CN105504065A - Drug-delivery carrier protein based on cholera toxin CT structure as well as in-vitro construction method and application of drug-delivery carrier protein - Google Patents
Drug-delivery carrier protein based on cholera toxin CT structure as well as in-vitro construction method and application of drug-delivery carrier protein Download PDFInfo
- Publication number
- CN105504065A CN105504065A CN201511029373.2A CN201511029373A CN105504065A CN 105504065 A CN105504065 A CN 105504065A CN 201511029373 A CN201511029373 A CN 201511029373A CN 105504065 A CN105504065 A CN 105504065A
- Authority
- CN
- China
- Prior art keywords
- egfp
- tat
- cta2
- ctb
- cholera
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/28—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Vibrionaceae (F)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a drug-delivery carrier protein based on a cholera toxin CT structure and an in-vitro construction method of the drug-delivery carrier protein. The drug-delivery carrier protein is a chimeric protein CTB5/EGFP-CTA2-TAT. The construction method comprises the following steps: constructing carriers petduet-CTB and pet22b-EGFP-CTA2-TAT; introducing host bacteria, carrying purification or renaturation, and assembling an AB5-structured chimeric protein in vitro. The drug-delivery carrier protein prepared by virtue of the construction method is high in purity, is relatively stable and is strong in repeatability; furthermore, no burden is produced during cell expression, and the protein raw material can be rapidly obtained; the drug-delivery carrier protein has high combining activity with GM1 as well as relatively efficient transmembrane capacity.
Description
Technical field
The present invention relates to biological technical field, particularly relate to and a kind of pass drug carrier albumen and vitro construction method thereof and application based on Toxins,exo-, cholera CT structure.
Background technology
Build a kind of carrier to assist such as larger protein class medicine and pass hemato encephalic barrier to treat the focus that central nervous system disorders is research at present efficiently, low toxicity, hurtless measure.HIV (human immunodeficiency virus) HIV trans-activating factor TAT, that one is rich in a large amount of cationic small peptide, current research shows, the fusion rotein formed after TAT and target protein gene fusion, can efficiently, fast, enter cell low dosage, hurtless measure, current research shows, but the fusion rotein of TAT can enter cell under the dosage of 100ug/ml in 1 hour, and reaches more than 70% at intracellular albumen distributive law.Therefore, significantly to improve target protein cross-film ability unquestionable for TAT fusion rotein.Natural Toxins,exo-, cholera (CT) molecule is made up of (A and B) two parts, and B is as the effect of carrier, and natural structure is pentamer, and its pentamer can be combined with the Ganglioside GM1 of nasal cavity and not enter cell.A subunit utilizes the aperture in the middle of B subunit pentamer, enters cell, and in cell paste, is hydrolyzed into A1 and A2 part, A1 and internal cell coenzyme effect, interference cell signal, makes a large amount of salt ion in cell outer defeated, and then cause body lack of water, cause diarrhea even dead.Research shows, what form Native cholera toxin with the effect of B subunit is A2 part, and by the effect of hydrophilic and hydrophobic between A2 and B, close-packed arrays together, and then guides A1 part to enter cell, and causes a disease.In conjunction with the molecular structure of CT, replace A1 part with EGFP, and in addition TAT modifies, after making EGFP enter cell by B subunit, can continue to wear film, directly through hemato encephalic barrier, finally, a kind of chimeric protein CTB5/EGFP-CTA2-TAT. of acquisition is built in order to solve this difficult problem.
Patent report is had to pass through by CTB and EGFP-CTA2-TAT cotransformation in same Host Strains at present, by Double screening chimeric protein CTB5/EGFP-CTA2-TAT.But the fact is that CTB has five pairs of disulfide linkage, is very easy to form inclusion body, the pentamer unit of CTB in supernatant, cannot be detected by the method for WESTERNBLOT and ELISA.And find that the process LAN of the inclusion body of CTB also can affect the expression amount of EGFP-CTA2-TAT albumen supernatant in operation, double-mass model cotransformation can cause dormitory bacterium internal load overweight, cause bacterium difficulty length, do not express foreign protein even directly death.Form chimeric protein CTB5/EGFP-CTA2-TAT, and make it keep fluorescence, wear film activity, extremely difficult especially.
Summary of the invention
The object of the invention is to be that providing a kind of obtains a kind of novel chimeric protein, and highly keep its biological activity.This chimeric protein can with the nerve node glycosides fat receptors bind at nasal cavity place, by the mode of intranasal administration, albumen EGFP-CTA2-TAT is entered in body via nasal cavity place in noninvasive mode.In vivo, the KDEL sequence of TAT and CTA2 is worked in coordination with and is done, and greatly improves the ability that EGFP wears film, enables EGFP pass through hemato encephalic barrier, and be positioned brain, to reach the nervous center diseases such as efficient treatment brain.When the EGFP (about 26kd) on carrier replaces with size pharmaceutical protein similar with it, namely played the effect that this carrier passs medicine, this carrier will probably become the good medicine of encephalopathy patient future.
The present invention is achieved through the following technical solutions:
Passing drug carrier albumen based on Toxins,exo-, cholera CT structure, is CTB5/EGFP-CTA2-TAT, assembles for CTB5 and EGFP-CTA2-TAT is chimeric.
Wherein, the aminoacid sequence of CTB5 is for shown in SEQIDNO:1.
The aminoacid sequence of EGFP-CTA2-TAT is for shown in SEQIDNO:2.
Pass the method for the external structure of drug carrier albumen based on Toxins,exo-, cholera CT structure, its step is as follows:
S1, gene cloning and expression
Adopt the method for BamHI/HindIII double digestion, by the position of the gene clone of coding CTB to the multiple clone site 1 of double gene expression vector petduet-1, the carrier called after petduet-CTB of structure;
Coding is had the gene clone of EGFP-CTA-TAT in expression vector pet22b (+), and removes its signal peptide, the restriction enzyme site selected during clone is NdeI and XhoI, the carrier called after pet22b-EGFP-CTA2-TAT of structure;
S2, EGFP-CTA2-TAT soluble proteins expression and purification
Plasmid pet22b-EGFP-CTA2-TAT imports Host Strains, namely in e. coli bl21 (DE3), and realizes expressing; Pet22b-EGFP-CTA2-TAT expresses with soluble form in e. coli bl21 (DE3) system, finally obtains electrophoretically pure product via Ni-NTA purifying;
S3, choleratoxin B subunit inclusion body protein purifying and renaturation
Plasmid petduet-CTB imports in Host Strains BL21 (DE3), and realize expressing, expression product is inclusion body, inclusion body is by washing, after removing surface impurity, again be dissolved in the urea of gradient concentration, screen pure CTB monomer by electrophoresis, CTB monomer forms stable CTB5 through gradient dialysis renaturation;
S4, assembled in vitro AB5 structure chimeric protein
After CTB5 and the EGFP-CTA2-TAT of purifying removes most salt ion by ultrafiltration, by the mass ratio of CTB5:EGFP-CTA2-TAT be 5:1 to 8:! Ratio drop in reaction vessel, making the pH value of mixture be between 2.3-3.0 by adding citric acid, adding rapidly EDETATE SODIUM after 20s and regulating PH to 8.5. room temperature to leave standstill at least 1 hour, until fluorescence recovers gradually.
Further, primer is designed as follows: CGCGGATCCAACACCTCAAAATATTACTGATTT and CAGCCAACTCAGCTTCCTT, the gene of the CTB that namely encodes for the target gene sequence CTB that increases from pet28a-CTB.
Further, design primer is as follows: CGGAATTCCATATGGTGAGCAAGG and CCGCTCGAGCTGTGGTGGAC, have the gene order EGFP-CTA2-TAT of restriction enzyme site NdeI/XhoI for amplification in the gene order from synthesis, namely coding has the gene of EGFP-CTA-TAT.
Further, for convenience of purifying, retain on carrier petduet-CTB original histidine-tagged.
Further, for convenience of purifying, retain on carrier pet22b-EGFP-CTA2-TAT original histidine-tagged.
Further, corresponding modification has been done by connection peptides between the gene order of EGFP-CTA2-TAT.
Chimeric protein CTB5/EGFP-CTA2-TAT is used for the treatment of tumour.
Compared with prior art, the beneficial effect that the present invention has is:
1. assembled in vitro interference is few, and experiment shows, the albumen high purity obtained, and more stable.
2. assembled in vitro is different from cotransformation to same Host Strains, and repeatability is strong, and bacterial expression is free of a burden, can obtain protein raw materials fast.
3. the present invention demonstrates the binding activities of chimeric protein CTB5/EGFP-CTA2-TAT and GM1 first, and result shows that it keeps the high activity be combined with GM1.
4. by the method for HPLC, the present invention verifies whether CTB5/EGFP-CTA2-TAT is formed, and result shows first, and CTB5/EGFP-CTA2-TAT can regulate via potential of hydrogen and be formed.
5. what the present invention was different from cotransformation is, obtain albumen EGFP-CTA2-TAT and CTB5. separately and, CTB5 has tumor-killing power, and EGFP-CTA2-TAT has and wears film ability more efficiently compared to EGFP-TAT, under dosage is 5ug, cell can be entered in 15min, and to cell without lethality, compared to the EGFP-TAT of reported in literature, 100ug, 1 hour, there is significant dosage reducing effect.
Accompanying drawing explanation
Fig. 1 is plasmid petduet-CTB collection of illustrative plates;
Fig. 2 is plasmid pet22b-EGFP-CTA2-TAT collection of illustrative plates;
Fig. 3 is protein electrophoresis figure:
Marker (116kda, 66.2kda, 45kda, 35kda, 25kda, 18.4kda, 14.4kda.) from left to right; 1, CTB monomer purifying result; 2, EGFP-CTA2-TAT protein purification result; 3, CTB refolded protein electrophoresis result;
Fig. 4 is by anti-GFP primary antibodie effect EGFP-CTA2-TAT albumen result and with anti-CTB primary antibodie effect CTB protein electrophoresis figure;
Fig. 5 is that nativepage and blue-ray light excite lower AB5 albumen to assemble result schematic diagram:
A is marker (116kda, 66.2kda, 45kda, 35kda, 25kda, 18.4kda, 14.4kda) from left to right; 1, the complex proteins results of weak current 2, CTB5 of assembling assembles rear result 3, EGFP-CTA2-TAT non denatured electrophoresis result;
Fig. 6 figure blue-ray light excites lower AB5 albumen to assemble result schematic diagram;
Fig. 7 is the HPLC collection of illustrative plates of the EGFP-CTA2-TAT of purifying;
Fig. 8 is the HPLC collection of illustrative plates of the CTB5 of purifying;
Fig. 9 is the HPLC collection of illustrative plates of the mixture AB5 after assembling;
Figure 10 is the schematic diagram that GM1-elisa measures the binding ability of albumen and GM1;
Figure 11 is the PC3 cell image under the fluorescent microscope visual field:
The result of the PC3 cell that A observes under being classified as natural light, B observes the result of PC3 cell under being classified as fluorescence excitation.
Embodiment
Explain the present invention further below in conjunction with embodiment, but embodiment does not limit in any form to the present invention.
Part material reagent in embodiment is as follows:
PetDute-1, pet28a-CTB are this laboratory structure; Gene order EGFP-CTA2-TAT is synthesized by Beijing pul Pu Le company; E.coliDH5a cell, E.coliBL21 (DE3) cell are preserved by this laboratory, carry out bacterial classification order-checking qualification before using; Restriction enzyme BamHI, Hind III, NdeI, XhoI are all purchased from Thermo company; Plasmid extraction kit, PCR primer reclaim test kit, glue reclaims test kit, penbritin, kantlex purchased from Shanghai bio-engineering corporation; Agarose, Tryptones, sodium-chlor, yeast powder are purchased from riel Xin De company; IPTG available from Sigma; Third refining acid amides, the cruel amine of methene propylene, ammonium persulphate, Tris, Glycine, SDS, coomassie brilliant blue R_250, Tween-20, Virahol, Glacial acetic acid, ethanol, methyl alcohol, glycerine etc. are domestic analytical pure; Pfumix is purchased from Novage company; DL5000marker is purchased from Novage company.Antibody is purchased from SAB company, and CTB standard substance are purchased from sigma company.Other reagent such as electrophoresis and consumptive material are domestic analytical pure.
The configuration of LB substratum:
Tryptones 10g, yeast extract 5g, sodium-chlor 10g add the ddH20 of 800ml in beaker, and after fully dissolving, adjust between PH to 7.0-7.2 with 1mol/LNaOH, last constant volume is in the volumetric flask of 1L.Getting 5ml is sub-packed in test tube, 121 degree, and 20min high pressure steam sterilization is for subsequent use.
Embodiment 1
Gene cloning and expression:
See figures.1.and.2, design primer is as follows: CGCGGATCCAACACCTCAAAATATTACTGATTT and CAGCCAACTCAGCTTCCTT, for the target gene sequence CTB that increases from pet28a-CTB, design primer is as follows, CGGAATTCCATATGGTGAGCAAGG and CCGCTCGAGCTGTGGTGGAC, there is for amplification in the gene order from synthesis the CTB after the gene order EGFP-CTA2-TAT. amplification of restriction enzyme site NdeI/XhoI is cloned into the multiple clone site 1 of carrier petduet-1 position by BamHI/HindIII double digestion, and EGFP-CTA2-TAT is cloned into carrier pet22b by NdeI/XhoI double digestion, product is cut after preliminary evaluation through enzyme, be sent to Shanghai biotechnology company limited to check order, the transformant that screening order-checking is correct, positive colony is designated as petduet-CTB and pet22b-EGFP-CTA2-TAT.
Embodiment 2
EGFP-CTA2-TAT soluble proteins expression and purification
Plasmid pet22b-EGFP-CTA2-TAT imports Host Strains
,namely in e. coli bl21 (DE3), and realize expressing; What be transformed into plasmid pet22b-EGFP-CTA2-TAT is rich in the LB substratum of 100ug/mL penbritin in 1:100 ratio enlarged culturing in 2L, in 37 degree, being cultured to OD value in the shaking table of 200rpm is after 2, adds the IPTG that final concentration is 1mM, inducing culture to 8 hour.Culture is sub-packed in the centrifuge tube of 300ml, and in 10000rpm, 4 degree of lower centrifugal 30min, discard substratum, collect bacterium and wash 3 times containing the PBS of 2%tritonx-100 with 200ml, collecting bacterium.Add the PBS of 4ml containing 2%tritonx-100 in the culture that every 100ml is original, and add the N,O-Diacetylmuramidase (purchased from the raw work in Shanghai) that final concentration is 200ug/ml, multigelation 3 times in-20 degree.Be transferred to afterwards in whizzer, in 10000rpm, 4 degree, centrifugal 1 hour, collect supernatant.Supernatant is crossed 0.45um filter membrane (Tianjin is risen) and is loaded in Ni-NTA post, according to GENi-NTA purification step, finally use imidazole gradient wash-out, the purity of EGFP-CTA2-TAT in the sample of each pipe collection is analyzed in SDSPAGE, and carry out WESTERNBLOT analysis with the antibody of anti-GFP, detect whether obtain target protein EGFP-CTA2-TAT.
Embodiment 3
Choleratoxin B subunit inclusion body protein purifying and renaturation
Plasmid petduet-CTB imports in Host Strains BL21 (DE3), and realize expressing, after plasmid petduet-CTB is transformed into e. coli bl21 (DE3), the step before multigelation is consistent with the step that EGFP-CTA2-TAT albumen obtains.After multigelation three times, proceed in whizzer, in 4 degree, centrifugal 30min under 10000rpm, collecting precipitation.Precipitation bufferI (pH=8.0,100mMNaCl, 2%tritonx-100,20mMtris-HCl, 5mMEDTA) washs three times, continues washing successively, collect supernatant with the bufferI of 2M, 4M, 6M, 8M urea.And it is whether pure with the CTB monomer in SDSPAGE detection supernatant.The CTB supernatant that screening purity is high is used for renaturation.BufferII (bufferI, 1mmol/LGSH, Ameresco, 0.1mmol/LGSSH, Ameresco, 8M-0M urea, the PH=7.4) dialysis renaturation of CTB supernatant containing urea containing graded series.Within every 8 hours, change liquid once, by the bufferII of 8M urea, constantly dilute urea concentration, until removing urea.PAGE detects the formation of CTB5, and detected result is shown in Fig. 3 ~ Fig. 4.
Embodiment 4
Assembled in vitro AB5 structure chimeric protein
The PROTEIN C TB5 of purifying and protein EGFP-CTA2-TAT is transferred to (Millipore) in the super filter tube of 10kda, and centrifugal concentrating to volume is 5ml, removes most salt ion simultaneously.BCA method is carried out quantitatively PROTEIN C TB5 and albumen EGFP-CTA2-TAT.The ratio being 5:1 in CTB5:EGFP-CTA2-TAT mass ratio is put in reaction tubes, adding citric acid regulates PH just to disappear to fluorescence, now PH is about 3.0, after 20min, adding EDTA2Na regulates between PH to 8.0-8.5, leaves standstill more than 1 hour, until again can observe fluorescence in blue-ray light in room temperature, with reference to Fig. 6, luminous is CTB5/EGFP-CTA2-TAT.PAGE detects whether define six glycoprotein polyprotein precursors, with reference to Fig. 5.
Embodiment 5
Whether HPLC detects albumen and is formed
Chromatographic column model is TSKGS2000W, and set the chessman on the chessboard according to the chess manual successively by the AB5 mixture after EGFP-CTA2-TAT, CTB5 and assembling, HPLC is purchased from Japanese Shimadzu Corporation, and model is LC-20A..In analytic process, optimum configurations is as follows: temperature is 30 DEG C, and flow velocity is 0.5ml/min, and sample size is 20 μ l, and moving phase is: _ BS. also detects target protein in 210nm place.Experimental result is shown in Fig. 7 ~ Fig. 9, can know that CTB5/EGFP-CTA2-TAT is formed by the HPLC collection of illustrative plates of mixture AB5 after the HPLC collection of illustrative plates of the HPLC collection of illustrative plates of the EGFP-CTA2-TAT by purifying, the CTB5 of purifying, assembling.
Embodiment 6
GM1-elisa detects AB5 protein binding GM1 ability
PBS purchased from the nerve node glycosides fat GM1 sterilizing of sigma is diluted to 10ug/ml. pipettor absorption 100ul and is coated in 96 orifice plates, spends night in 4.Afterwards, pat dry the GM1 solution in 96 orifice plates, and add the confining liquid (PBS of 100ul, 0.2% tween, 10% bovine serum albumin component five) close after 2 hours in 37 degree, pat dry the confining liquid in 96 orifice plates, the CTB5 of graded series concentration is added in every hole, AB5, EGFP-CTA2-TAT, PBS, in 37 degree of shaking tables, low speed hatches 1 hour, abandon the protein solution in dry 96 orifice plates, and respectively by the primary antibodie of anti-CTB, anti-CTB primary antibodie, anti-GFP primary antibodie, anti-GFP primary antibodie (primary antibodie is by 1:500 dilution) acts on one hour in 37 degree, pat dry primary antibodie residual solution, and wash three times with PBST (PBS+0.05% tween), each 20min, after patting dry, continue to add corresponding sheep anti mouse respectively, sheep anti mouse, two anti-(by 1:5000 dilutions) of rabbit against murine, 37 degree hatch one hour after, continuation PBST washs three times, after patting dry clean residual solution, with TMB (Boster, China) a tubular type nitrite ion colour developing, colour developing step is poly-according to this product description, and survey OD value in 450nm place.The parallel 5 hole tests of each concentration samples.
Experimental result is shown in Figure 10, correspond to the CTB5 of this experiment purifying as For the illustrated example, buy CTB5 standard substance from sigma, EGFP-CTA2-TAT, AB5 mixture of purifying, PBS are to the binding ability of GM1, along with concentration raises, stronger with the binding ability of GM1, further, under low dosage, AB5 mixture is stronger compared with the binding ability of CTB5.
Embodiment 7
Film measure of merit is worn based on prostate cancer PC3 cell
Prostate cancer cell kind plate in purchased from 96 healthy and free from worry orifice plates, by 5000/ml concentration kind plate, every hole 2ml.After 24 hours, discard 1640 old substratum, add 1640 substratum 1ml of fresh serum-free, and add the EGFP-CTA2-TAT fusion rotein (16ug/ml) of purifying respectively, AB5 albumen (48ug/ml) and EGFP albumen (16ug/mL), cultivate 1 hour in 37 degree of CO2gas incubator.Discard substratum, and with the careful washed cell of PBS three times, to transfer in fluorescent microscope (OlympusIX71, Japan) fluorescence distribution situation in observation of cell, and Taking Pictures recording.
The results are shown in Figure 11, the result of the PC3 cell that A observes under being classified as natural light, B observes the result of PC3 cell under being classified as fluorescence excitation.As seen from the figure, EGFP-CTA2-TAT is the strongest, and EGFP is invalid, and CTB5/EGFP-CTA2-TAT is effective, demonstrates the formation of CTB5/EGFP-CTA2-TAT further.
Above-described embodiment is only be described the preferred embodiment of the present invention; not scope of the present invention is limited; under not departing from the present invention and designing the prerequisite of spirit; the various distortion that the common engineering technical personnel in this area do technical scheme of the present invention and improvement, all should fall within protection domain that claims of the present invention determines.
Claims (10)
1. passing drug carrier albumen based on Toxins,exo-, cholera CT structure, it is characterized in that, is CTB5/EGFP-CTA2-TAT, assembles for CTB5 and EGFP-CTA2-TAT is chimeric.
2. according to claim 1ly pass drug carrier albumen based on Toxins,exo-, cholera CT structure, it is characterized in that, the aminoacid sequence of CTB5 is for shown in SEQIDNO:1.
3. according to claim 1ly pass drug carrier albumen based on Toxins,exo-, cholera CT structure, it is characterized in that, the aminoacid sequence of EGFP-CTA2-TAT is for shown in SEQIDNO:2.
4. the method for passing the external structure of drug carrier albumen based on Toxins,exo-, cholera CT structure described in claims 1 to 3, it is characterized in that, its step is as follows:
S1, gene cloning and expression
Adopt the method for BamHI/HindIII double digestion, by the position of the gene clone of coding CTB to the multiple clone site 1 of double gene expression vector petduet-1, the carrier called after petduet-CTB of structure;
Coding is had the gene clone of EGFP-CTA-TAT in expression vector pet22b (+), and removes its signal peptide, the restriction enzyme site selected during clone is NdeI and XhoI, the carrier called after pet22b-EGFP-CTA2-TAT of structure
;
S2, EGFP-CTA2-TAT soluble proteins expression and purification
Plasmid pet22b-EGFP-CTA2-TAT imports Host Strains, namely in e. coli bl21 (DE3), and realizes expressing; Pet22b-EGFP-CTA2-TAT expresses with soluble form in e. coli bl21 (DE3) system, finally obtains the pure product of electrophoresis level via Ni-NTA purifying.
S3, choleratoxin B subunit inclusion body protein purifying and renaturation
Plasmid petduet-CTB imports in Host Strains BL21 (DE3), and realize expressing, expression product is inclusion body, inclusion body is by washing, after removing surface impurity, again be dissolved in the urea of gradient concentration, screen pure CTB monomer by electrophoresis, CTB monomer forms stable CTB5 through gradient dialysis renaturation;
S4, assembled in vitro AB5 structure chimeric protein
After CTB5 and the EGFP-CTA2-TAT of purifying removes most salt ion by ultrafiltration, the ratio being 5:1 to 8:1 in the mass ratio of CTB5:EGFP-CTA2-TAT drops in reaction vessel, the pH value of mixture is made to be add rapidly EDETATE SODIUM between 2.3-3.0 after 20s to regulate PH to 8.5. room temperature to leave standstill at least 1 hour by adding citric acid, until fluorescence recovers gradually.
5. method of passing the external structure of drug carrier albumen based on Toxins,exo-, cholera CT structure according to claim 4, it is characterized in that, design primer is as follows: CGCGGATCCAACACCTCAAAATATTACTGATTT and CAGCCAACTCAGCTTCCTT, the gene of the CTB that namely encodes for the target gene sequence CTB that increases from pet28a-CTB.
6. method of passing the external structure of drug carrier albumen based on Toxins,exo-, cholera CT structure according to claim 4, it is characterized in that, design primer is as follows: CGGAATTCCATATGGTGAGCAAGG and CCGCTCGAGCTGTGGTGGAC, have the gene order EGFP-CTA2-TAT of restriction enzyme site NdeI/XhoI for amplification in the gene order from synthesis, namely coding has the gene of EGFP-CTA-TAT.
7. method of passing the external structure of drug carrier albumen based on Toxins,exo-, cholera CT structure according to claim 5, is characterized in that, retains on carrier petduet-CTB original histidine-tagged.
8. method of passing the external structure of drug carrier albumen based on Toxins,exo-, cholera CT structure according to claim 6, is characterized in that, retains on carrier pet22b-EGFP-CTA2-TAT original histidine-tagged.
9. method of passing the external structure of drug carrier albumen based on Toxins,exo-, cholera CT structure according to claim 8, is characterized in that, has done corresponding modification between the gene order of EGFP-CTA2-TAT by connection peptides.
10. pass the treatment of drug carrier albumen for tumour based on Toxins,exo-, cholera CT structure.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511029373.2A CN105504065A (en) | 2015-12-30 | 2015-12-30 | Drug-delivery carrier protein based on cholera toxin CT structure as well as in-vitro construction method and application of drug-delivery carrier protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511029373.2A CN105504065A (en) | 2015-12-30 | 2015-12-30 | Drug-delivery carrier protein based on cholera toxin CT structure as well as in-vitro construction method and application of drug-delivery carrier protein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105504065A true CN105504065A (en) | 2016-04-20 |
Family
ID=55712412
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201511029373.2A Pending CN105504065A (en) | 2015-12-30 | 2015-12-30 | Drug-delivery carrier protein based on cholera toxin CT structure as well as in-vitro construction method and application of drug-delivery carrier protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105504065A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318962A (en) * | 2016-09-07 | 2017-01-11 | 广东工业大学 | Non-fusion expression vector capable of enhancing target gene expression and method for preparing non-fusion expression vector |
| CN106946984A (en) * | 2017-03-17 | 2017-07-14 | 中国科学院武汉物理与数学研究所 | A kind of preparation method for the b subunit of cholera toxin albumen for having bioactivity |
| CN107759698A (en) * | 2017-09-18 | 2018-03-06 | 广东工业大学 | A kind of application of EGFP CTA2 TAT fusion proteins in fluorescence probe is prepared |
| CN110078835A (en) * | 2019-05-30 | 2019-08-02 | 广东工业大学 | One type EGF albumen and its construction method, chimeric protein and its preparation method and application |
| CN112143694A (en) * | 2020-09-25 | 2020-12-29 | 广州白云山花城药业有限公司 | Preparation method of three-dimensional cell sieving drug bracket of in-vitro osteoporosis drug |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942478A (en) * | 2010-08-31 | 2011-01-12 | 上海交通大学 | Foreign protein soluble expression plasmid, preparation method thereof and application method thereof |
| CN104387472A (en) * | 2014-10-24 | 2015-03-04 | 广东工业大学 | Multimeric protein having effect of brain targeting, and preparation method and usage thereof |
-
2015
- 2015-12-30 CN CN201511029373.2A patent/CN105504065A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942478A (en) * | 2010-08-31 | 2011-01-12 | 上海交通大学 | Foreign protein soluble expression plasmid, preparation method thereof and application method thereof |
| CN104387472A (en) * | 2014-10-24 | 2015-03-04 | 广东工业大学 | Multimeric protein having effect of brain targeting, and preparation method and usage thereof |
Non-Patent Citations (2)
| Title |
|---|
| WEIPING LIN等: "Purification and characterization of a novel cell-penetrating carrier similar to cholera toxin chimeric protein", 《PROTEIN EXPRESSION AND PURIFICATION》 * |
| 周小芬等: "不相容双质粒共表达霍乱毒素类似嵌合蛋白", 《基因组学与应用生物学》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318962A (en) * | 2016-09-07 | 2017-01-11 | 广东工业大学 | Non-fusion expression vector capable of enhancing target gene expression and method for preparing non-fusion expression vector |
| CN106318962B (en) * | 2016-09-07 | 2020-10-27 | 广东工业大学 | Non-fusion expression vector capable of enhancing target gene expression and preparation method thereof |
| CN106946984A (en) * | 2017-03-17 | 2017-07-14 | 中国科学院武汉物理与数学研究所 | A kind of preparation method for the b subunit of cholera toxin albumen for having bioactivity |
| CN106946984B (en) * | 2017-03-17 | 2020-06-02 | 中国科学院武汉物理与数学研究所 | Preparation method of cholera toxin B subunit protein with biological activity |
| CN107759698A (en) * | 2017-09-18 | 2018-03-06 | 广东工业大学 | A kind of application of EGFP CTA2 TAT fusion proteins in fluorescence probe is prepared |
| CN110078835A (en) * | 2019-05-30 | 2019-08-02 | 广东工业大学 | One type EGF albumen and its construction method, chimeric protein and its preparation method and application |
| CN110078835B (en) * | 2019-05-30 | 2021-08-13 | 广东工业大学 | EGF-like protein, construction method thereof, chimeric protein, preparation method and application thereof |
| CN112143694A (en) * | 2020-09-25 | 2020-12-29 | 广州白云山花城药业有限公司 | Preparation method of three-dimensional cell sieving drug bracket of in-vitro osteoporosis drug |
| CN112143694B (en) * | 2020-09-25 | 2021-05-18 | 广州白云山花城药业有限公司 | Preparation method of three-dimensional cell sieving drug bracket of in-vitro osteoporosis drug |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105504065A (en) | Drug-delivery carrier protein based on cholera toxin CT structure as well as in-vitro construction method and application of drug-delivery carrier protein | |
| CN105567641B (en) | A kind of preparation method and applications carrying anti-tumor protein targeting exosome | |
| CN104540846B (en) | Methods for refolding g-csf from inclusion bodies | |
| CN109529044A (en) | A kind of tumor-targeting drug and preparation method thereof | |
| CN111620952A (en) | Novel coronavirus vaccine based on chimeric virus-like particles | |
| CN110655556B (en) | Preparation and method of immunoregulatory peptide | |
| Liew et al. | High-yield and scalable cell-free assembly of virus-like particles by dilution | |
| JP2011083292A (en) | Modulation of protein function by spatial configuration | |
| Bin Mohamed Suffian et al. | Yield optimisation of Hepatitis B virus core particles in E. coli expression system for drug delivery applications | |
| WO2018074558A1 (en) | Composite polypeptide monomer, aggregate of said composite polypeptide monomer having cell penetration function, and norovirus component vaccine for subcutaneous, intradermal, percutaneous, or intramuscular administration and having said aggregate as effective component thereof | |
| CN106632664A (en) | Apolipoprotein II/I and preparation method, biological function and application thereof | |
| WO2021120900A1 (en) | Method for preparing recombinant human nerve growth factor | |
| CN111530439B (en) | Method for preparing fixed-value syphilis specific antibody in serum | |
| CN101747437B (en) | Apoptin-EC-SOD carboxyl terminal protein transduction domain fusion protein | |
| CN102321591A (en) | Assembly mechanism of virus-like particle of hepatitis E virus and preparation method thereof | |
| CN105669856A (en) | Gene recombination long-acting adrenocorticotropic hormone and preparation method thereof | |
| WO2018024153A1 (en) | Preparation method and use of recombinant swine fever e2 protein and subunit vaccine thereof | |
| CN104311656B (en) | 21 albumen of cFGF and its application in treatment rheumatoid arthritis | |
| CN104342423B (en) | High activity recombinant human chymotrypsin preparation method and application | |
| WO2020210965A1 (en) | Method for extraction and purification of hirudin mutant and use thereof | |
| CN102174104A (en) | Duck plague virus cyst membrane gI protein polyclonal antibody as well as preparation method and application thereof | |
| WO2021004561A1 (en) | Rubella virus spike construct | |
| CN105693864A (en) | Tripolymer TRAIL protein and application thereof | |
| CN114276423B (en) | S protein mutant of porcine transmissible gastroenteritis virus and application thereof | |
| CN109762056A (en) | A kind of extracting method of nerve growth factor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20170731 Address after: 529240 No. 333 Nanshan Road, off street, Jianghai District, Guangdong, Jiangmen, China Applicant after: Jiangmen large Health International Innovation Research Institute Address before: 510006 Panyu District, Guangzhou, Guangzhou University,, West Ring Road, No. 100 Applicant before: Guangdong University of Technology |
|
| TA01 | Transfer of patent application right | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160420 |
|
| WD01 | Invention patent application deemed withdrawn after publication |