CN105463105B - The method of the identification general bacterium in Beijing and its pairs of DNA molecular used - Google Patents
The method of the identification general bacterium in Beijing and its pairs of DNA molecular used Download PDFInfo
- Publication number
- CN105463105B CN105463105B CN201610005153.4A CN201610005153A CN105463105B CN 105463105 B CN105463105 B CN 105463105B CN 201610005153 A CN201610005153 A CN 201610005153A CN 105463105 B CN105463105 B CN 105463105B
- Authority
- CN
- China
- Prior art keywords
- beijing
- general bacterium
- bacterium
- general
- identification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the method for the identification general bacterium in Beijing and its pairs of DNA moleculars used.The method of the general bacterium in identification Beijing, including using the genomic DNA of biological sample to be measured as template, PCR amplification, which is carried out, with the general bacterium primer pair AZF-AZR in Beijing obtains PCR product, detect the size of the PCR product, if the PCR product contains the DNA fragmentation of 1000-1600bp, the biological sample to be measured is the general bacterium in Beijing or contains the general bacterium in Beijing；If the PCR product does not contain the DNA fragmentation of 1000-1600bp, the biological sample to be measured is not the general bacterium in Beijing or without containing the general bacterium in Beijing.The general bacterium primer pair AZF-AZR in Beijing has only amplified specific band in the genomic DNA of the general bacterium in Beijing, does not obtain amplified production in other bacterial strains, the general bacterium primer pair AZF-AZR in Beijing can be used for the general bacterium in Rapid identification Beijing.
Description
Technical field
The present invention relates to the method that the general bacterium in Beijing is identified in field of biotechnology and its pairs of DNA moleculars used.
Background technique
China's Pleurotus eryngii large-scale planting since last century the nineties.General Pseudomonas includes being used as plant growth-promoting bacteria, life
(Pantoea:insights into a highly versatile and diverse several kinds fungi-proofing or phytopathogen
genus within the Enterobacteriaceae,FEMS Microbiology Reviews (2015)39:968-
984).By general microbial Pleurotus eryngii bacterial soft rot be in recent years at home and abroad Pleurotus eryngii industrial production in occur it is tight
Grave illness evil, the pathogen for being reported in the Pleurotus eryngii soft rot of Beijing area are accredited and name as the general bacterium (Pantoea in Beijing
beijingensis sp.nov.,isolated from the fruiting body of Pleurotus eryngii.Liu
et al.Antonie van Leeuwenhoek(2013)104:1039–1047).Pleurotus eryngii bacterial soft rot is in production vehicle
Between once occur, be difficult to control, to Pleurotus eryngii industrial production cause serious loss.The general bacterium in Beijing is also Beijing area hair
Pathogenic bacteria (the First report of Pantoea beijingensis induced soft of raw Pleurotus nebrodensis soft rot
rot disease of Pleurotus nebrodensis in China.Xu et al.Plant Disease(2014)98
(7):1000).The exploitation of the general bacterium quick diagnosis technology in Beijing has effective prevention and control of Pleurotus eryngii soft rot and Pleurotus nebrodensis soft rot
It is significant.
Summary of the invention
The technical problem to be solved by the present invention is to how identify or assist the identification general bacterium (Pantoea in Beijing
beijingensis)。
In order to solve the above technical problems, the present invention provides the general bacterium specific PCR primers pair in Beijing.
The general bacterium specific PCR primers in Beijing provided by the present invention are to entitled AZF-AZR, by primer AZF and primer AZR group
At；The primer AZF is single strand dna shown in SEQ ID No.1；The primer AZR is single shown in SEQ ID No.2
Ssdna molecule.
The present invention also provides the identification including the general bacterium primer pair AZF-AZR in Beijing or assist the identification general bacterium in Beijing
Reagent or kit.
The reagent or kit of above-mentioned identification or the auxiliary identification general bacterium in Beijing further include needed for carrying out PCR reaction except primer
Outer other reagents.
The present invention also provides the preparation method of the general bacterium primer pair AZF-AZR in Beijing, identification or auxiliary identification Beijing
The reagent of general bacterium or the preparation method of kit.
The preparation method of the general bacterium primer pair AZF-AZR in Beijing provided by the present invention includes specifically drawing the general bacterium in Beijing
The step of object individually packs two single strand dnas of AZF-AZR.
The preparation method of the reagent or kit of identification provided by the present invention or the auxiliary identification general bacterium in Beijing, including will be northern
The step of two single strand dnas of the general bacterium primer pair AZF-AZR in capital are individually packed.
The present invention also provides DNA moleculars shown in SEQ ID No.3.
DNA molecular shown in SEQ ID No.3 is the specific DNA fragment of the general bacterium in Beijing.
The general bacterium primer pair AZF-AZR in Beijing is identifying or is assisting the application in the identification general bacterium in Beijing, identification or auxiliary
The reagent or kit for identifying the general bacterium in Beijing are being identified or are being assisted shown in application and SEQ ID No.3 in the identification general bacterium in Beijing
DNA molecular is being identified or is assisting to identify that the application in the general bacterium in Beijing also belongs to protection scope of the present invention.
Above-mentioned application does not include the diagnostic method and/or treatment method of disease.
The present invention also provides identification or the methods of the auxiliary identification general bacterium in Beijing.
The method of identification provided by the present invention or the auxiliary identification general bacterium in Beijing, including with the genome of biological sample to be measured
DNA is template, carries out PCR amplification with the general bacterium primer pair AZF-AZR in Beijing and obtains PCR product, detects the PCR product
Size, if the PCR product contain 1000-1600bp DNA fragmentation (or the PCR product be 1000-1600bp DNA
Segment), the biological sample to be measured is the general bacterium in Beijing or is Beijing containing the general bacterium in Beijing or the biological sample candidate to be measured
General bacterium or candidate contain the general bacterium in Beijing；If the PCR product without containing 1000-1600bp DNA fragmentation (or the PCR produce
Object is not the DNA fragmentation of 1000-1600bp), the biological sample to be measured is not the general bacterium in Beijing or does not contain the general bacterium in Beijing, or
The biological sample candidate to be measured is not the general bacterium in Beijing or candidate without containing the general bacterium in Beijing.
In the method for above-mentioned identification or the auxiliary identification general bacterium in Beijing, the DNA fragmentation of the 1000-1600bp is concretely
The DNA fragmentation of 1347bp.
It is demonstrated experimentally that the general bacterium primer pair AZF-AZR in Beijing has only amplified spy in the genomic DNA of the general bacterium in Beijing
Different band, does not obtain amplified production in other bacterial strains, and the general bacterium primer pair AZF-AZR in Beijing can be used for Rapid identification
The general bacterium in Beijing.The present invention is early prevention and the general microbial Pleurotus eryngii soft rot in cutting Beijing and the soft corruption of Pleurotus nebrodensis in time
The infection sources and route of transmission of disease provide technical support, it can be achieved that microbial Pleurotus eryngii soft rot general to Beijing and Pleurotus nebrodensis
Soft rot carries out early prevention and control.
Detailed description of the invention
Fig. 1 is agarose gel electrophoresis figure of the primer pair 16sp1-16sp2 to the pcr amplification product of general bacterium.Wherein, M:
1kb plus DNA ladder；The general bacterium in Beijing 1. (Pantoea beijingensis sp.nov.) JZB2120001T；
2.Pantoea gaviniae DSM22758；3.Pantoea eucalypti DSM23077；4.Pantoea anthophila
DSM23080；5.Pantoea agglomerans DSM30072；6Pantoea dispersa DSM30073；7.Pantoea
agglomerans JCM1236；8.Pantoea agglomerans JCM20143；9.Pantoea pleuroti
sp.nov.JZB2120015T。
Fig. 2 is the Ago-Gel of the pcr amplification product of the general bacterium of the general bacterium primer pair AZF-AZR specific detection in Beijing
Electrophoretogram.Wherein, M:1kb plus DNA ladder；1. the general bacterium in Beijing (Pantoea beijingensis sp.nov.)
JZB2120001T；2.Pantoea gaviniae DSM22758；3.Pantoea eucalypti DSM23077；
4.Pantoea anthophila DSM23080；5.Pantoea agglomerans DSM30072；6Pantoea
dispersa DSM30073；7.Pantoea agglomerans JCM1236；8.Pantoea agglomerans
JCM20143；9.Pantoea pleuroti sp.nov.JZB2120015T。
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
The general bacterium in Beijing (Pantoea beijingensis sp.nov.) JZB2120001 in following embodimentsT(i.e. LMG
27579TOr KCTC 32406T)(Pantoea beijingensis sp.nov.,isolated from the fruiting
body of Pleurotus eryngii.Liu et al.Antonie van Leeuwenhoek(2013)104:1039–
1047) public can be from Beijing City Academy Of Agriculture and Forest Sciences INST OF PLANT PROT & ENVIRONME or Belgium's BCCM/LMG culture presevation
The heart or South Korea's KCTC Culture Collection Center obtain the bacterial strain.
Pantoea pleuroti sp.nov.JZB2120015 in following embodimentsT(Pantoea pleuroti
sp.nov.,Isolated from the Fruiting Bodies of Pleurotus eryngii.Ma et
Al.Current Microbiology.19November 2015) public can be from Beijing City Agriculture and Forestry Institute plant protection environment
Protective strategy institute or Belgium's BCCM/LMG Culture Collection Center or China's CGMCC Culture Collection Center obtain the bacterial strain.
Pantoea gaviniae DSM22758, Pantoea eucalypti DSM23077 in following embodiments,
Pantoea anthophila DSM23080, Pantoea agglomerans DSM30072 and Pantoea dispersa
DSM 30073 is the bacterial strain of German DSM Culture Collection Center.
Pantoea agglomerans JCM1236 and Pantoea agglomerans in following embodiments
JCM20143 is the bacterial strain of Japan's JCM Culture Collection Center.
Embodiment 1 identifies the general bacterium in Beijing to AZF-AZR using PCR primer
1, the PCR reagent of the general bacterium in Beijing is identified
The PCR reagent of the identification general bacterium in Beijing of the present embodiment is by the general bacterium primer pair AZF-AZR in Beijing, 2 × Taq PCR
Mix (Bioeasy) and ddH2O composition.
Wherein, the general bacterium primer pair AZF-AZR in Beijing is made of AZF (upstream primer) and AZR (downstream primer), AZF
Nucleotide sequence be 5'GAGATAAAACCGTGAAAGGTGCTAAGTGGT 3'(SEQ ID No.1), the nucleotides sequence of AZR
Column are 5'TTTGTAAAATTAAAATTATGGCTACAGGCGG 3'(SEQ ID No.2).
2, the general bacterium in Beijing is identified
2.1, the DNA of bacterial strain is extracted
Strain (the general bacterium in Beijing (the Pantoea beijingensis sp.nov.) JZB2120001 saved from -80 DEG CT；
Pantoea gaviniae DSM22758；Pantoea eucalypti DSM23077；Pantoea anthophila
DSM23080；Pantoea agglomerans DSM30072；Pantoea dispersa DSM30073；Pantoea
agglomerans JCM1236；Pantoea agglomerans JCM20143 or Pantoea pleuroti
sp.nov.JZB2120015T) cross in solid LB media, 28 DEG C of culture 20h, with each bacterium bacterial strain list of oese picking
A bacterium colony is connected in the test tube equipped with LB culture medium (3mL), with 28 DEG C of shaken cultivation 18h of 200rpm.Each strains tested is used
DNeasy Blood&Tissue Kit (QIAGEN) extracts total DNA as pcr template, operates according to the specification of kit, tool
Steps are as follows for body:
1) 2ml inoculum is collected, 12000rpm is centrifuged 1min, removes supernatant.
2) 180 μ l Buffer ATL are added, 20 μ l Proteinase Ks, 4 μ l RNaseA, 56 DEG C are handled 1 hour.
3) 15s is vibrated, 200 μ l buffer AL are added and mix.
4) 200 μ l dehydrated alcohols are added, 8000rpm is centrifuged 3min.
5) supernatant is collected into centrifugal column, and 8000rpm is centrifuged 1min.
6) 500 μ l Buffer AW1,8000rpm are added in centrifugal column and are centrifuged 1min.
7) 500 μ l Buffer AW2,8000rpm are added in centrifugal column and are centrifuged 1min.
8) centrifugal column is put on a new 1.5ml centrifuge tube, 50 μ l Buffer AE is added, are placed at room temperature for 1min,
8000rpm is centrifuged 1min, and gained is the total DNA of bacterium.
2.2, PCR amplification
The total DNA of each bacterial strain extracted respectively using 2.1 utilizes the general bacterium primer pair AZF- in Beijing of step 1 as template
AZR carries out PCR.PCR reaction system (20 μ L): 10 μm of olL-1Each 1 μ L, 2 × Taq PCR Mix of upstream and downstream primer
(Bioeasy) 10 μ L, template DNA 1 μ L, ddH2O 7μL.PCR reaction condition: 95 DEG C, 5min；95 DEG C, 30s, 66 DEG C, 30s,
72 DEG C of 1min, 30 circulations；72 DEG C of extension 10min.The detection of 1% agarose gel electrophoresis.
The 16srDNA segment of each bacterial strain is expanded using primer pair 16sp1-16sp2PCR.Primer pair 16sp1-16sp2 by
16sp1 (5 ' AGAGTTTGATCCTGGCTCAGAACGAACGCT 3 ' of sequence) and 16sp2 (sequence 5 '
TACGGCTACCTTGTTACGACTTCACCCC 3 ') composition.PCR reaction system (20 μ L): 10 μm of olL-1Upstream and downstream draw
Object each 1 μ L, 2 × Taq PCR Mix (Bioeasy), 10 μ L, template DNA 1 μ L, ddH2O7μL.PCR reaction condition: 95 DEG C,
5min；95 DEG C, 30s, 55 DEG C, 30s, 72 DEG C of 2min, 30 circulations；72 DEG C of extension 10min.The detection of 1% agarose gel electrophoresis.
The result shows that primer pair 16sp1-16sp2 can amplify purpose band in 9 bacterial strains for examination, illustrate for examination
The DNA extraction effect of bacterial strain is good (Fig. 1).The general bacterium primer pair AZF-AZR in Beijing can only be with the general bacterium (Pantoea in Beijing
beijingensis sp.nov.)JZB2120001TGoing out size for template amplification is 1000-1600bp band, other 8 bacterial strains
The not 1000-1600bp band (Fig. 2).It recycles the general bacterium in Beijing (Pantoea beijingensis sp.nov.)
JZB2120001T1000-1600bp band, be sequenced, the results showed that the size of the 1000-1600bp band is
1347bp, sequence are SEQ ID No.3.Illustrate that the general bacterium primer pair AZF-AZR in Beijing is the special primer of the general bacterium in Beijing
It is right, it can be used for the general bacterium in Rapid identification Beijing.
Claims (7)
1. the general bacterium primer pair in Beijing, is made of primer AZF and primer AZR；The primer AZF is shown in SEQ ID No.1
Single strand dna；The primer AZR is single strand dna shown in SEQ ID No.2.
2. the reagent or kit of identification or the auxiliary identification general bacterium in Beijing, including the general bacterium in Beijing described in claim 1 are specifically drawn
Object pair.
3. the application in the identification general bacterium in Beijing is being identified or assisted to the general bacterium primer pair in Beijing described in claim 1.
4. the application in the identification general bacterium in Beijing is being identified or assisted to reagent as claimed in claim 2 or kit.
5. the method for identification or the auxiliary identification general bacterium in Beijing, including using right using the genomic DNA of biological sample to be measured as template
It is required that the general bacterium primer pair in Beijing described in 1, which carries out PCR amplification, obtains PCR product, the size of the PCR product is detected, such as
PCR product described in fruit contains the DNA fragmentation of 1000-1600bp, and the biological sample to be measured is general for the general bacterium in Beijing or containing Beijing
Bacterium or the biological sample candidate to be measured are that the general bacterium in Beijing or candidate contain the general bacterium in Beijing；If the PCR product does not contain
The DNA fragmentation of 1000-1600bp, the biological sample to be measured be not the general bacterium in Beijing or without containing the general bacterium in Beijing or it is described to
Surveying biological sample candidate is not the general bacterium in Beijing or candidate without containing the general bacterium in Beijing.
6. according to the method described in claim 5, it is characterized by: the DNA fragmentation of the 1000-1600bp is 1347bp's
DNA fragmentation.
7. a kind of DNA molecular, it is characterised in that: the DNA molecular is DNA molecular shown in SEQ ID No.3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610005153.4A CN105463105B (en) | 2016-01-04 | 2016-01-04 | The method of the identification general bacterium in Beijing and its pairs of DNA molecular used |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610005153.4A CN105463105B (en) | 2016-01-04 | 2016-01-04 | The method of the identification general bacterium in Beijing and its pairs of DNA molecular used |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105463105A CN105463105A (en) | 2016-04-06 |
| CN105463105B true CN105463105B (en) | 2019-03-08 |
Family
ID=55601258
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610005153.4A Active CN105463105B (en) | 2016-01-04 | 2016-01-04 | The method of the identification general bacterium in Beijing and its pairs of DNA molecular used |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105463105B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106967823B (en) * | 2017-05-10 | 2020-11-17 | 北京市农林科学院 | Method for identifying pathogenic bacteria of pleurotus eryngii wilt |
| CN107012242B (en) * | 2017-05-10 | 2020-08-18 | 北京市农林科学院 | Method for identifying Pantoea pleuroti by using primer pair K37FR |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894121A (en) * | 2015-06-10 | 2015-09-09 | 中国中医科学院中药研究所 | Primer pair used for identifying peucedanum praeruptorum and application thereof |
-
2016
- 2016-01-04 CN CN201610005153.4A patent/CN105463105B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894121A (en) * | 2015-06-10 | 2015-09-09 | 中国中医科学院中药研究所 | Primer pair used for identifying peucedanum praeruptorum and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Pantoea beijingensis sp nov., isolated from the fruiting body of Pleurotus eryngii;Yu Liu等;《Antonie van Leeuwenhoek》;20130907;第104卷(第6期);第1039-1047页 * |
| PMA结合实时荧光PCR进行玉米细菌性枯萎病菌细胞活性检测初步研究;冯建军等;《植物检疫》;20140430;第28卷(第2期);第27-32页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105463105A (en) | 2016-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Valera et al. | Acetic acid bacteria from biofilm of strawberry vinegar visualized by microscopy and detected by complementing culture-dependent and culture-independent techniques | |
| CN104263813A (en) | Sequences of primer for identifying fusarium solani and/or fusarium oxysporum, kit and method thereof | |
| CN109504799A (en) | A kind of the primer combination and method of Rapid identification sickle-like bacteria strain | |
| CN105463105B (en) | The method of the identification general bacterium in Beijing and its pairs of DNA molecular used | |
| Kuzmanović et al. | A novel group of Rhizobium tumorigenes-like agrobacteria associated with crown gall disease of rhododendron and blueberry | |
| CN105441543A (en) | Primers for identifying fusarium oxysporum watermelon forma specialis physiological races and application thereof | |
| CN105483260B (en) | The general bacterium primer pair in Beijing and its application | |
| CN105506117B (en) | The method for identifying the general bacterium in Beijing using primer pair AHF-AHR | |
| CN105463107B (en) | Identify the primer pair AWF-AWR of the general bacterium in Beijing | |
| CN105463103B (en) | The method for identifying the general bacterium in Beijing | |
| Kamono et al. | Rapid PCR-based method for detection and differentiation of Didymiaceae and Physaraceae (myxomycetes) in environmental samples | |
| CN105463106B (en) | Identify the method and its primer pair of the general bacterium in Beijing | |
| CN108531639B (en) | It is a kind of for detecting the specific primer and rapid detection method of Botryodiplodia theo-bromae | |
| CN104328205A (en) | Establishment of rapid detection method for grain sclerospora graminicola by LAMP | |
| Chebil et al. | Occurrence of Agrobacterium vitis carrying two opine-type plasmids in Tunisian vineyards | |
| CN108866219B (en) | Konjac soft rot germ specific sequence and detection primer and application thereof | |
| Hesham et al. | Use of PCR-denaturing gradient gel electrophoresis for the discrimination of Candida species isolated from natural habitats | |
| CN101838705A (en) | Method for detecting burkholderia cepacia flora on fruits or vegetables and identifying seeds | |
| KR101855955B1 (en) | Diagnosis Marker Composition for Rice Fusarium Head Blight caused by Fusarium graminearum species complex using disease development-specific genes and Kit comprising the same | |
| Magnuson et al. | Fungal diversity in soils as assessed by direct culture and molecular techniques | |
| CN107012242B (en) | Method for identifying Pantoea pleuroti by using primer pair K37FR | |
| CN106967823B (en) | Method for identifying pathogenic bacteria of pleurotus eryngii wilt | |
| KR101413121B1 (en) | Method for detecting Acidovorax citrulli | |
| Thapa et al. | Direct detection of Brenneria rubrifaciens by polymerase chain reaction (PCR-based assay) using rubrifacine synthetic gene | |
| KR101413123B1 (en) | Primer set for detecting Xanthomonas oryzae pv. oryzicola and method for detecting using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |