each 5min;

(2) be preheating to 50 DEG C, 20ml0.1 × SSC/0.1%SDS washs 2 times, each 15min;

(3) lavation buffer solution then film being placed in 20ml balances 2-5min;

(4) jiggle on shaking table, film is hatched 30min in 10ml Block buffer;

(5) pour out blocking-up liquid after having closed, add the 10ml antibody-solutions diluted, hatch at least 30min;

(6) remove antibodies buffer, slowly wash film 2 times with 20ml lavation buffer solution, each 15min;

(7) lavation buffer solution is removed, balance film 2 times in 20ml detection damping fluid, each 2 ~ 5min;

(8) dilute 300 μ lNBT/BCIP chemical colour reaction substrates with detection damping fluid, in the nitrite ion of the fresh preparation of about 15ml, reflection colour developing, does not shake in process color.16h completes reaction, and for detecting colour developing degree, midway can expose observation the short period of time;

(9) after spot or band occur, wash film 5min with water by 50mlTE damping fluid or PCR level, take a picture.Result shows that L4, L7, L9 individual plant all shows hybridization signal, and unconverted plant does not show any hybridization signal (see figure 10).

Three, Function Identification

(1) arid is on the impact turning the growth of PCAMBIA3300-35S-ZmHDZIV14-bar Arabidopsis thaliana Seedlings

When turning ZmHDZIV14 gene Arabidopis thaliana T ₃after generation and nontransgenic plants seed germination grow to 15d, after interpolation 20%PEG solution coerces 5d, the long developmental condition turning ZmHDZIV14 gene Arabidopsis plant and nontransgenic plants there occurs change, and the wilting degree of transfer-gen plant and nontransgenic plants also has obvious difference (see Figure 11).During drought stress, nontransgenic plants blade starts yellow, and drought environment has produced the growth of non-transgenic Arabidopis thaliana and suppressed, and transfer-gen plant is uninfluenced; Along with stress time extends, transgenosis south mustard plant and nontransgenic plants have all occurred that wilting is in various degree dead, but nontransgenic plants wilting degree is more serious than transfer-gen plant; Illustrate that transgenic arabidopsis has certain drought-resistant ability, under drought stress environment, ZmHDZIV14 gene alleviates drought stress to a certain extent.

(2) arid is to the change turning PCAMBIA3300-35S-ZmHDZIV14-bar Arabidopis thaliana and wild Arabidopis thaliana survival rate, biomass, relative water content

The T of Osmotic treatment ₃for Arabidopis thaliana transfer-gen plant and wild-type Arabidopsis plants, after 20%PEG Stress treatment 5d, measure its survival rate, leaf r elative water content and biomass; Corresponding result is as shown in Figure 12, Figure 13 and Figure 14.

Figure 12 shows: under non-stress condition, the survival rate of transfer-gen plant and Wild plant is 100%, after PEG Stress treatment 5d, compared with the wild Arabidopis thaliana under normal growing conditions, under stress conditions, the survival rate of wild-type and ZmHDZIV14 reduces 70.5%, compared with wild-type under stress conditions, the survival rate turning ZmHDZIV14 improves 82.68%.

Figure 13 shows: the leaf r elative water content of wild-type and transfer-gen plant all remains on more than 92% under normal operation, no significant difference; After Osmotic treatment, each plant leaf relative water content all shows as decline, WT lines leaf r elative water content declines at most, have dropped over half, its leaf r elative water content only has 39.65%, and turn the relative water content of ZmHDZIV14 gene Arabidopis thaliana T3 for plant substantially all more than 60%, namely when PEG coerces 5d, what lower wild-type comparatively coerced by the relative water content of transgenic Arabidopsis plants blade exceeds 43.76%, show under stress conditions, comparatively WT lines is strong for the blade retentiveness of plant for ZmHDZIV14 transgenic arabidopsis T3.

Figure 14 shows: the biomass of wild-type and transfer-gen plant all remains on about 0.85g under normal operation, and difference is not remarkable; After Osmotic treatment, the biomass of each plant all shows as decline, and WT lines biomass declines at most, have dropped over half.Under stress conditions, compared to wildtype Arabidopsis thaliana, the biomass turning ZmHDZIV14 gene Arabidopsis plant exceeds 70.00%, therefore, turns ZmHDZIV14 gene Arabidopis thaliana and has better defensive ability/resistance ability to drought stress.

(3) arid is on the impact turning PCAMBIA3300-35S-ZmHDZIV14-bar Arabidopsis thaliana Seedlings mda content

By wild-type and turn PCAMBIA3300-35S-ZmHDZIV14-bar Arabidopsis plant T2 for seed in nutrition pot, be cultured to 3 leaf after date 20%PEG solution-treated seedlings root, after 5d, take 0.1g blade and grind in 10% trichoroacetic acid(TCA), the centrifugal l0min of 12000rpm.Get 2mL supernatant liquor to mix with 2mL0.6% thiobarbituricacidα-, in boiling water bath, react 15min, centrifugal after cooling rapidly.Get the photoabsorption under supernatant liquor mensuration 532nm, 600nm and 450nm wavelength.

The concentration of mda (Malondialdehyde, MDA) is according to following formulae discovery: C (μm olL ^-1)=6.45 (OD ₅₃₂-OD ₆₀₀)-0.56OD ₄₅₀, calculate the content in tissue further.Calculation result is shown in Figure 15.Figure 15 shows: under non-stress condition, and in non-transgenic strain and transgenic line, the content of MDA and Proline is substantially without significant difference; After PEG Stress treatment 5d, compared to the non-transgenic Arabidopis thaliana under coercing, the MDA content turning ZmHDZIV14 gene Arabidopsis leaf significantly reduces, and reduces, 13.93%; Result shows, after drought stress process, the transgenic arabidopsis blade physical signs relevant with drought-resistant ability makes moderate progress, and further checking agrobacterium-mediated transformation, by corn ZmHDZIV14 channel genes Arabidopis thaliana, enhances the drought-resistant ability of Arabidopis thaliana.

(4) arid is on the impact turning PCAMBIA3300-35S-ZmHDZIV14-bar Arabidopsis thaliana Seedlings proline content

According to the method described above, by wild-type and turn PCAMBIA3300-35S-ZmHDZIV14-bar Arabidopsis plant T2 for seed in nutrition pot, be cultured to 3 leaf after date 20%PEG solution-treated, then, detect proline content as follows: each 0.5g of plant leaf to be measured accurately taking different treatment, put respectively in bassoon, then the sulfosalisylic acid solution of 5ml3% is added respectively to each pipe, 10min is extracted in boiling water bath, (will often shake in leaching process), cooled and filtered is in clean test tube, and filtrate is the extracting solution of proline(Pro).Draw 2ml extracting solution in another clean band glass plug test tube, add 2ml Glacial acetic acid and 2ml acid ninhydrine reagent, in boiling water bath, heat 30min, namely solution take on a red color.Add 4ml toluene after cooling, sway 30S, leave standstill a moment, get upper liquid in 10ml centrifuge tube, centrifugal 5min at 3,000 rpm.With the red toluene solution of suction pipe gentle aspiration upper strata proline(Pro) in cuvette, be blank with toluene, on spectrophotometer, 520nm wavelength place colorimetric, tries to achieve absorbance.Result calculates and goes out according to regression equation calculation the content (X μ g/2ml) that (or finding from typical curve) 2ml measures proline(Pro) in liquid, then the percentage ratio of proline content in calculation sample.Calculation formula is as follows: proline content (μ g/g)=[X × 5/2]/sample heavy (g); Calculation result as shown in figure 16.Figure 16 shows: under non-stress condition, the basic indifference of content of wild-type and transgenic line Free Proline; After PEG Stress treatment 5d, compared with the wild Arabidopis thaliana under coercing, transgenic line free proline content significantly increases, and improves 17.50%.

<110> Gansu Agriculture University

The application of <120> anti contravariance related gene ZmHDZIV14 in regulating plant resistance

<160>2

<170>PatentInversion3.3

<210>SEQID：2

<211>692

<212>PRT

<213> corn (Zeamays L.)

<400>1

MetAspPheGlyAspAspValMetAspGlyGlySerAspAlaGlnArg

151015

ArgLysLysArgTyrHisArgHisThrProArgGlnIleGlnGlnLeu

202530

GluAlaMetPheLysGluCysProHisProAspGluAsnGlnArgMet

354045

GlnLeuSerArgGluLeuGlyLeuGluProArgGlnIleLysPheTrp

505560

PheGlnAsnArgArgThrGlnMetLysAlaGlnHisGluArgGlnAsp

657075

AsnCysPheLeuArgAlaGluAsnAspLysIleArgCysGluAsnIle

8081859095

AlaMetGlnGluAlaLeuArgAsnValIleCysProThrCysGlyGly

100105110

ProProValAlaAspAspHisPheAspGluGlnLysLeuArgMetGlu

115120125

AsnAlaArgLeuLysGluGluLeuAspArgValSerSerLeuThrSer

130135140

LysTyrLeuGlyArgProIleThrGlnLeuProSerAlaGlnAlaLeu

145150155

SerMetSerSerLeuAspLeuSerValGlyGlyLeuGlyGlyProSer

160161165170175

LeuAspLeuAspLeuLeuSerGlyGlySerSerGlyTyrProProPhe

180185190

HisLeuLeuProMetAlaValSerGluMetGluArgProMetMetAla

195200205

GluMetAlaThrArgAlaMetAspGluLeuIleArgMetAlaGlnAla

210215220

GlyGluHisLeuTrpValLysThrGlyGlyArgGluValLeuAsnVal

225230235

AspThrTyrAspSerIlePheAlaLysProAspGlySerPheArgGly

240241245250255

ProAspValHisValGluGlySerArgGluThrGlyLeuValPheMet

260265270

SerAlaIleGlyLeuValAspMetPheMetAspSerSerLysTrpThr

275280285

GluLeuPheProAlaIleValSerLysAlaArgThrValAspValLeu

290295300

ValAsnGlyMetGlyGlyArgSerGluSerLeuLeuLeuMetTyrGlu

305310315

GluLeuHisValMetSerProValValProThrArgGluPheCysPhe

320321325330335

LeuArgTyrCysArgGlnIleGluHisGlyLeuTrpAlaIleAlaAsp

340345350

IleSerValAspGlnGlnGlnArgAspAlaArgPheGlyAlaProPro

355360365

SerArgSerCysArgLeuProSerGlyCysLeuIleAlaAspMetAla

370375380

AspGlySerSerLysValThrTrpValGluHisMetGluIleGluAsp

485390395

ArgValProIleHisLeuLeuTyrArgAspLeuValLeuSerGlyAla

400401405410415

AlaPheGlyAlaHisArgTrpLeuAlaAlaLeuGlnArgAlaCysGlu

420425430

ArgCysAlaCysLeuAlaThrAlaGlyIleMetProHisArgAspIle

435440445

AlaAlaAlaGlyValThrProGluGlyLysArgSerMetMetLysLeu

450455460

SerGlnArgMetValAsnSerPheCysAlaSerLeuSerAlaSerGln

465470475

LeuHisArgTrpThrThrLeuSerGlyProAsnAspValGlyValArg

480481585490495

ValMetValHisArgSerThrAspProGlyGlnProSerGlyValVal

500505510

LeuSerAlaAlaThrSerIleTrpLeuProValProCysAspArgAla

515520525

PheAlaPheValArgAspGluHisThrArgSerGlnTrpAspValLeu

530535540

SerHisGlyAsnProValGlnGluValSerArgIleProAsnGlySer

545550555

HisProGlyAsnCysIleSerLeuLeuArgGlyLeuAsnAlaSerGln

560561565570575

AsnSerMetLeuIleLeuGlnGluSerCysThrAspAlaSerGlySer

580585690

LeuValValTyrAlaProIleAspIleProAlaAlaAsnValValMet

595600605

SerGlyGluAspProSerAlaIleProLeuLeuProSerGlyPheSer

610615620

IleLeuProAspGlyArgProGlyAlaSerSerSerArgAlaGlyGln

625630635

AlaProSerAlaGlySerLeuValThrValAlaPheGlnIleLeuVal

640641645650655

SerSerLeuProSerAlaLysLeuAsnAlaGluSerValAlaThrVal

660665670

AsnSerLeuIleSerThrThrValGluGlnIleLysAlaAlaLeuAsn

675680685

CysAlaSerHis

690692

<160>2

<170>PatentInversion3.3

<210>SEQID：1

<211>2079

<212>DNA

<213> corn (ZeamaysL.)

<400>2

atggacttcggcgacgacgtcatggacggcggctccgacgcgcagcgccgcaagaagaga60

taccaccgccacactccgcgccagattcagcagctcgaggcgatgttcaaggagtgcccg120

cacccggacgagaaccagcggatgcagctgagcagggagctggggctggagccccggcag180

atcaagttctggttccagaaccgccggacgcagatgaaggcgcagcacgagcgccaggac240

aactgtttcctgcgcgcggagaacgacaagatccggtgcgagaacatcgccatgcaggag300

gcgctccggaacgtcatctgccccacctgcggcggcccgcccgtcgccgacgaccatttt360

gacgagcagaagctgcgcatggagaacgcgcgactcaaagaagagcttgaccgggtgtcc420

agcctgacgtccaagtacctggggcggcccatcacgcagctgccgtcggcgcaggcgctg480

tccatgtcgtcgctggacctgtccgtcggcgggctcggcggcccgtcgctggacctcgac540

ctcctcagcggcggctcctcggggtatcccccgttccacctcctcccgatggcggtgtcg600

gagatggagcggcccatgatggccgagatggcgacgcgcgccatggacgagctcatcagg660

atggcgcaggccggcgagcacctgtgggtcaagacgggcggccgcgaggtgctcaatgtc720

gacacgtacgacagcatcttcgccaagcccgacggctcgttccgcggcccggacgtgcac780

gtcgagggctcccgcgagacggggctcgtcttcatgagcgccatcggcctcgtcgacatg840

ttcatggactcgagcaagtggacggagctcttccctgccatcgtgtccaaagcgcgcacg900

gtcgacgtcctcgtgaacggcatgggcgggcggagcgagtctttgcttctgatgtacgag960

gagctgcacgtgatgtcgccggtcgtcccgacgcgcgagttctgcttcctccgctactgc1020

aggcagatcgagcacgggctatgggcgatcgcggacatctcggtggaccagcagcagcgc1080

gacgcgaggttcggcgcgcccccgtcgcgctcgtgccgcctcccgtcgggatgcctcatc1140

gccgacatggccgacggctcgtccaaggtgacctgggtcgagcacatggagatcgaggat1200

cgggttcccatccacctgctctaccgcgacctcgtcctcagcggggcggcgttcggcgcg1260

caccgttggctcgccgcgctgcagagggcgtgcgagcggtgcgcgtgcctcgccacggcc1320

ggcattatgccgcaccgggacattgcagcggcaggagtgacgccggaagggaagcggagc1380

atgatgaagctgtcgcagcggatggtgaacagcttctgcgcgagccttagcgcgtcgcag1440

ctccaccggtggacgacgctgtcggggcccaacgacgtgggcgtccgcgtcatggtgcac1500

cgcagcacggacccggggcagcccagcggcgtggtgctcagcgcggccacgtccatctgg1560

ctgccggtcccgtgcgaccgggcgtttgcctttgtccgcgacgagcatacgcgctcccag1620

tgggacgtgctgtcgcacggcaacccggtgcaggaggtgtcgcgcatccccaacggctct1680

caccctggaaactgcatctccttgctgagaggcctgaacgcgagccagaacagcatgctg1740

atcctgcaggagagctgcaccgacgcgtcaggctcgctggtggtgtacgcgccgatcgac1800

atcccggcggccaacgtggtgatgagcggcgaggacccgtccgcgatcccgctcctgccg1860

tccggcttctccatcctgcccgacgggcggcccggcgcgtcgtcgtcgagggccggccag1920

gcgccgtcggcggggtcgctggtgacggtggcgttccagatcctggtgagcagcctgccg1980

tcggcgaagctgaacgccgagtcggtggcgacggtcaacagcctcatcagcaccactgtg2040

gagcaaattaaggcggccttgaattgcgccagccattga2079

Claims (4)

1. strengthen a plant anti-adversity associated protein, it is characterized in that: name is called ZmHDZIV14, derive from corn (ZeamaysL.) self-mating system B73, its aminoacid sequence is as shown in sequence table SEQ IDNO:2.

2. a kind of enhancing plant anti-adversity associated protein as claimed in claim 1, is characterized in that: the coding gene sequence of this albumen is the nucleotide sequence as shown in SEQIDNO:1.

3. as claimed in claim 2 a kind of strengthen plant anti-adversity associated protein, it is characterized in that: recombinant expression vector or transgenic cell or engineering bacteria contain the nucleotide sequence coded gene of claim 2.

4. one kind strengthens the application method of the encoding gene of plant anti-adversity associated protein; It is characterized in that: will the expression vector of ZmHDZIV14 gene of the present invention be carried, by using Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated conventional biological processes transformed plant cells or tissue, and the plant of conversion is become plant through tissue cultivating, obtain the plant that drought resisting resistance improves.