CN108300766A - Methylate to chromatin open zone and mitochondria using transposase the method for research - Google Patents
Methylate to chromatin open zone and mitochondria using transposase the method for research Download PDFInfo
- Publication number
- CN108300766A CN108300766A CN201810040939.9A CN201810040939A CN108300766A CN 108300766 A CN108300766 A CN 108300766A CN 201810040939 A CN201810040939 A CN 201810040939A CN 108300766 A CN108300766 A CN 108300766A
- Authority
- CN
- China
- Prior art keywords
- mitochondria
- dna
- open zone
- seq
- chromatin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to gene engineering technology fields, and in particular to a method of the research that methylates being carried out to chromatin open zone and mitochondrial genomes using transposase.For existing mitochondrial genomes have to extraction DNA separating-purifyings could carry out methylating research the problem of, the present invention provides a kind of method for the research that chromatin open zone and mitochondrial DNA methylate using transposase.The present invention is after cell lysis, digestion is carried out to chromatin using Transposon compounds, obtain the DNA fragmentation and mitochondria DNA fragment in chromatin open zone, notch filling-in, weight bisulfite conversion are carried out again, the library being sequenced for Illumina is obtained after amplification, it is compared with reference gene group after Illumina is sequenced, the cytimidine site for the modification that obtains methylating, the i.e. sites 5mC.The present invention can directly carry out the research that methylates of chromatin open zone and mitochondria, simplify process, improve mitochondria and methylate Efficiency.
Description
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of to utilize transposase to chromatin open zone and line grain
Body genome methylate the method for research.
Background technology
New-generation sequencing technology is just favourably welcome with the advantage of high-throughput low cost from occurring certainly.With technology
Development, new-generation sequencing technology have application in terms of many scientific researches and clinical detection.Many scientific researches at present with face
Bed application needs to carry out in individual cells level, or is carried out in minor levels.In individual cell level analysis DNA hereditary variations letter
Breath, judges whether cell, embryo or individual illness or carry disease gene, is also common research method.
The structure of sequencing library is the necessary step of high-flux sequence, and traditional sequencing library construction method mainly passes through
It interrupts instrument (such as Covaris) to interrupt the target DNAs such as genomic DNA progress machinery, then passes through end reparation, the first-class step of adjunction
It is rapid to realize.The segment randomness interrupted based on machinery is good, but also to rely on a large amount of Covaris on flux and interrupt instrument, together
When need follow-up individually to carry out end-o f-pipe -control, adjunction head and PCR and various purification process.
Tn5 transposases are a kind of transposases of bacterial origin, by 926 amino acid encodings, molecular weight about 53KD.There is research
It was found that Tn5 transposases can be used while realizing the addition of DNA fragmentation and connector, sequencing library structure is completed.Its mechanism of action
For conservative " cut and paste ", after Tn5 can cut DNA double chain, the joint sequence that is incorporated on Tn5
(Adaptor) both ends of DNA sequence dna are connected to.
2013, Stanford University used the transposase Tn5 for combining Adaptor to human lymphoblastoid cell line for the first time
GM12878 carries out chromatin digestion, to positioning, the DNA combinations in single base level to chromatin open zone in the genome
Interaction between albumen, single nucleosome and chromosome assembling is studied.We analyze its data, find
The data of about 10-70% are compared mitochondria.Chromosome in cell itself there is open zone and the region that is closely wound,
Open area typically constitutes from the 1-2% of chromosomal DNA, and mitochondria is present in cytoplasm, is the DNA with independent inheritance characteristic,
And chromosomal DNA is present in nucleus.ATAC-seq technologies disclosed in Stanford University obtain chromosome open area,
When analyzing sequencing data, only retain the data of Matrix attachment region, mitochondria data can abandon.
It is another to have researcher that Tn5 fragmentation DNA techniques methylate research field applied to full-length genome, referred to as
Tagmentation-based WGBs (T-WGBs), i.e., the full-length genome bisulfite sequencing based on fragmentation.It mainly leads to
It crosses and Tn5 fragmentations is carried out to extremely low genomic DNA sample and carry out bisulfite conversion, to full genome after PCR builds library
Group carries out the methylation sites analysis of mononucleotide level.Its key technology is as follows：(1) to above-mentioned Transposon
All C (cytimidine) in Sequences carry out the modification that methylates, and the C in the sequence is prevented to be converted into U by bisulfite
(uracil)；(2) after transposon sequences are connected on DNA fragmentation by Tn5, using replacement policy, with one section of cytimidine first
The identification sequence of 19bp is substituted for the sequence (Replacement of the band Adaptor for the modification that methylates by the sequence of base
Oligo), so ensure that the Adaptor sequences at DNA fragmentation both ends are not changed by bisulfite；⑶Replacement oligo
3 ' end inverted modifications, prevent oligo DNA sequence dnas from being degraded by 3 ' -5 ' 5 prime excision enzyme activity of T4DNA polymerases.
Although this method can measure mitochondrial genomes, ratio of the mitochondrial genomes in its sequencing data is extremely low,
Sequencing data amount is big, and sequencing is of high cost, therefore the methylation analysis of mitochondrial genomes is limited.If it is desired that with this method to line
Mitochondrial genes group carries out full-length genome and methylates sequencing, then needs individually can just obtain purer mitochondria progress separating-purifying
Mitochondrial genomes, operating process is complicated tediously long, and the sample size needed is very big.
Existing mitochondrial genomes research method is usually two schemes：1, separate mitochondria, then nucleic acid is extracted, disadvantage
Sample size including needs is very big, usually still has the pollution of a small amount of Matrix attachment region；2, total nucleic acid is extracted, wherein including core
Genome and mitochondrial genomes, then mitochondrial genomes DNA is captured by PCR or sonde method, the disadvantage is that step is complicated, at
This height.
Invention content
It has to that DNA progress separating-purifyings the research that methylates could be carried out for above-mentioned mitochondrial genomes research method
The problems such as, the present invention provides a kind of method for the research that chromatin open zone and mitochondrial DNA methylate using transposase.
The present invention solve technical problem technical solution be：There is provided it is a kind of using transposase to chromatin open zone and line grain
Body methylates the method for research, specifically includes following steps：
A, after cell cracking, digestion is carried out to chromatin using Transposon compounds, obtains chromatin open zone
DNA fragmentation and/or mitochondria DNA fragment；
B, the DNA fragmentation obtained to step a carries out notch filling-in, then carries out bisulfite conversion, then with containing
The DNA and/or line grain in the chromatin open zone obtained after the primer pair bisulfite conversion of Illumina Adaptor sequences
Body DNA carries out PCR amplification, obtains the library being sequenced for Illumina, is compared with reference gene group after Illumina is sequenced,
Obtain methylating the cytimidine site of modification, i.e. the sites 5mC.
Wherein, in the method for the above-mentioned research that methylated to chromatin open zone and mitochondria using transposase, institute in step a
The Transposon compounds stated are that connector 1,2 is incubated with Tn5 transposases.
Wherein, in the method for the above-mentioned research that methylated to chromatin open zone and mitochondria using transposase, institute in step a
The preparation method for the Transposon compounds stated is that nucleotides sequence is classified as SEQ ID NO：Connector 1 shown in 1 and SEQ ID
NO:After connector 2 shown in 2 dissolves, it is incubated in PCR instrument, obtains the connector for being annealed into double-strand, add Tn5 transposases,
Incubation at room temperature, obtains Transposon compounds.
Further, described in the method for the above-mentioned research that methylated to chromatin open zone and mitochondria using transposase
The nucleotides sequence of connector 1 be classified as SEQ ID NO：Sequence shown in 1, all modification C that methylate of C
(TcGTcGGcAGcGTcAGATGTGTATAAGAGAcAG, wherein c:5-methylcytosine).
SEQ ID NO：1：
5’-TcGTcGGcAGcGTcAGATGTGTATAAGAGAcAG
Wherein, in the method for the above-mentioned research that methylated to chromatin open zone and mitochondria using transposase, institute in step a
The nucleotides sequence for the connector 2 stated is classified as in SEQ ID NO：5 ' phosphorylation modification on the basis of 2, after the modification of 3 ' dideoxycytidine acid
Obtained sequence (pCTGTCTCTTATACAddC, p:Phosphorylation, ddC:Dideoxycytidine acid).
SEQ ID NO:2CTGTCTCTTATACAC
Wherein, in the method for the above-mentioned research that methylated to chromatin open zone and mitochondria using transposase, institute in step b
The concrete operation method for the notch filling-in stated is：SEQ ID NO are replaced with replacement oligo：2, then utilize
Two kinds of enzymes of ampligase and T4DNA polymerases act on the notch of filling-in 9bp simultaneously.
Further, above-mentioned SEQ ID NO：2 and SEQ ID NO：35 ' ends carry out phosphorylation modification, SEQ ID NO：1
With SEQ ID NO：3 all C carry out the modification that methylates.
The Replacement oligo nucleotides sequences are classified as in SEQ ID NO:Through 5 ' phosphorylation modifications on the basis of 3,
3 ' inversion deoxythymidylic acids modification and all C bases methylate modification obtained from sequence (pcTGTcTcTTA
TAcAcATcTccGAGccCAcGAGAcinvT p:Phosphorylation modification, c:5-methylcytosine, invT:The deoxidation of inverse composition
Thymidylic acid).The inversion deoxythymidylic acid is meant that：Standard reaction is 3 ' -5 ' reactions, and inversion is inverse composition, reversely
Synthesis is to be added to nucleotide in DNA chain with 5 ' -3 ' directions.
SEQ ID NO：3cTGTcTcTTA TAcAcATcTccGAGccCAcGAGAcT
Beneficial effects of the present invention are：The present invention provides a kind of using Tn5 transposases to chromosome open zone and line grain
Body DNA methylate the method for research, and this method need not extract nucleic acid, directly used after lytic cell Tn5 transposases into
Row digestion obtains chromosome open zone and mitochondria DNA fragment；It needs to carry out mitochondrial DNA compared to existing acquisition mitochondrial DNA
Extraction, the low problem of extraction efficiency, the method for the present invention can reduce the interference of chromatin dna, improve mitochondrial DNA in sequencing number
Ratio in, (on this basis, handled using bisulfite (bisulfite), it can be to chromosomal section region
It is all studied with the methylation status of mitochondrial genomes.The method of the present invention can handle trace sample (500-20,
0000cells or 1-200ng DNA), DNA extraction operations are simplified, reduces sequencing amount, improves work efficiency, reduce
Research cost.
Description of the drawings
Fig. 1 show the testing result of 1 chip analyzer of sample；
Fig. 2 show the testing result of 2 chip analyzer of sample；
Fig. 3 show chromosome open zone.
Specific implementation mode
The present invention provides a kind of to methylate to chromatin open zone and mitochondria using transposase the method for research, specifically
Include the following steps：
A, after cell cracking, digestion is carried out to chromatin using Tn5 transposases, obtains the DNA fragmentation in chromatin open zone
And/or mitochondria DNA fragment；
B, the DNA fragmentation obtained to step a carries out notch filling-in, then carries out bisulfite conversion, then with containing
The primer of Illumina Adaptor sequences is expanded, and the library that can be used for Illumina sequencings is obtained.
Specifically, the method for the present invention includes the following steps：
A, after cell cracking, digestion is carried out to chromatin using Transposon compounds, obtains chromatin open zone
DNA fragmentation and/or mitochondria DNA fragment；The Transposon compounds are that connector 1,2 is incubated with Tn5 transposases,
When incubation, nucleotides sequence is classified as SEQ ID NO：Connector 1 shown in 1 and SEQ ID NO:After connector 2 shown in 2 dissolves,
It is incubated in PCR instrument, obtains the connector for being annealed into double-strand, add Tn5 transposases, be incubated at room temperature, obtain Transposon
Compound；The nucleotides sequence of connector 1 is classified as 5 '-TcGTcGGcAGcGTcAGATGTGTATAAGAGAcAG；The nucleotide of connector 2
Sequence is pCTGTCTCTTATACAddC；
B, the DNA fragmentation obtained to step a carries out notch filling-in, then carries out bisulfite conversion, then with containing
The primer of Illumina Adaptor sequences is expanded, and is obtained the library being sequenced for Illumina, is sequenced through Illumina
It is compared afterwards with reference gene group, the cytimidine site for the modification that obtains methylating, the i.e. sites 5mC；The concrete operations side of notch filling-in
Method is：SEQ ID NO are replaced with replacement oligo：2, then utilize ampligase and two kinds of enzymes of DNA ligase same
The notch of Shi Zuoyong filling-in 9bp, the replacement oligo nucleotides sequences are classified as pcTGTcTcTTA
TAcAcATcTccGAGccCAcGAGAcinvT。
The present invention carries out chromatin digestion first with transposase, obtains chromatin open zone DNA and mitochondrial DNA, then profit
It is sequenced with bisulfite, can directly carry out the research that methylates of chromatin open zone and mitochondria, simplify process, improve
Mitochondria methylates Efficiency.
Explanation is further explained to the specific implementation mode of the present invention below by embodiment, but does not indicate that and sends out this
Bright protection domain is limited in range described in embodiment.
The reagents such as 5 × LM buffer in embodiment are purchased to Tianjin Qiang Weite companies, other reagents used in embodiment,
Without special instruction, can be commercially available in market.Connector SEQ ID NO used in embodiment：1 and SEQ ID NO：
2 are synthesized by Sangon Biotech (Shanghai) Co., Ltd., and replacement oligo are synthesized by Integrated Device Technology, Inc. of the U.S..
Research that embodiment with the method for the present invention carries out chromatin open zone and mitochondrial DNA methylates
One, Transposon compounds are prepared
Concrete operation step is as follows：
1, connector 1 and 2 is dissolved respectively with TE buffer, sequence is respectively SEQ ID NO：1 and SEQ ID NO：2, to
10 μ l connectors, 1 (SEQ ID NO are separately added into 200 μ l PCR pipes：And 10 μ l connectors, 2 (SEQ ID NO 1)：2) (concentration is
100μM)。
2, it is incubated in PCR instrument, so that the single-stranded of complementation is combined into double-strand using temperature appropriate in buffer solution, obtain
To the connector for being annealed into double-strand, response procedures and condition are as shown in table 1 below：
The annealing incubation conditions of table 1
| Recurring number | Denaturation | Annealing | Gradient cooling is to 26 DEG C | It maintains |
| 1 | 95 DEG C, 3min | 70 DEG C, 3min | ||
| 2-46 | 70 DEG C, 30s | - 1 DEG C/cycle, 30s | ||
| 47 | It 25 DEG C, maintains |
3, the 4 μ l of connector for taking the annealing that step 2 obtains, add the H of nuclease free2O is diluted to 10 μM, is added isometric sweet
Oil takes out 10 μ l connectors and glycerol complexes, then adds 10 μ l Tn5 transposases, blows and beats 20 mixings repeatedly.
4, it is incubated at room temperature (20-30 DEG C, be placed on experimental bench) 30min, obtains Transposon compounds, -20 DEG C
It saves backup.
Two, cell is collected
1, it prepares single cell suspension or collects culture cell, cell count is carried out with tally or automated cell calculating instrument,
Required nutrient solution volume or single cell suspension volume are calculated according to cell number/ml.
2,5,00-200,000,500 × g, 4 DEG C centrifugation 5min of intact cell is collected.
It discards supernatant, cleans cell with the 50 μ l of PBS of precooling, 500 × g centrifuges 5min.
It discards supernatant, cell is resuspended with the lysate of 50 μ l precoolings, immediately 500 × g, 4 DEG C of centrifugation 10min.
Supernatant is abandoned, the cell precipitation after centrifugation is spare.
Three, it carries out digestion with Transposon compounds and DNA is purified
1, ensure that the cell precipitation after centrifugation is placed on ice always.
2, swivel base reaction system configures：
10 μ l reaction buffers (5 × LM buffer, Tianjin by force micro- spy)
2.5 μ l Transposon compounds
37.5μl nuclease-free H2O.
3, the cell precipitation after centrifugation is resuspended with the swivel base reaction system that the 2nd step configures.
4, Transposon compounds will be added in the cell precipitation after centrifugation, 30- is incubated in 37 DEG C of metal baths
40min, per 10min, gently mixing is primary, and the Tn5 transposases in Transposon compounds carry out digestion to chromatin, obtain
Chromatin
The DNA fragmentation and/or mitochondria DNA fragment in open zone.
5, after above-mentioned endonuclease reaction, purify dye with Qiagen MinElute PCR Purification Kit at once
Chromaticness open zone
DNA fragmentation and/or mitochondria DNA fragment.The concrete operations of purification process are carried out by kit specification.
6, by 10 μ l EB buffer solutions (MinElute of the DNA in chromatin open zone after purification and/or mitochondrial DNA
There is provided in Kit, including 10mM TrisCl, pH 8) elution.
7, by the DNA in the chromatin open zone of above-mentioned elution and/or mitochondrial DNA freeze to -20 DEG C it is spare.
Four, notch filling-in
When using Transposon compound digestions in above-mentioned steps, the notch of a 9bp can be left, is used
Replacement oligo (sequence such as SEQ ID NO：The 15bp complementary strand SEQ ID NO in Adaptor are replaced shown in 3：2,
Then the notch of filling-in 9bp).Specific operation process is as follows：
1, configuration enzyme reaction system (20 μ l systems)
Mixing is blown and beaten repeatedly with pipette tips.
2, the enzyme reaction system that step 1 configures is placed in PCR instrument, makes SEQ ID NO into line replacement reaction：2 from template
It is dissociated in DNA chain, replacement oligo and template DNA chain combination, i.e. connector are replaced：
Reaction condition is as shown in table 2 below：
2 conditions of replacement reaction of table
3, after the completion of reacting, the enzyme that notch filling-in needs is added into reaction mixture：
0.5 μ l of T4DNA polymerases
Ampligase 1.25μl
Mixing is blown and beaten repeatedly.
4, reaction system is again placed in PCR instrument and carries out notch filling-in, reaction condition is as shown in table 3 below：
3 notch filling-in condition of table
| Recurring number | Notch filling-in | It maintains |
| 1 | 37 DEG C, 30 minutes | It 4 DEG C, maintains |
5, it is purified after notch filling-in
Purified with Qiagen MinElute PCR Purification Kit, is operated by kit specification, with 10 μ l
EB buffer solutions or nuclease free H2O elutes the DNA fragmentation and/or mitochondria DNA fragment in chromatin open zone.
Five, bisulfite conversion (uses Zymo EZ DNA Methylation-DirectTMKit)
1, using the DNA fragmentation and/or mitochondria DNA fragment in the above-mentioned chromatin open zone afforded, 20 μ l dyes are taken
130 μ l CT conversion reagents (one of ingredient in kit) are added in the DNA fragmentation and/or mitochondria DNA fragment in chromaticness open zone.
If DNA volumes are mended with water to 20 μ l less than 20 μ l.
2, PCR pipe is placed in PCR instrument, carries out following reaction：
(1) 98 DEG C, 8 minutes (2) 64 DEG C, 3.5 hours (3) 4 DEG C holding
3,600 μ l M-binding buffer solutions (Kit components) are added into Zymo-Spin IC columns, and pillar is put
In the collecting pipe that kit offer is provided.
4, second step sample obtained by the reaction is sucked in the Zymo-Spin IC columns of the buffer solution containing M-binding, is covered
Pillar is turned upside down mixing several times by pipe lid.
5, with maximum centrifugal speed centrifuge 30 seconds (>10000x g), it discards and flows through liquid.
6,100 μ l M-wash buffer solutions are added into pillar, maximum centrifugal speed centrifuges 30 seconds.
7,200 μ l M-Desulphonation buffer solutions are added into pillar, at room temperature (20-30 DEG C) placement 15-
20min.After the completion of incubation, maximum centrifugal speed centrifuges 30 seconds.
8,200 μ l M-wash buffer solutions are added into pillar, maximum centrifugal speed centrifuges 30 seconds.Abandoned stream weighs again after wearing liquid
This multiple operation is primary.
9, pillar is put into new 1.5ml centrifuge tubes, 10 μ l M-Elution buffer solutions are added in base for post matter, it is maximum from
Heart speed centrifuges 30 seconds with eluted dna.
The DNA and/or mitochondrial DNA in the chromatin open zone obtained after bisulfite conversion can be immediately used to PCR
Amplification carries out analysis detection, can also freeze in -20 DEG C or -70 DEG C or lower temperature.
The amount that PCR reacts when amplification recommends the DNA of 1-4 μ l elutions, can also use 10 μ l DNA or bigger
The DNA of volume is as template, but small size elution can obtain the DNA of higher concentration, therefore, selects the elution of 1-4 μ l as possible
DNA as template.
Six, PCR amplification
PCR is carried out with the primer pair chromatin open zone DNA and/or mitochondrial DNA of the sequences of Adaptor containing Illumina
Amplification, primer sequence such as SEQ ID NO：4 and SEQ ID NO：Shown in 5.
PCR primer 1:
Tn5mCP1AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC(SEQ ID NO：4)
The PCR primer 2 of tape label:
Tn5mCBar CAAGCAGAAGACGGCATACGAGAT GGATGTTCT GTCTCGTGGGCTCGG(SEQ ID
NO：5)
1, following reaction system (25 μ l systems) is added into 0.2ml PCR pipes:
10μl converted DNA
0.75μl 10μM Tn5mCP1
0.75μl 10μM Tn5mC Bar
12.5μl Kapa 2G robust hot start ready mix(2×)
1μl nuclease-free H2O
PCR response procedures：
3 minutes 95 DEG C
12-15 recurring numbers:30 seconds 95 DEG C
30 seconds 62 DEG C
1 minute 72 DEG C of
1 minute 72 DEG C
Seven, PE Labchip detect library fragments size
It is operated according to PE labchip Standard Operating Procedure.Chromatin open zone DNA and/or mitochondria DNA fragment
In 200-2000bp, main peak is that 190bp or so and 380bp or so thinks that Library Quality is preferable.The library of quality inspection qualification according to
In bis- generations of Illumina, are sequenced conventional method progress qPCR and quantify, upper machine sequencing after mixing in proper proportions, to the data measured
Bioinformatic analysis is carried out, to obtain chromatin open zone DNA and/or mtdna sequence, and methylate point
Analysis, as a result as shown in Figure 1, 2.
Fig. 1 show the testing result of 1 chip analyzer of sample.As shown in Figure 1：Sample is by Tn5 digestions and weight sulfurous
After hydrochlorate conversion, PCR builds the library fragments that library obtains and is concentrated mainly on 180bp and 360bp, meets library sequencing and requires, explanation
Success in Experiment.
Fig. 2 show the testing result of 2 chip analyzer of sample.As shown in Figure 2：Sample 2 obtains the knot similar with sample 1
Fruit, library meet sequencing and require, and illustrate that experimental repeatability is fine.
Eight, qPCR carries out quantitative (being carried out using Kapa KK4923, specification is shown in operation) library
It is quantitative according to Qubit as a result, carrying out dilution appropriate, usually 1000 times, 2000 times and 10000 of dilution to sample
Again, 20000 times, the concentration in each library is then calculated by standard curve.
It is quantitative that qPCR is carried out to the sample after dilution.Suitable sample, which is drawn, according to quantitative result carries out upper machine sequencing.Ginseng
Kapa specifications are examined to be operated.
Nine, library is sequenced with Illumina Nextseq500
Multiple libraries with different bar codes are mixed into (usual 8-10), the data volume needed according to each sample
Library concentration corresponding with each sample takes appropriate sample to mix, and concrete operations refer to Illumina Nextseq500 library systems
Standby and upper machine sequencing procedures handbook.
Fig. 3 indicates that the chromosome open zone measured, the top indicate that No. 1 chromosomal section region, middle section indicate dye
Colour solid open zone, what bottom indicated is Gene Name.As shown in Figure 3：The present invention can successfully detect chromosome open zone, can
While progress mitochondria methylates research, to be studied from genome epigenetics level.
The present invention also by taking 1209 site of mitochondrial genomes as an example, is analyzed using the method for the present invention, the results showed that,
After bisulfite is sequenced, the C in the site about 3% remains as C, and 97% C is converted into T, it is believed that the C in the site about 3%
In the presence of the modification that methylates, i.e. methyl rate is 3%.The figure illustrates that our experimental method can be used successfully to mitochondria 5mC first
The detection in base site and its calculating of methylation level.The mitochondria methylation level that we detect and document report before
Unanimously, most of site methyl rate is less than 3%.
Sequence table
<110>Sichuan University
<120>Methylate to chromatin open zone and mitochondria using transposase the method for research
<130> A180018K
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 33
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
tcgtcggcag cgtcagatgt gtataagaga cag 33
<210> 2
<211> 15
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ctgtctctta tacac 15
<210> 3
<211> 35
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ctgtctctta tacacatctc cgagcccacg agact 35
<210> 4
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
aatgatacgg cgaccaccga gatctacact cgtcggcagc gtc 43
<210> 5
<211> 48
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
caagcagaag acggcatacg agatggatgt tctgtctcgt gggctcgg 48
Claims (7)
1. the method for the research that methylated to chromatin open zone and mitochondria using transposase, which is characterized in that including following step
Suddenly：
A, after cell cracking, digestion is carried out to chromatin using Transposon compounds, obtains the DNA pieces in chromatin open zone
Section and/or mitochondria DNA fragment；
B, the DNA fragmentation obtained to step a carries out notch filling-in, then carries out bisulfite conversion, then with containing
The DNA and/or mitochondria in the chromatin open zone obtained after the primer pair bisulfite conversion of IlluminaAdaptor sequences
DNA carries out PCR amplification, obtains the library being sequenced for Illumina, compares, obtain with reference gene group after Illumina is sequenced
To the cytimidine site for the modification that methylates, the i.e. sites 5mC.
2. the method for the research according to claim 1 that methylated to chromatin open zone and mitochondria using transposase,
It is characterized in that：Transposon compounds described in step a are that connector 1,2 is incubated with Tn5 transposases.
3. the method for the research according to claim 1 that methylated to chromatin open zone and mitochondria using transposase,
It is characterized in that：The preparation method of Transposon compounds described in step a is that nucleotides sequence is classified as SEQ ID NO：1
Shown in connector 1 and SEQ ID NO:After connector 2 shown in 2 dissolves, it is incubated in PCR instrument, obtains being annealed into double-strand
Connector adds Tn5 transposases, and incubation at room temperature obtains Transposon compounds.
4. the method for the research according to claim 1 that methylated to chromatin open zone and mitochondria using transposase,
It is characterized in that：The nucleotides sequence of the connector 1 is classified as in SEQ ID NO：The all modification C that methylate of C on the basis of shown in 1
Sequence, the nucleotides sequence of the connector 2 is classified as in SEQ ID NO：5 ' phosphorylation modification on the basis of 2,3 ' double deoxidation born of the same parents
The sequence obtained after thuja acid modification.
5. the method for the research according to claim 1 that methylated to chromatin open zone and mitochondria using transposase,
It is characterized in that：The concrete operation method of notch filling-in described in step b is：SEQ ID are replaced with replacement oligo
NO：2, then utilize two kinds of enzymes of ampligase heat-stable DNAs ligase and T4DNA polymerases to act on lacking for filling-in 9bp simultaneously
Mouthful.
6. the method for the research according to claim 1 that methylated to chromatin open zone and mitochondria using transposase,
It is characterized in that：The Replacement oligo nucleotides sequences are classified as in SEQ ID NO:It is repaiied through 5 ' phosphorylations on the basis of 3
Decorations, the deoxythymidylic acid of 3 ' inverse compositions and all C bases methylate sequence obtained from modification.
7. the method for the research according to claim 1 that methylated to chromatin open zone and mitochondria using transposase,
It is characterized in that：The SEQ ID NO：2 and SEQ ID NO：35 ' ends carry out phosphorylation modification, SEQ ID NO：1 and SEQ
ID NO：3 all C carry out the modification that methylates.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810040939.9A CN108300766A (en) | 2018-01-16 | 2018-01-16 | Methylate to chromatin open zone and mitochondria using transposase the method for research |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810040939.9A CN108300766A (en) | 2018-01-16 | 2018-01-16 | Methylate to chromatin open zone and mitochondria using transposase the method for research |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108300766A true CN108300766A (en) | 2018-07-20 |
Family
ID=62869152
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810040939.9A Pending CN108300766A (en) | 2018-01-16 | 2018-01-16 | Methylate to chromatin open zone and mitochondria using transposase the method for research |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108300766A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111154846A (en) * | 2020-01-13 | 2020-05-15 | 四川大学华西医院 | Detection method of methylated nucleic acid |
| CN112176041A (en) * | 2019-07-01 | 2021-01-05 | 深圳华大生命科学研究院 | Detection method, reagent and application of epigenetic modification |
| WO2021077415A1 (en) * | 2019-10-25 | 2021-04-29 | Peking University | Methylation detection and analysis of mammalian dna |
| CN113668068A (en) * | 2021-07-20 | 2021-11-19 | 广州滴纳生物科技有限公司 | Genome methylation library and preparation method and application thereof |
| CN117025753A (en) * | 2023-08-15 | 2023-11-10 | 广州女娲生命科技有限公司 | Method and device for detecting chromosomal variation |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102409408A (en) * | 2010-09-21 | 2012-04-11 | 深圳华大基因科技有限公司 | Method for accurate detection of whole genome methylation sites by utilizing trace genome DNA (deoxyribonucleic acid) |
| CN102796808A (en) * | 2011-05-23 | 2012-11-28 | 深圳华大基因科技有限公司 | Methylation high-flux detection method |
| CN103443338A (en) * | 2011-02-02 | 2013-12-11 | 华盛顿大学商业化中心 | Massively parallel continguity mapping |
| WO2016191618A1 (en) * | 2015-05-27 | 2016-12-01 | Jianbiao Zheng | Methods of inserting molecular barcodes |
-
2018
- 2018-01-16 CN CN201810040939.9A patent/CN108300766A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102409408A (en) * | 2010-09-21 | 2012-04-11 | 深圳华大基因科技有限公司 | Method for accurate detection of whole genome methylation sites by utilizing trace genome DNA (deoxyribonucleic acid) |
| CN103443338A (en) * | 2011-02-02 | 2013-12-11 | 华盛顿大学商业化中心 | Massively parallel continguity mapping |
| CN102796808A (en) * | 2011-05-23 | 2012-11-28 | 深圳华大基因科技有限公司 | Methylation high-flux detection method |
| WO2016191618A1 (en) * | 2015-05-27 | 2016-12-01 | Jianbiao Zheng | Methods of inserting molecular barcodes |
Non-Patent Citations (3)
| Title |
|---|
| ANDREW ADEY等: "Ultra-low-input, tagmentation-based whole-genome bisulfite sequencing", 《GENOME RESEARCH》 * |
| JASON BUENROSTRO等: "ATAC-seq: A Method for Assaying Chromatin Accessibility Genome-Wide", 《CURR PROTOC MOL BIOL》 * |
| SÉBASTIEN A SMALLWOOD等: "Single-Cell Genome-Wide Bisulfite Sequencing for Assessing Epigenetic Heterogeneity", 《NAT METHODS》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112176041A (en) * | 2019-07-01 | 2021-01-05 | 深圳华大生命科学研究院 | Detection method, reagent and application of epigenetic modification |
| WO2021077415A1 (en) * | 2019-10-25 | 2021-04-29 | Peking University | Methylation detection and analysis of mammalian dna |
| CN114391043A (en) * | 2019-10-25 | 2022-04-22 | 北京大学 | Methylation detection and analysis of mammalian DNA |
| CN114391043B (en) * | 2019-10-25 | 2024-03-15 | 昌平国家实验室 | Methylation detection and analysis of mammalian DNA |
| CN111154846A (en) * | 2020-01-13 | 2020-05-15 | 四川大学华西医院 | Detection method of methylated nucleic acid |
| CN113668068A (en) * | 2021-07-20 | 2021-11-19 | 广州滴纳生物科技有限公司 | Genome methylation library and preparation method and application thereof |
| CN113668068B (en) * | 2021-07-20 | 2024-07-19 | 广州滴纳生物科技有限公司 | Genome methylation library and preparation method and application thereof |
| CN117025753A (en) * | 2023-08-15 | 2023-11-10 | 广州女娲生命科技有限公司 | Method and device for detecting chromosomal variation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108300766A (en) | Methylate to chromatin open zone and mitochondria using transposase the method for research | |
| CN1896284B (en) | Method for identifying allelic gene type | |
| CN106591441B (en) | Alpha and/or beta-thalassemia mutation detection probe, method and chip based on whole gene capture sequencing and application | |
| CN110029178B (en) | SNP molecular marker related to single-fetus and multiple-lamb characters of sheep, detection primer group, detection kit and application thereof | |
| CN105803071B (en) | SNP marker relevant to melon powdery mildew resistance and its application | |
| CN102703595B (en) | STR (short tandem repeat) sequence high-throughput detection method with base selective controllable extension and detection reagent thereof | |
| CN106399478A (en) | Kit for rapidly detecting alpha/beta-thalassemia through fluorescent probe PCR method | |
| CN107619870B (en) | Molecular marker capable of indicating and identifying length of sheep wool and specific primer pair and application thereof | |
| CN113502335A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN113293204B (en) | Primer composition, kit and method for detecting microsatellite instability based on second-generation sequencing platform | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN108753952A (en) | A kind of gene parting detecting reagent for 10 common mutations sites of mankind SLC25A13 genes | |
| CN106086223B (en) | A kind of STR parting kit based on ZNA primer | |
| CN113166809A (en) | Method, kit, device and application for detecting DNA methylation | |
| CN109913575A (en) | A kind of KASP molecular labeling, kit and its application for identifying capsicum CMS fertility restorer gene | |
| CN112410441B (en) | Method for identifying character of bee colony for resisting saccular larva disease by utilizing SNP marker KZ288479.1_95621 | |
| CN112430675B (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN110964844B (en) | Primer, kit and method for qualitative determination of ginseng, poria cocos and bighead atractylodes rhizome powder | |
| CN108998539A (en) | Cabezon genome SNP marker method based on enzymes combinations Genotyping sequencing technologies | |
| CN105087804B (en) | For identifying primer sets, kit and the method for identifying Desmodium styracifolium type of Desmodium styracifolium type | |
| KR20230109925A (en) | SNP markers and primer sets for high-throughput identification of wheat cultivar and uses thereof | |
| CN111763668B (en) | Sequencing primer group and PCR-based whole genome sequencing method | |
| Graham et al. | DNA: an overview | |
| CN113957158B (en) | Primer probe composition for detecting mitochondrial gene of Acipenser schrenki, kit and application of primer probe composition | |
| CN113957159B (en) | Primer probe composition for detecting mitochondrial gene of sturgeon in Siberian, kit and application of primer probe composition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180720 |