CN105463092B - The system for detecting miR-30c-5p expression quantity is predicting aspirin to the application in cardiovascular patient curative effect - Google Patents
The system for detecting miR-30c-5p expression quantity is predicting aspirin to the application in cardiovascular patient curative effect Download PDFInfo
- Publication number
- CN105463092B CN105463092B CN201510989205.1A CN201510989205A CN105463092B CN 105463092 B CN105463092 B CN 105463092B CN 201510989205 A CN201510989205 A CN 201510989205A CN 105463092 B CN105463092 B CN 105463092B
- Authority
- CN
- China
- Prior art keywords
- mir
- aspirin
- expression quantity
- patient
- cardiovascular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention discloses the system of detection miR-30c-5p expression quantity in prediction aspirin to the application in cardiovascular patient curative effect.It is control with non-blood platelet high response patient in the present invention, ROC curve analysis, area under the curve 0.720, sensitivity 54.84%, specificity 82.25% is carried out to the miR-30c-5p of blood platelet high response patient.Show that the expression quantity of miR-30c-5p in the venous blood of test object can be used for judging the aspirin clinical efficacy of cardiovascular patient.
Description
Technical field
The present invention relates to the systems that miR-30c-5p expression quantity is detected in field of biotechnology to predict aspirin to the heart
Application in vascular disease's curative effect.
Background technique
Aspirin (ASA) is the common antiplatelet drug of patients with coronary heart disease secondary prevention, and a large amount of randomized double-blinds are clinical
Research confirms that aspirin can substantially reduce the bad thing such as malignant arrhythmia, non-fatal myocardial infarction, sudden cardiac death
The generation of part is American Society of Cardiology (ACC) and one of the standard care drug that American Heart Association's (AHA) guide is recommended.
Aspirin on inhibition of platelet aggregation acts in crowd that there are larger individual difference and unpredictabilities have been ground by many clinics
Studying carefully is confirmed, some patientss, clinically still cannot effective prevention of arterial congee although taking the aspirin of routine dose for a long time
Sample hardens Cardioversion, this phenomenon is known as blood platelet high response under aspirin hypoergia or aspirin for treatment
(High on Aspirin Platelet Response, HAPR), i.e. the curative effect of aspirin is bad.
The reactive influence factor of aspirin for treatment includes phase interaction between environmental factor, compliance, drug dose, drug
With and genetic factors etc..The existing method for assessing therapeutic effect of aspirin specifically includes that light turbidimetry detects arachidonic
The detection of TXA2 metabolite level, VerifyNow detect platelet aggregation in the platelet aggregation rate of acid induction, serum and urine
Rate, PFA-100, thrombelastogram etc., but consistency is poor between different detection methods, and for aspirin to angiocarpy
Disease clinical efficacy and the predictive value of clinical cardiovascular events risk are insufficient.
Summary of the invention
The technical problem to be solved by the present invention is to how predict aspirin to cardiovascular patient clinical efficacy.
In order to solve the above technical problems, present invention firstly provides following B1) or purposes B2):
B1 the system for) detecting miR-30c-5p expression quantity predicts aspirin to cardiovascular disease in preparation prediction or auxiliary
Application in patient's curative effect product；
B2 the system for) detecting miR-30c-5p expression quantity is being predicted or is assisting to predict aspirin to cardiovascular patient
Application in curative effect.
In such use, the system of the detection miR-30c-5p expression quantity can be to utilize quantitative PCR detection miR-30c-
The system of 5p expression quantity.
In such use, the system of the detection miR-30c-5p expression quantity may include detection miR-30c-5p expression quantity
Reagent and/or kit and/or instrument, as passed through reagent, reagent needed for quantitative PCR reaction detection miR-30c-5p expression quantity
Box and instrument.Specifically, detect miR-30c-5p expression quantity system can for detection miR-30c-5p expression quantity primer and
Other reagents and/or instrument required for quantitative PCR reacts are carried out, also can be only the primer of detection miR-30c-5p expression quantity.
The primer of the detection miR-30c-5p expression quantity can be classified as the primer of sequence 1 for nucleotides sequence.
In the system of the detection miR-30c-5p expression quantity, carrying out other reagents required for quantitative PCR reacts can be
The article No. of Beijing Quanshijin Biotechnology Co., Ltd is seminal plasma fructose detection kit (such as TransScript Green of AQ202-01
miRNA Two-Step qRT-PCR SuperMix(TransScript Green miRNA Two-Step qRT-PCR
Contain the single stranded DNA that can be matched with single stranded DNA shown in sequence 1 using progress PCR amplification in SuperMix)) and/or
MicroRNA data processing system.The microRNA data processing system, which can be used for calculating, to be controlled from aspirin to be predicted
The expression quantity of the miR-30c-5p of the cardiovascular patient for the treatment of predicts aspirin according to the expression quantity of the miR-30c-5p
Treat the curative effect to the cardiovascular patient to be predicted.
In such use, the miR-30c-5p expression quantity is the expression quantity of miR-30c-5p in peripheral blood.
In such use, the miR-30c-5p expression quantity is relative expression quantity of the miR-30c-5p relative to U6.
In order to solve the above technical problems, the present invention also provides the prediction using miR-30c-5p as marker or assisting pre-
It surveys aspirin and predicts or assist prediction aspirin to cardiovascular disease in preparation the system of cardiovascular patient curative effect
Application in patient's curative effect product.
In above-mentioned application, the prediction or auxiliary prediction aspirin can be institute to the system of cardiovascular patient curative effect
The system for stating detection miR-30c-5p expression quantity.
In order to solve the above technical problems, the present invention also provides predictions or auxiliary prediction aspirin to suffer to cardiovascular disease
The product of person's curative effect.
Prediction provided by the present invention or auxiliary prediction aspirin are described to the product of cardiovascular patient curative effect
The system for detecting miR-30c-5p expression quantity.
In order to solve the above technical problems, the present invention also provides prediction aspirin to the side of cardiovascular patient curative effect
Method.
Prediction aspirin provided by the present invention is to the method for cardiovascular patient curative effect, comprising: detection to
Predict the miR-30c-5p expression quantity of cardiovascular patient；If miR-30c- in the venous blood of the cardiovascular patient
The expression quantity of 5p is higher, and the cardiovascular patient is or candidate is blood platelet high response (HAPR) under aspirin for treatment
The risk of patient is bigger, if the expression quantity of miR-30c-5p is lower in the venous blood of test object, the cardiovascular disease is suffered from
Person be or candidate be blood platelet high response (HAPR) patient under aspirin for treatment risk it is smaller.
The above method can be carried out using the system.
In the present invention, the cardiovascular patient can be the trouble with following at least one risk factors of cardiovascular diseases
Person: with stable angina pectoris, acute coronary syndrome, percutaneous coronary intervention (pci) operation, coronary artery bypass surgery
And ischemic cerebral vascular.
In the present invention, when using the patient of cardiovascular high-risk patient inclusion criteria as test object, if test object
Venous blood in the relative expression quantity relative to U6 of miR-30c-5p in the range (- 15.23~21.67) and be No-HAPR
3-5 times or more of cardiovascular high-risk patient, the test object are blood platelet high response (HAPR) patient under aspirin for treatment,
If the relative expression quantity relative to U6 of miR-30c-5p is less than the cardiovascular high-risk trouble of No-HAPR in the venous blood of test object
3-5 times of person, the test object are blood platelet high response (No-HAPR) patient under non-aspirin for treatment.
It is demonstrated experimentally that being control with non-blood platelet high response (No-HAPR) patient, to 4 of patient in HPR group
MicroRNA (miR-30c-5p, miR-16-2-3p, miR-98-5p and miR-3158-5p) carries out ROC curve analysis.miR-
The area under the curve of 30c-5p is 0.720, sensitivity 54.84%, specificity 82.25%, below miR-3158-5p curve
Product is 0.726, sensitivity 83.87%, specificity 51.52%, the area under the curve of miR-30c-5p and miR-3158-5p
Between 0.7-0.9, it can be used for the judgement to aspirin clinical efficacy, the two microRNA are to aspirin clinical efficacy
Diagnosis have diagnostic value.Show that the expression quantity of miR-30c-5p in the venous blood of test object can be used for judging angiocarpy
The aspirin clinical efficacy of Disease.
Detailed description of the invention
Fig. 1 is miR-30c-5p to the ROC curve of aspirin evaluation of clinical curative effect, specificity and susceptibility.It is given in figure
Oblique straight line be reference line, specific to indicate: when area under the curve is equal to 50%, the therapeutic effect of aspirin that can diagnose half is poor
Patient.Wherein, Sensitivity indicates that susceptibility, Specificity indicate specificity.
Fig. 2 is miR-3158-5p to the ROC curve of aspirin evaluation of clinical curative effect, specificity and susceptibility.It is given in figure
Oblique straight line be reference line, specific to indicate: when area under the curve is equal to 50%, the therapeutic effect of aspirin that can diagnose half is poor
Patient.Wherein, Sensitivity indicates that susceptibility, Specificity indicate specificity.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
TransScript Green miRNA Two-Step qRT-PCR SuperMix in following embodiments is Beijing
Quan Shijin Bioisystech Co., Ltd product.
Embodiment 1, for predicting determination of the aspirin to Patients with Cardiovascular/Cerebrovascular Diseases
Cardiovascular high-risk patient 350, inclusion criteria is as follows: age >=50 year old；With following at least one cardiovascular disease
The patient of sick risk factor: stable angina pectoris, acute coronary syndrome (ACS), percutaneous coronary intervention (pci) are suffered from
(PCI) operation, coronary bypass (CABG) operation and ischemic cerebral vascular.This 350 cardiovascular high-risk patients are in basis
Exclusion criteria excludes the PATIENT POPULATION obtained after a part of patient, and exclusion criteria is with a kind of following situations: platelet count
Less than 100 × 109/L；Disease in the blood system；Using GP IIb/IIIa antagonist, warfarin or non-steroid anti-inflammatory drug；Seriously
Hepatic and kidney function obstacle；There is aspirin to use contraindication.
Collect selected patient clinical data: demographic data, cardiovascular disease condition, enters risk factors of cardiovascular diseases
Merge disease and drug combination situation, the indexs such as blood routine, hepatic and renal function, blood lipid, serum hs-CRP, immune when selecting.
The blood platelet of arachidonic acid (Arachidonic Acid, the AA) induction of selected patient is had detected using optics turbidimetry simultaneously
Aggregation rate.This research passes through the approval of Ethics Committee, Peking University First Hospital, and full-fledged research object is signed before experiment
Affix one's name to informed consent form.
The research object clinical data being selected in is all made of 17.0 software of SPSS and is analyzed.Measurement data usesTable
Show, two comparison among groups are examined using t；Enumeration data indicates that the comparison between two groups uses the chi-square criterion of four fold table, respectively with percentage
Factor and blood platelet high response strength of association odds ratio (OR) value and 95% credibility interval (95%CI) are indicated.logistic
Regression analysis corrects the predisposing factors such as age, gender, body mass index, smoking, hypertension, is that difference has statistics with bilateral P < 0.05
Learn meaning.
1, platelet aggregation rate detects
Selected detection in peripheral blood of patients underwent 3mL is acquired, is the arachidonic acid (arachidonic of 0.5mg/mL with concentration
Acid, AA) be used as inducer, with optics turbidimetry for Determination platelet aggregation rate (platelet agglutination ratio,
PA).Blood platelet high response (High on aspirin platelet reactivity, HAPR) is defined as selected patient's
The PA dividing value of the total selected patient in value >=3/4 PA, this research PA dividing value is 15.22%, accordingly by selected patient be divided into HAPR group with
Non- blood platelet high response group (No-High on aspirin platelet reactivity, No-HAPR) group.
2, the measurement of PA
Platelet aggregation rate is measured using PACK-4 multichannel platelet aggregation instrument (Helena, the U.S.).It is taken into and selects patient
Peripheral blood sample, in 37 DEG C, 800r/min be centrifuged 10min, draw upper layer platelet rich plasma (platelet-rich
Plasma, PRP), obtain the blood specimen for drawing PRP.The blood specimen of PRP will be drawn, on 4000r/min centrifugation 10min, absorption
It is spare that layer no platelet plasma is prepared as platelet-poor plasma (platelet-poor plasma, PPP).The blood of PRP will be drawn
Platelet count in sample is adjusted to (300-400) × 109/ L is placed in colorimetric cylinder, and the flower that concentration is 0.5mg/mL is added
The inducer of raw tetraenoic acid (arachidonic acid, AA) is measured.
3, cardiovascular event definition and follow-up
The definition of cardiovascular event: following at least one symptoms occur in the case where Aspirin: shakiness centering twists
Bitterly, acute coronary syndrome, non-lethality cerebral apoplexy, in-stent restenosis, dead and visualisation show former Coronary Artery Lesions
Progress.All selected patients after discharge 3 months, 6 months and 12 are monthly to carry out follow-up in outpatient service, determines that painstaking effort are run affairs
Part.
Coronary Artery Lesions progress is defined as at least meeting with the next item down: >=50% stenotic lesion blood vessel number or segment number are earlier above
Increase；Original narrow >=30% lesion vessels check CAG again and prompt stenosis amplification > 20%；Script row CAG inspection mentions
Show without narrow blood vessel, checks CAG and prompt its stenosis >=30%.
According to the clinical data of above-mentioned selected patient, the postoperative regular Aspirin of wherein 40 coronary artery brackets is chosen
Selected patient is for carrying out sequencing research.Remaining 310 patient is for the quantitative PCR checking research after microRNA screening.Enter
The clinical data of patient is selected to be shown in Table 1.
Table 1, the clinical data for being selected in patient
Embodiment 2, for predicting screening of the aspirin to the gene marker of Patients with Cardiovascular/Cerebrovascular Diseases clinical efficacy
It is postoperative that 20 coronary artery brackets are picked out in the selected patient of the postoperative regular Aspirin of 40 coronary artery brackets
The typical patient of cardiovascular event still occurs using the aspirin Antiplatelet therapy of 100mg/d for rule, is named as painstaking effort
Pipe event group；The postoperative rule of 20 matching coronary artery brackets is not sent out using the aspirin Antiplatelet therapy of 100mg/d
The selected patient of raw cardiovascular event, is named as control group.The selected patient of cardiovascular event group and control group is at age, property
Not, body mass index, smoking, hypertension, hyperlipidemia, the past myocardial infarction are without apparent statistical difference (P > 0.05)；?
Laboratory checks and essential drugs treatment etc. also no difference of science of statistics (P > 0.05).
Using 7500 system of quantitative PCR analysis instrument to 10 microRNA (table 2) in cardiovascular event group and control group
Quantitative analysis is carried out, the relative expression quantity relative to U6 of this 10 microRNA in whole blood is obtained.
10 microRNA sequences are as shown in table 2 below, and dye method quantification PCR primer sequence is as shown in table 3 below.
Table 2, microRNA sequence
The quantification PCR primer sequence of table 3, microRNA
MicroRNA extract specific steps are as follows:
1. taking out the anticoagulation and blood plasma of -80 DEG C of cryogenic freezings, 200 μ l blood and 100 μ are taken after dissolving on ice respectively rapidly
L blood plasma, is separately added into 1ml LB10, and oscillation mixes.
2. being stored at room temperature 5min.
3. every add 0.2ml chloroform or 50 μ l 4-Bromoanisole using 1ml LB10, acutely oscillation 30 seconds, room temperature is incubated
Educate 3min.
4. 4 DEG C, 10,000 × g centrifugation 15min (in order to avoid detection leads to DNA pollution in milling cutter, can suitably leave
A part of water phase).
5. shifting colourless water phase in new centrifuge tube, the dehydrated alcohol of 1/3 transfer liquid product is added, gently overturns mixed
It is even, at this time it is possible that precipitating.
6. obtained solution and precipitating are added in RNA Spin Column together, 12,000 × g, 4 DEG C of centrifugation 30s are protected
Stay efflux.
7. measuring effluent volume, it is transferred in clean 1.5ml or 2ml RNase-free centrifuge tube, is added 1.25 times
The dehydrated alcohol (at this time it is possible that precipitating) of effluent volume is gently mixed by inversion.
8. obtained solution and precipitating are added in miRNA Spin Column together, 12,000 × g, 4 DEG C of centrifugation 30s,
Abandon efflux.
9. 500 μ l WB10 (please first check whether before use and dehydrated alcohol is added), 4 DEG C of 12,000 × g centrifugations are added
30s abandons efflux.
10. it is primary to repeat step 9.
11. 12,000 × g, 4 DEG C of centrifugation 2min, completely remove remaining ethyl alcohol, thoroughly dry being stored at room temperature several minutes
miRNA Spin Column。
12. miRNA Spin Column is put into 1.5ml RNase-free Tube, add 30 μ l RNase-free
Water is stored at room temperature 1min in the center of centrifugal column.
13. 12,000 × g, 4 DEG C of centrifugation 2min elute miRNA.
14. RNA is placed in -80 DEG C of preservations.
The preparation of cDNA template: TransScript Green miRNA Two-Step qRT-PCR SuperMix is used
(AQ202) cDNA template is prepared, reaction system and reaction system are as follows:
| Agent/composition | Volume |
| Total RNA | 4μl |
| 2×TS miRNA Reaction Mix | 10μl |
| TransSctipt miRNA RT Enzyme Mix | 1μl |
| RNase-free Water to final volume | 20μl |
Reaction condition: 37 DEG C of incubations 1h, 85 DEG C of heating 5s inactivate RT enzyme.
QPCR quantitative experiment: each sample is arranged 3 technologies and repeats, and each pair of primer setting NTC is control (i.e. without template
Control), the primer of internal reference U6, internal reference are U6-F:GCTTCGGCAGCACATATACTAAAAT and U6-R:
CGCTTCACGAATTTGCGTGTCAT, the reaction system and condition of internal reference are as follows:
Reaction condition:
The reaction system of microRNA are as follows: the system of 20 μ l, specially 1 μ l, 2 × TransStart Top of cDNA template
10 μ l of Green qPCR SuperMix quantitative reagent, preceding primer (preceding primer sequence is corresponding microRNA primer sequence in table 3)
0.4 μ l, rear primer 0.4 μ l, ddH2O 8.2μl.Wherein, 2 × TransStart Top Green qPCR SuperMix is quantitative
Reagent and rear primer be the article No. of Beijing Quanshijin Biotechnology Co., Ltd be AQ202-01 kit (wherein after primer exist
In 2 × TransStart Top Green qPCR SuperMix quantitative reagent) in reagent.Reaction condition are as follows: 95 DEG C of 30s；
95 DEG C of 5s, 58 DEG C of 15s, 72 DEG C of 10s), 30 circulations.
Such as the ratio of expression quantity of the microRNA in cardiovascular event group and expression quantity of the microRNA in control group
Value is greater than 1, microRNA cardiovascular event group expression up-regulation；Such as expression quantity of the microRNA in cardiovascular event group and this
The ratio of expression quantity of the microRNA in control group less than 1, lower by microRNA cardiovascular event group expression；Such as
The ratio of expression quantity of the microRNA in cardiovascular event group and expression quantity of the microRNA in control group is equal to 1, should
MicroRNA cardiovascular event group expresses indifference.Quantitative PCR verification result shows in cardiovascular event group and control group table 4
4 microRNA (miR-30c-5p, miR-16-2-3p, miR-98-5p and miR-3158-5p) expression quantity are variant, other
The expression quantity of microRNA is not significantly different.
When 1 times or more in the expression quantity that the expression quantity of cardiovascular event group is control group of microRNA, show this
MicroRNA is risk profile microRNA, can be used as the biological indicator of evaluation therapeutic effect of aspirin.
The sequencing genescreen result of table 4, cardiovascular event group and control group
Note: in table 4, UP indicates the expression up-regulation of cardiovascular event group, and DOWN indicates that the expression of cardiovascular event group is lowered；
Each numerical value indicates microRNA expression variation times between two generation sequencing result screening cardiovascular event groups and control group in " FOLD " column
Number.
Embodiment 3, for predicting aspirin to the microRNA marker of Patients with Cardiovascular/Cerebrovascular Diseases clinical efficacy
Verifying
It is fixed to 310 fluorescence for after microRNA screening according to the platelet aggregation rate detection method in embodiment 1
The selected patient of amount PCR checking research is grouped, wherein HAPR group totally 74 patients, No-HAPR group totally 236 patients.
Whole blood is carried out to 310 selected patients for the quantitative fluorescent PCR checking research after microRNA screening
MicroRNA is extracted, and extracted whole blood microRNA is carried out reverse transcription, is placed in -20 DEG C of preservations；It is glimmering using SYBR Green
Fluorescent Quantitative PCR method expands 10 microRNA in table 2, this 10 in quantitative analysis HAPR group and No-HAPR group
The relative expression quantity (table 5) relative to U6 of microRNA, method assess this 10 microRNA and Ah Si with embodiment 2
The correlation of woods clinical efficacy.
Relative expression quantity of 5,10 microRNA of table in HRP with two groups of No-HPR
With 16.0 software of SPSS using No-HAPR group as control, by 4 discrepant microRNA of expression of two groups of patients
(miR-30c-5p, miR-16-2-3p, miR-98-5p and miR-3158-5p) and cardiovascular event cause danger factor progress
COX regression analysis (table 6).COX regression result shows miR-30c-5p, miR-3158-5p and smoking factor and patients with coronary heart disease
The significant correlation of cardiovascular event occurrence risk still occurs for regular Aspirin.
Table 6, COX regression analysis cardiovascular event are caused danger factor and microRNA occurrence risk
ROC curve analyzes miR-30c-5p for the evaluation reactive predictive value of Ah Si (Fig. 1), miR-30c-5p
Area under the curve be 0.720, the area under the curve of sensitivity 54.84%, specificity 82.25%, miR-30c-5p exists
Between 0.7-0.9, there is diagnostic value to the evaluation of aspirin clinical efficacy.ROC curve analyzes miR-3158-5p for commenting
The reactive predictive value of valence Ah Si (Fig. 2), the area under the curve of miR-3158-5p are 0.726, sensitivity 83.87%,
Evaluation of the area under the curve that specificity is 51.52%, miR-3158-5p between 0.7-0.9, to aspirin clinical efficacy
There is diagnostic value.The area under the curve that the area under the curve of miR-16-2-3p is 0.668, miR-98-5p is 0.596, miR-
The area under the curve of 16-2-3p and miR-98-5p < 0.7, shows that the two microRNA examine aspirin clinical efficacy
Disconnected value is lower.
It is determined as blood platelet high response (HAPR) patient miR- according to the relative expression quantity of two groups of patient miR-30c-5p
30c-5p relative expression quantity Ct value (range -15.23~21.67) is non-blood platelet high response (No-HAPR) patient with respect to table
Up to 3-5 times (being 5.613 times in the present invention) of amount Ct value (range -13.89~19.28).Specifically, when to meet embodiment 1
In cardiovascular high-risk patient inclusion criteria patient as test object when, according to the above results, obtain testing result judgement
Standard is as follows: when using the patient that meets the cardiovascular high-risk patient inclusion criteria in embodiment 1 as test object, if inspection
The relative expression quantity of miR-30c-5p in range (- 15.23~21.67) and is No-HAPR painstaking effort in the venous blood of survey object
More than 3-5 times (being 5.613 times in the present invention) of pipe high-risk patient, which is that blood platelet is high anti-under aspirin for treatment
Answering property (HAPR) patient, if the relative expression quantity of miR-30c-5p is less than No-HAPR angiocarpy in the venous blood of test object
3-5 times (being 5.613 times in the present invention) of high-risk patient, which is blood platelet high response under non-aspirin for treatment
(No-HAPR) patient.
It is determined as blood platelet high response (HAPR) patient miR- according to the relative expression quantity of two groups of patient miR-3158-5p
3158-5p relative expression quantity Ct value (range -16.46~26.93) is non-blood platelet high response (No-HAPR) patient with respect to table
Up to 0.3-0.047 times (being 0.047 times in the present invention) of amount Ct value (range -19.14~29.42).Specifically, when real to meet
When applying the patient of the cardiovascular high-risk patient inclusion criteria in example 1 as test object, according to the above results, testing result is obtained
Criterion is as follows: when using the patient that meets the cardiovascular high-risk patient inclusion criteria in embodiment 1 as test object, such as
The relative expression quantity of miR-3158-5p is in range (- 16.46~26.93) and less than No- in the venous blood of fruit test object
0.3-0.047 times (being 0.047 times in the present invention) of HAPR angiocarpy high-risk patient, which is under aspirin for treatment
Blood platelet high response (HAPR) patient, if the relative expression quantity of miR-3158-5p is No- in the venous blood of test object
More than 0.3-0.047 times (being 0.047 times in the present invention) of HAPR angiocarpy high-risk patient, which is non-aspirin
Treat lower blood platelet high response (No-HAPR) patient.
Cardiovascular event group and control group are compared discovery miR-30c-5p and miR-3158-5p by this research may make up Ah Si
The diagnostic system of woods clinical efficacy, while to can be used as biological markers anti-for assessing aspirin by the two microRNA
Ying Xing.
Claims (8)
1. the system for detecting miR-30c-5p expression quantity predicts aspirin to cardiovascular patient in preparation prediction or auxiliary
Application in curative effect product.
2. application according to claim 1, it is characterised in that: the system of the detection miR-30c-5p expression quantity is to utilize
The system of quantitative PCR detection miR-30c-5p expression quantity.
3. application according to claim 1, it is characterised in that: the system of the detection miR-30c-5p expression quantity includes core
Nucleotide sequence is the primer of sequence 1.
4. application according to claim 1 to 3, it is characterised in that: the miR-30c-5p expression quantity is peripheral blood
The expression quantity of middle miR-30c-5p.
5. application according to claim 1 to 3, it is characterised in that: the system comprises microRNA data processings
System, the microRNA data processing system is for calculating the cardiovascular patient from aspirin for treatment to be predicted
MiR-30c-5p expression quantity, according to the expression quantity of the miR-30c-5p predict aspirin for treatment to the heart to be predicted
The curative effect of vascular disease.
6. application according to claim 1 to 3, it is characterised in that: the cardiovascular patient is with following
The patient of at least one risk factors of cardiovascular diseases: stable angina pectoris, acute coronary syndrome, percutaneous coronary are suffered from
Interventional therapy operation, coronary artery bypass surgery and ischemic cerebrovascular disease.
7. being to cardiovascular patient curative effect using miR-30c-5p as the prediction of marker or auxiliary prediction aspirin
System is in preparation prediction or auxiliary prediction aspirin to the application in cardiovascular patient curative effect product.
8. application according to claim 7, it is characterised in that: the cardiovascular patient is with following at least one
The patient of risk factors of cardiovascular diseases: stable angina pectoris, acute coronary syndrome, percutaneous coronary intervention (pci) are suffered from
Operation, coronary artery bypass surgery and ischemic cerebrovascular disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510989205.1A CN105463092B (en) | 2015-12-24 | 2015-12-24 | The system for detecting miR-30c-5p expression quantity is predicting aspirin to the application in cardiovascular patient curative effect |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510989205.1A CN105463092B (en) | 2015-12-24 | 2015-12-24 | The system for detecting miR-30c-5p expression quantity is predicting aspirin to the application in cardiovascular patient curative effect |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105463092A CN105463092A (en) | 2016-04-06 |
| CN105463092B true CN105463092B (en) | 2019-03-05 |
Family
ID=55601245
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510989205.1A Active CN105463092B (en) | 2015-12-24 | 2015-12-24 | The system for detecting miR-30c-5p expression quantity is predicting aspirin to the application in cardiovascular patient curative effect |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105463092B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110951870A (en) * | 2020-01-03 | 2020-04-03 | 中国人民解放军总医院 | Application of miRNA expression quantity in predicting therapeutic effect of clopidogrel |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104975112A (en) * | 2015-07-08 | 2015-10-14 | 深圳国际旅行卫生保健中心 | Detection method based on throat swab sample for influenza virus and detection kit for influenza virus |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140303025A1 (en) * | 2013-03-15 | 2014-10-09 | The Translational Genomics Research Institute | Methods for the diagnosis and prognosis of neurodegenerative diseases |
-
2015
- 2015-12-24 CN CN201510989205.1A patent/CN105463092B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104975112A (en) * | 2015-07-08 | 2015-10-14 | 深圳国际旅行卫生保健中心 | Detection method based on throat swab sample for influenza virus and detection kit for influenza virus |
Non-Patent Citations (4)
| Title |
|---|
| miR-30c-5p, miR-223-3p, miR-302c-3p and miR-17-5p could be used as novel non-invasive biomarkers for HCV-positive cirrhosis and hepatocellular carcinoma.《Mol Biol Rep》.2015, * |
| Oksuz Z et al..Serum microRNAs * |
| Targeting epigenetic mechanisms and microRNAs by aspirin and other non steroidal anti-inflammatory agents - implications for cancer treatment and chemoprevention;Yiannakopoulou et al.;《CELLULAR ONCOLOGY》;20140630;167-178 * |
| 阿司匹林对冠心病患者血小板微小RNA-223影响及意义;曾小莉等;《中华实用诊断与治疗杂志》;20150630;553-555 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110951870A (en) * | 2020-01-03 | 2020-04-03 | 中国人民解放军总医院 | Application of miRNA expression quantity in predicting therapeutic effect of clopidogrel |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105463092A (en) | 2016-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ménard et al. | MicroRNA signatures in vitreous humour and plasma of patients with exudative AMD | |
| Vijayan et al. | Peripheral biomarkers of stroke: focus on circulatory microRNAs | |
| Eissa et al. | Clinical verification of a novel urinary microRNA panal: 133b,-342 and-30 as biomarkers for diabetic nephropathy identified by bioinformatics analysis | |
| Sonoda et al. | Serum microRNA-based risk prediction for stroke | |
| Bye et al. | Circulating microRNAs predict future fatal myocardial infarction in healthy individuals–The HUNT study | |
| Wanhainen et al. | Screening of circulating microRNA biomarkers for prevalence of abdominal aortic aneurysm and aneurysm growth | |
| Liu et al. | Association between peripheral blood cells mitochondrial DNA content and severity of coronary heart disease | |
| Pedrotty et al. | Transcriptomic biomarkers of cardiovascular disease | |
| Melak et al. | Circulating microRNAs as possible biomarkers for coronary artery disease: a narrative review | |
| Wang et al. | A meta-analysis of dysregulated miRNAs in coronary heart disease | |
| Silbiger et al. | Novel genes detected by transcriptional profiling from whole-blood cells in patients with early onset of acute coronary syndrome | |
| Ragusa et al. | miRNAs plasma profiles in vascular dementia: biomolecular data and biomedical implications | |
| Zhuo et al. | LncRNA SNHG8 is identified as a key regulator of acute myocardial infarction by RNA-seq analysis | |
| Cheng et al. | Plasma miRNA-122-5p and miRNA-151a-3p identified as potential biomarkers for liver injury among CHB patients with PNALT | |
| Bejleri et al. | Diagnostic and prognostic circulating microrna in acute stroke: a systematic and bioinformatic analysis of current evidence | |
| Gorur et al. | Investigation of possible effects of microRNAs involved in regulation of lipid metabolism in the pathogenesis of atherosclerosis | |
| Moushi et al. | MicroRNAs as possible biomarkers for screening of aortic aneurysms: a systematic review and validation study | |
| Gupta et al. | Long noncoding RNAs associated with phenotypic severity in multiple sclerosis | |
| Schirmer et al. | Suppression of inflammatory signaling in monocytes from patients with coronary artery disease | |
| Naghavi-Gargari et al. | Significant increasing of DISC2 long non-coding RNA expression as a potential biomarker in bipolar disorder | |
| Zhu et al. | Associations of miR-146a, miR-149, miR-196a2, and miR-499 polymorphisms with ischemic stroke in the northern Chinese han population | |
| Parvan et al. | Diagnostic performance of microRNAs in the detection of heart failure with reduced or preserved ejection fraction: a systematic review and meta‐analysis | |
| Wu et al. | Integrated analysis of microRNA and mRNA expression profiles in homozygous familial hypercholesterolemia patients and validation of atherosclerosis associated critical regulatory network | |
| Liu et al. | Plasma exosome-derived microRNAs expression profiling and bioinformatics analysis under cross-talk between increased low-density lipoprotein cholesterol level and ATP-sensitive potassium channels variant rs1799858 | |
| Yuan et al. | Plasma levels of miR-143 and miR-145 are associated with coronary in-stent restenosis within 1 year of follow-up after drug-eluting stent implantation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |