CN105483270A - Microsatellite marking method applied to pony genetic diversity detection - Google Patents

Abstract

The invention discloses a microsatellite marking method applied to pony genetic diversity detection. The method comprises the following steps that a pony genome PCR library is created; microsatellite sequence-based screening is conducted through a paramagnetic particle method; classification and verification are conducted on pony microsatellite marking sequences. When the pony genome PCR library is created, an obtained DNA fragment serves as a template, and primers (5'-GATCGTCGACGGTACCGAATTCT; 5'-GTCAAGAATTCGGTACCGTCGAC) are designed; PCR amplification is conducted, and the genome PCR library is created. According to the microsatellite marking method applied to pony genetic diversity detection, microsatellite marks applied to pony genetic diversity detection can be obtained rapidly and effectively in large quantities.

Description

A kind of microsatellite marking method being applied to pony Diversity Detection

Technical field

The invention belongs to animal molecular genetics technical field, be specifically related to the Microsatellite DNA as Molecular Genetic Marker of pony.

Background technology

Micro-satellite is a kind of new molecule marker grown up in recent ten years, and it refers to a few Nucleotide (1 ~ 6) for the repeated simple sequence of unit, wherein repeats the most common with dinucleotide.Be applied to the Diversity Detection of relevant population and the structure of genetic map.The acquisition of current microsatellite sequence mainly contains two kinds of approach: a kind of is build with classical molecular biology method the genomic library being rich in microsatellite locus, the positive colony containing microsatellite sequence is gone out by screening by hybridization, but screening process is more complicated, screening efficiency is low, needs a large amount of manpowers and the input of fund; Another kind retrieves from known nucleotide sequence, but searchable resource is relatively limited.Chinese Miniature Horses is the rare and endangered species of China, significant to the evaluation of its genetic diversity.At present, the Microsatellite DNA isolation preparation method relating to pony is also very rare.Therefore, new pony Microsatellite DNA isolation method is sought very important.

The more close public technology that current those skilled in the art can be known mainly contain following these:

1, application number number is 01106477.3, name is called the open Chinese invention patent document of the pig microsatellite DNA mark being applicable to pig variety classification, the feature of this invention is, build part small insert genomic library, the new microsatellite marker of isolation identification pig, screening is wherein applicable to pig microsatellite marker HAU01, HAU02, HAU03 of pig variety classification, determines this three microsatellite marker DNA sequence, devises the primer in three sites.The qualification of the assortment that this invention is pig, relationship and marker-assisted breeding provide new molecule marker.

2, application number is 201410022080.0, name is called the Chinese patent document of the method for grass carp paternity test micro-satellite Multiplex fluorescent PCR, this invention utilizes microsatellite marker and multiple fluorescence PCR combine with technique, 13 height polymorphic micro-satellite sites are screened, set up 3 multiple fluorescence PCR systems, by sequenator somatotype, high-throughput individual recognition and parent child relationship analysis are carried out to grass carp family; Of the present invention be established as grass carp Idioplasm identification, family management and enhancement effect assessment provide a kind of new technique means.

The shortcoming of these these technology is above: apply the method that multiple restriction endonuclease cuts genomic dna jointly.This method can produce more satisfactory fragment, obtains enough flanking sequences to design primer, but to produce be not the digestion products of flush end if cut with multienzyme, and product needs to carry out end-filling.

Summary of the invention

The present invention intends realizing obtaining reliable microsatellite marker sequence by building microsatellite DNA library, microsatellite sequence screening, design of primers and the step such as optimization and micro-satellite detection, and the Diversity Detection for Chinese Miniature Horses provides molecule marker means.

The present invention is achieved in that

Be applied to a microsatellite marking method for pony Diversity Detection, the method comprises the steps:

Step 1: pony Genomic PCR library creates;

Step 2: paramagnetic particle method carries out microsatellite sequence screening;

Step 3: the classification of pony microsatellite marker sequence and checking.

Wherein, in step 1, the establishment of pony Genomic PCR library comprises the steps:

Step 1.1: the extraction of pony genomic dna;

Step 1.2: ultrasonic disruption genomic dna;

Step 1.3: according to the size adjustment sample process instrument parameter of object fragment;

Step 1.4: the DNA electrophoresis detection after ultrasonic disruption;

Step 1.5: create Genomic PCR library.

In step 1.5, with the DNA fragmentation obtained as template, design primer (5'-GATCGTCGACGGTACCGAATTCT; 5'-GTCAAGAATTCGGTACCGTCGAC), carry out pcr amplification, create Genomic PCR library.

In step 2 paramagnetic particle method carry out microsatellite sequence screening comprise the steps:

Step 2.1: with biotin labeled microsatellite probe and Dynal magnetic bead and micro-satellite Library hybridization;

Step 2.2: the balance of magnetic bead;

Step 2.3: magnetic bead adsorption and enrichment;

Step 2.4: the single stranded DNA of catching containing microsatellite sequence go forward side by side performing PCR amplification;

Step 2.5: connect T-carrier, clone;

Step 2.6: in situ hybridization, carries out postsearch screening with isotope probe.

Step 2.1 adopts following methods to realize: experimentally 50 μ L reaction systems set up by material, 1.5 μ L biotin labeled (CA) 15 probe, 5 μ L (50 μm of ol/L) primer, 15 μ L20 × SSC, 0.5 μ L10%SDS and 16 μ LddH2O, mixing, 68 DEG C of preheatings; By 12 μ L (276ng) DNA95 DEG C of sex change 5min, add the hybrid mixed liquid of preheating, 68 DEG C of hybridization 1h; Magnetic bead is balanced in crossover process.

Step 2.4 adopts following methods to realize: wash 2 times with 200 μ L0.1 × TE fast in room temperature, adds 50 μ L0.1 × TE95 DEG C sex change 10min, discharges the single stranded DNA containing microsatellite sequence, be placed on sucking-off on magnetic frame for subsequent use; PCR reaction system 25 μ L, include the mixing PCR damping fluid 18 μ L of 4 kinds of dNTP, primer 0.5 μ L, Taq DNA polymerase 0.5 μ L, adds the template of no more than 4 μ L according to the concentration of DNA profiling, adds sterilized water and supplies PCR instrument and increase; After completion of the reaction, cross whiz post to remove unnecessary primer and not participate in the dNTP of reaction, and be concentrated to 15 μ about L, electrophoresis detection.

Step 2.5 adopts following methods to realize: set up 10 μ L ligation systems: 2 × ligase enzyme damping fluid 5 μ L, pGEM-Tvector1 μ L, insert DNA fragmentation 2 μ L, T4DNA ligase enzyme 1 μ L (3U/ μ L), add aseptic deionized water and supply 10 μ L, carrier T self connects in contrast simultaneously, and 4 DEG C of connections are spent the night; Use CaCl ₂the competence escherichia coli DH5a of preparation transforms, and obtains micro-satellite genomic library.

Step 2.6 adopts following methods to realize: carry out postsearch screening by situ hybridization to micro-satellite library; By transforming the Cloning Transformation of gained on Hybond membrane, retain the bacterium plate of identical size simultaneously, with until results of hybridization out after picking positive colony; Hybridize with isotope-labeled (CA) 15, pressure X-ray, 70 DEG C of radioautograph 7d; Picking positive colony carries out sequencing analysis.

In step 3, the classification of pony microsatellite marker sequence comprises the steps: with checking

Step 3.1: sequence is classified;

Step 3.2: the repeatability of microsatellite marker sequence, stability, polymorphism inspection.

Technique effect of the present invention quick, effective, a large amount of acquisitions can be applied to the microsatellite marker of pony Diversity Detection.The structure that the pony microsatellite marker that this method obtains also can be applicable to pony genetic map detects with other molecular biology, molecular ecology.

Embodiment

Below in conjunction with embodiment, the present invention is described in further detail, and in embodiment, relative quantities number, per-cent, quantitative proportion etc., if without specified otherwise, all refer to mass unit.

Embodiment 1:

Concrete steps are as follows:

One, pony Genomic PCR library creates:

1, the extraction of pony genomic dna:

By fresh for 5ml pony blood or the freezing pony blood sample (or muscle tissue) through EDTA anti-freezing, applying gene group reagent box extracts genomic dna, then detects quantitatively with spectrophotometer.

2, ultrasonic disruption genomic dna:

100 μ L, 2 μ g genomic dnas are put into Covaris company of the automatic focusing acoustic sample processing instrument Covaris220(U.S.) special cuvette (520045), build for subsequent use.

3, according to the size adjustment sample process instrument parameter of object fragment:

Object fragment is between 300 ~ 500bp, and in Covaris220 function software, optimum configurations is as follows: Dutyfactor10%, peakincidentpower140W, CycleperBrust200, Tim80s.

4, the DNA electrophoresis detection after ultrasonic disruption:

By the DNA after fragmentation with 1% agarose gel electrophoresis detect, EB dye, then carry out observation analysis with gel imaging system, by the DNA of peak value at about 300bp, carry out the detection of DNA crushing effect with biological analyser.

5, Genomic PCR library is created:

With the DNA fragmentation obtained as template, design primer (5'-GATCGTCGACGGTACCGAATTCT; 5'-GTCAAGAATTCGGTACCGTCGAC), carry out pcr amplification, create Genomic PCR library.PCR reaction system is: 94 DEG C of denaturation 3min, 94 DEG C of 1min, 58 DEG C of 1min, 72 DEG C of 1min, 30 circulations, and last 72 DEG C extend 10min.After completion of the reaction, cross whiz post to remove unnecessary primer and not participate in reaction dNTP, and be concentrated to 15 μ about L.Electrophoresis detection.

Two, paramagnetic particle method carries out microsatellite sequence screening:

1, with biotin labeled microsatellite probe and Dynal magnetic bead and micro-satellite Library hybridization:

Experimentally 50 μ L reaction systems set up by material, 1.5 μ L (10 μm of ol/L) biotin labeled (CA) 15 probe, 5 μ L (50 μm of ol/L) primer, 15 μ L20 × SSC, 0.5 μ L10%SDS and 16 μ LddH2O, mixing, 68 DEG C of preheatings.By 12 μ L (276ng) DNA95 DEG C of sex change 5min, add the hybrid mixed liquid of preheating, 68 DEG C of hybridization 1h.Magnetic bead is balanced in crossover process.

2, the balance of magnetic bead:

Magnetic bead is shaken up gently, in the silication centrifuge tube of sucking-off 100 μ L to 500 μ L, is placed on 1 ~ 2min on magnetic frame, gently sucking-off salts solution.With 200 μ LB & W wash liquid 2 times, then use 200 μ L washing lotion I(6 × SSC and 0.1%SDS) repetitive scrubbing balance, until magnetic bead surfaces becomes smooth easy wash-out.Add 200 μ L washing lotions I, room temperature is placed until hybridize complete.

3, magnetic bead adsorption and enrichment:

The complete hybridization solution of hybridization is added in the fresh magnetic bead balanced, 25 DEG C of incubation 20min, and shake make vitamin H and Streptavidin fully combine gently.After incubation terminates, centrifuge tube is placed on magnetic frame, removes solution.Use washing lotion I successively, washing lotion II, washing lotion III washs magnetic bead, removes the sequence not containing micro-satellite.Washing methods is: washing lotion I washes 2 times in room temperature, leaves standstill 10min at every turn; Washing lotion II washes 2 times at 68 DEG C, leaves standstill 15min at every turn; Washing lotion III washes 2 times fast in room temperature, can substantially remove clean by the sequence not containing micro-satellite.

4, the single stranded DNA of catching containing microsatellite sequence go forward side by side performing PCR amplification:

Wash 2 times with 200 μ L0.1 × TE fast in room temperature, add 50 μ L0.1 × TE95 DEG C sex change 10min, discharge the single stranded DNA containing microsatellite sequence, be placed on sucking-off on magnetic frame for subsequent use.PCR reaction system 25 μ L, include the mixing PCR damping fluid 18 μ L of 4 kinds of dNTP, primer 0.5 μ L, Taq DNA polymerase 0.5 μ L, adds the template of no more than 4 μ L according to the concentration of DNA profiling, adds sterilized water and supplies PCR instrument and increase.After completion of the reaction, cross whiz post to remove unnecessary primer and not participate in the dNTP of reaction, and be concentrated to 15 μ about L, electrophoresis detection.

5, T-carrier is connected, clone:

Set up 10 μ L ligation systems: 2 × ligase enzyme damping fluid 5 μ L, pGEM-Tvector1 μ L, insert DNA fragmentation 2 μ L, T4DNA ligase enzyme 1 μ L (3U/ μ L), add aseptic deionized water and supply 10 μ L, carrier T self connects in contrast simultaneously, and 4 DEG C of connections are spent the night.The competence escherichia coli DH5a prepared with CaCl2 transforms, and obtains micro-satellite genomic library.

6, in situ hybridization, carry out postsearch screening with isotope probe:

By in situ hybridization, postsearch screening is carried out to micro-satellite library.By transforming the Cloning Transformation of gained on Hybond membrane, retain the bacterium plate of identical size simultaneously, with until results of hybridization out after picking positive colony.Hybridize with isotope-labeled (CA) 15, pressure X-ray, 70 DEG C of radioautograph 7d (optical signal power increase and decrease autoradiographic time).Picking positive colony carries out sequencing analysis.

Three, the classification of pony microsatellite marker sequence and checking

1, sequence classification:

The positive colony obtained in above-mentioned experiment is carried out sequencing analysis, the order-checking standard proposed according to Weber (1990) is classified, calculate the ratio of perfect type, imperfections type and mixed type, wherein the microsatellite sequence ratio of perfect type should reach more than 60%.In addition, the ratio of multiplicity more than 10 times should more than 60%.

2, the repeatability of microsatellite marker sequence, stability, polymorphism inspection:

(1) gather China's five each kinds of kind (Guizhou, Yunnan, Shaanxi, Sichuan, Guangxi) pony blood sample 60 parts, every part of 5-10ml, EDTA anti-freezing ,-20 cryopreservation are for subsequent use.When the choice criteria of pony was 5 one full year of life, height is below 106cm.

(2) according to above-mentioned obtained microsatellite marker sequence two ends complementary sequence synthetic primer, carry out pcr amplification, carry out polyacrylamide gel electrophoresis (PAGE) distinguish according to the different DNA fragmentations obtained, AgNo3 dyes.

(3) in gel imaging system, somatotype is carried out according to PAGE result, to each microsatellite marker amplification of different varieties pony, application Microsat, the softwares such as Phylip carry out effective number of allele (Ne), heterozygosity (He), polymorphism information content (PIC) equivalent calculation, comprehensively analyze.

(4) between different pony kind, repeat amplification protcol is carried out to the microsatellite marker of above-mentioned acquisition, pass through obtained object stripe size, the stability evaluating its microsatellite marker with or without amplification and repeatability.The pony microsatellite marker that final selection is reproducible, stability strong, polymorphism information content value is high.

Certainly, more than just embody rule example of the present invention, the technical scheme that the present invention also has other embodiment, all employings to be equal to replacement or equivalent transformation to be formed, all drops within protection domain of the presently claimed invention.

Sequence table

SEQUENCELISTING

<110> Guizhou University

<120> mono-kind is applied to the microsatellite marking method of pony Diversity Detection

<130>nm:

<160>2

<170>PatentInversion3.3

<210>1

<211>23

<212>DNA

<213> artificial sequence

<220>

<223> designs, for the pcr amplification of pony genomic dna according to Nucleotide conserved sequence

<400>1

gatcgtcgacggtaccgaattct23

<210>2

<211>23

<212>DNA

<213> artificial sequence

<220>

<223> designs, for the pcr amplification of pony genomic dna according to Nucleotide conserved sequence

<400>2

gtcaagaattcggtaccgtcgac23

Claims (9)

1. be applied to a microsatellite marking method for pony Diversity Detection, it is characterized in that: the method comprises the steps:

Step 1: pony Genomic PCR library creates;

Step 2: paramagnetic particle method carries out microsatellite sequence screening;

Step 3: the classification of pony microsatellite marker sequence and checking.

2. the microsatellite marking method being applied to pony Diversity Detection according to claim 1, is characterized in that: described pony Genomic PCR library creates and comprises the steps:

Step 1.1: the extraction of pony genomic dna;

Step 1.2: ultrasonic disruption genomic dna;

Step 1.3: according to the size adjustment sample process instrument parameter of object fragment;

Step 1.4: the DNA electrophoresis detection after ultrasonic disruption;

Step 1.5: create Genomic PCR library.

3. the microsatellite marking method being applied to pony Diversity Detection according to claim 2, is characterized in that: in step 1.5, with the DNA fragmentation obtained as template, and design primer (5'-GATCGTCGACGGTACCGAATTCT; 5'-GTCAAGAATTCGGTACCGTCGAC), carry out pcr amplification, create Genomic PCR library.

4. the microsatellite marking method being applied to pony Diversity Detection according to claim 1, is characterized in that: described paramagnetic particle method carries out microsatellite sequence screening and comprises the steps:

Step 2.1: with biotin labeled microsatellite probe and Dynal magnetic bead and micro-satellite Library hybridization;

Step 2.2: the balance of magnetic bead;

Step 2.3: magnetic bead adsorption and enrichment;

Step 2.4: the single stranded DNA of catching containing microsatellite sequence go forward side by side performing PCR amplification;

Step 2.5: connect T-carrier, clone;

Step 2.6: in situ hybridization, carries out postsearch screening with isotope probe.

5. the microsatellite marking method being applied to pony Diversity Detection according to claim 4, it is characterized in that: step 2.1 adopts following methods to realize: experimentally 50 μ L reaction systems set up by material, 1.5 μ L biotin labeled (CA) 15 probe, 5 μ L (50 μm of ol/L) primer, 15 μ L20 × SSC, 0.5 μ L10%SDS and 16 μ LddH2O, mixing, 68 DEG C of preheatings; By 12 μ L (276ng) DNA95 DEG C of sex change 5min, add the hybrid mixed liquid of preheating, 68 DEG C of hybridization 1h; Magnetic bead is balanced in crossover process.

6. the microsatellite marking method being applied to pony Diversity Detection according to claim 4, it is characterized in that: step 2.4 adopts following methods to realize: wash 2 times with 200 μ L0.1 × TE fast in room temperature, add 50 μ L0.1 × TE95 DEG C sex change 10min, discharge the single stranded DNA containing microsatellite sequence, be placed on sucking-off on magnetic frame for subsequent use; PCR reaction system 25 μ L, include the mixing PCR damping fluid 18 μ L of 4 kinds of dNTP, primer 0.5 μ L, Taq DNA polymerase 0.5 μ L, adds the template of no more than 4 μ L according to the concentration of DNA profiling, adds sterilized water and supplies PCR instrument and increase; After completion of the reaction, cross whiz post to remove unnecessary primer and not participate in the dNTP of reaction, and be concentrated to 15 μ about L, electrophoresis detection.

7. the microsatellite marking method being applied to pony Diversity Detection according to claim 4, it is characterized in that: step 2.5 adopts following methods to realize: set up 10 μ L ligation systems: 2 × ligase enzyme damping fluid 5 μ L, pGEM-Tvector1 μ L, insert DNA fragmentation 2 μ L, T4DNA ligase enzyme 1 μ L (3U/ μ L), add aseptic deionized water and supply 10 μ L, carrier T self connects in contrast simultaneously, and 4 DEG C of connections are spent the night; Use CaCl ₂the competence escherichia coli DH5a of preparation transforms, and obtains micro-satellite genomic library.

8. the microsatellite marking method being applied to pony Diversity Detection according to claim 4, is characterized in that: step 2.6 adopts following methods to realize: carry out postsearch screening by situ hybridization to micro-satellite library; By transforming the Cloning Transformation of gained on Hybond membrane, retain the bacterium plate of identical size simultaneously, with until results of hybridization out after picking positive colony; Hybridize with isotope-labeled (CA) 15, pressure X-ray, 70 DEG C of radioautograph 7d; Picking positive colony carries out sequencing analysis.

9. the microsatellite marking method being applied to pony Diversity Detection according to claim 1, is characterized in that: described pony microsatellite marker sequence classification comprises the steps: with checking

Step 3.1: sequence is classified;

Step 3.2: the repeatability of microsatellite marker sequence, stability, polymorphism inspection.