CN105463092A - Application of system for detecting miR-30c-5p expression quantity in prediction of curative effect of aspirin for treating cardiovascular disease patients - Google Patents
Application of system for detecting miR-30c-5p expression quantity in prediction of curative effect of aspirin for treating cardiovascular disease patients Download PDFInfo
- Publication number
- CN105463092A CN105463092A CN201510989205.1A CN201510989205A CN105463092A CN 105463092 A CN105463092 A CN 105463092A CN 201510989205 A CN201510989205 A CN 201510989205A CN 105463092 A CN105463092 A CN 105463092A
- Authority
- CN
- China
- Prior art keywords
- mir
- patient
- expression amount
- cardiovascular
- prediction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an application of a system for detecting miR-30c-5p expression quantity in prediction of a curative effect of aspirin for treating cardiovascular disease patients. In the application disclosed by the invention, an ROC curve analysis is carried out on miR-30c-5p of platelet hyper-reactivity patients by taking non-platelet hyper-reactivity patients a control, the area under curve is 0.720, the sensitivity is 54.84%, and the specificity is 82.25%. The result shows that the expression quality of miR-30c-5p in venous blood of detected objects can be used for judging the clinical curative effect of aspirin for treating the cardiovascular disease patients.
Description
Technical field
The present invention relates in biological technical field the system detecting miR-30c-5p expression amount and predicting that acetylsalicylic acid is to the application in cardiovascular patient curative effect.
Background technology
Acetylsalicylic acid (ASA) is the antiplatelet drug that patients with coronary heart disease secondary prevention is commonly used, a large amount of randomized, double-blind clinical research confirmation acetylsalicylic acid significantly can reduce the generation of the adverse events such as malignant arrhythmia, non-fatal myocardial infarction, sudden cardiac death, are one of standard care medicines of ACC (ACC) and american heart association (AHA) Guidelines recommend.Aspirin on inhibition of platelet aggregation act in crowd exist larger individual difference and unpredictability confirm by many clinical studyes, although the acetylsalicylic acid of some patients long-term taking routine dose, still can not effectively occur by the atherosis Cardioversion of prevention of arterial clinically, this phenomenon is called thrombocyte hyperergy (HighonAspirinPlateletResponse under acetylsalicylic acid low reactivity or aspirin for treatment, HAPR), namely the curative effect of acetylsalicylic acid is bad.
The reactive influence factor of aspirin for treatment comprises environmental factors, compliance, drug dose, drug drug interaction and genetic factors etc.The existing method for assessment of therapeutic effect of aspirin mainly comprises: light turbidimetry detects the platelet aggregation rate of arachidonic acid-induction, serum and urine in TXA2 meta-bolites level detection, VerifyNow detects platelet aggregation rate, PFA-100, thrombelastogram etc., but consistence is poor between different detection methods, and not enough for the predictive value of acetylsalicylic acid to cardiovascular patient clinical efficacy and clinical cardiovascular events risk.
Summary of the invention
Technical problem to be solved by this invention how to predict that acetylsalicylic acid is to cardiovascular patient clinical efficacy.
For solving the problems of the technologies described above, the present invention provide firstly following B1) or purposes B2):
B1) system detecting miR-30c-5p expression amount is predicted in preparation or assists prediction acetylsalicylic acid to the application in cardiovascular patient curative effect product;
B2) system detecting miR-30c-5p expression amount is being predicted or is being assisted prediction acetylsalicylic acid to the application in cardiovascular patient curative effect.
In such use, the system of described detection miR-30c-5p expression amount can be the system utilizing quantitative PCR detection miR-30c-5p expression amount.
In such use, the system of described detection miR-30c-5p expression amount can comprise the reagent and/or test kit and/or instrument that detect miR-30c-5p expression amount, as passed through reagent, test kit and the instrument needed for quantitative PCR reaction detection miR-30c-5p expression amount.Specifically, the system detecting miR-30c-5p expression amount can be the primer and other reagent carried out required for quantitative PCR reaction and/or instrument that detect miR-30c-5p expression amount, also can be only the primer detecting miR-30c-5p expression amount.The primer of described detection miR-30c-5p expression amount can be the primer that nucleotides sequence is classified as sequence 1.
In the system of described detection miR-30c-5p expression amount, other reagent carried out required for quantitative PCR reaction can be seminal plasma fructose detection kit that the article No. of Beijing Quanshijin Biotechnology Co., Ltd is AQ202-01 (as TransScriptGreenmiRNATwo-StepqRT-PCRSuperMix (containing matching with single stranded DNA shown in sequence 1 single stranded DNA using and carry out pcr amplification in TransScriptGreenmiRNATwo-StepqRT-PCRSuperMix)) and/or microRNA data handling system.Described microRNA data handling system can be used for calculating the expression amount of the miR-30c-5p of the cardiovascular patient from aspirin for treatment to be predicted, predicts that aspirin for treatment is to the curative effect of described cardiovascular patient to be predicted according to the expression amount of described miR-30c-5p.
In such use, described miR-30c-5p expression amount is the expression amount of miR-30c-5p in peripheral blood.
In such use, described miR-30c-5p expression amount is the relative expression quantity of miR-30c-5p relative to U6.
For solving the problems of the technologies described above, present invention also offers prediction using miR-30c-5p as mark or auxiliary prediction acetylsalicylic acid to the system of cardiovascular patient curative effect at preparation prediction or auxiliary prediction acetylsalicylic acid to the application in cardiovascular patient curative effect product.
In above-mentioned application, described prediction or the system of auxiliary prediction acetylsalicylic acid to cardiovascular patient curative effect can be the system of described detection miR-30c-5p expression amount.
For solving the problems of the technologies described above, present invention also offers prediction or assisting prediction acetylsalicylic acid to the product of cardiovascular patient curative effect.
Prediction provided by the present invention or auxiliary prediction acetylsalicylic acid, to the product of cardiovascular patient curative effect, are the system of described detection miR-30c-5p expression amount.
For solving the problems of the technologies described above, present invention also offers prediction acetylsalicylic acid to the method for cardiovascular patient curative effect.
Prediction acetylsalicylic acid provided by the present invention, to the method for cardiovascular patient curative effect, comprising: detect the miR-30c-5p expression amount from cardiovascular patient to be predicted; If the expression amount of miR-30c-5p is higher in the venous blood of described cardiovascular patient, described cardiovascular patient is or candidate is that the risk of thrombocyte hyperergy (HAPR) patient under aspirin for treatment is larger, if the expression amount of miR-30c-5p is lower in the venous blood of detected object, described cardiovascular patient is or candidate is that the risk of thrombocyte hyperergy (HAPR) patient under aspirin for treatment is less.
Aforesaid method can utilize described system to carry out.
In the present invention, described cardiovascular patient can be the patient with following at least one risk factors of cardiovascular diseases: suffer from stable angina pectoris, acute coronary syndrome, percutaneous coronary intervention (pci) operation, coronary artery bypass surgery and ischemic cerebral vascular.
In the present invention, when using the patient of cardiovascular high-risk patient inclusion criteria as detected object, if in the venous blood of detected object the relative expression quantity relative to U6 of miR-30c-5p in scope (-15.23 ~ 21.67) and be the cardiovascular high-risk patient of No-HAPR 3-5 doubly more than, this detected object is thrombocyte hyperergy (HAPR) patient under aspirin for treatment, if the 3-5 of the cardiovascular high-risk patient of relative expression quantity not sufficient No-HAPR relative to U6 of miR-30c-5p doubly in the venous blood of detected object, this detected object is thrombocyte hyperergy (No-HAPR) patient under non-aspirin for treatment.
Experiment proves, with non-thrombocyte hyperergy (No-HAPR) patient for contrast, carries out ROC tracing analysis to 4 microRNA (miR-30c-5p, miR-16-2-3p, miR-98-5p and miR-3158-5p) of patient in HPR group.The area under curve of miR-30c-5p is 0.720, sensitivity is 54.84%, specific degree is 82.25%, miR-3158-5p area under curve is 0.726, sensitivity is 83.87%, and specific degree is that the area under curve of 51.52%, miR-30c-5p and miR-3158-5p is between 0.7-0.9, can be used for the judgement to acetylsalicylic acid clinical efficacy, these two microRNA diagnosis to acetylsalicylic acid clinical efficacy have diagnostic value.Show, in the venous blood of detected object, the expression amount of miR-30c-5p can be used for the acetylsalicylic acid clinical efficacy judging cardiovascular patient.
Accompanying drawing explanation
Fig. 1 is miR-30c-5p to the ROC curve of acetylsalicylic acid evaluation of clinical curative effect, specificity and susceptibility.The oblique straight line given in figure is reference line, specifically represents: when area under curve equals 50%, can diagnose the patient of the therapeutic effect of aspirin difference of half.Wherein, Sensitivity represents susceptibility, and Specificity represents specificity.
Fig. 2 is miR-3158-5p to the ROC curve of acetylsalicylic acid evaluation of clinical curative effect, specificity and susceptibility.The oblique straight line given in figure is reference line, specifically represents: when area under curve equals 50%, can diagnose the patient of the therapeutic effect of aspirin difference of half.Wherein, Sensitivity represents susceptibility, and Specificity represents specificity.
Embodiment
Below in conjunction with embodiment, the present invention is further described in detail, the embodiment provided only in order to illustrate the present invention, instead of in order to limit the scope of the invention.
Experimental technique in following embodiment, if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
TransScriptGreenmiRNATwo-StepqRT-PCRSuperMix in following embodiment is Beijing Quanshijin Biotechnology Co., Ltd's product.
Embodiment 1, for predicting the determination of acetylsalicylic acid to Patients with Cardiovascular/Cerebrovascular Diseases
Cardiovascular high-risk patient 350 example, inclusion criteria is as follows: age >=50 years old; There is the patient of following at least one risk factors of cardiovascular diseases: suffer from stable angina pectoris, acute coronary syndrome (ACS), percutaneous coronary intervention (pci) (PCI) operation, coronary bypass (CABG) operation and ischemic cerebral vascular.This 350 routine cardiovascular high-risk patient is the PATIENT POPULATION obtained after getting rid of a part of patient according to exclusion standard, and exclusion standard is for having following a kind of situation: platelet count is less than 100 × 10
9/ L; Disease in the blood system; Application GPIIb/IIIa antagonist, warfarin or non-steroidal anti-inflammatory drugs; Serious hepatic and kidney function obstacle; Acetylsalicylic acid is had to use contraindication.
Collect selected patient clinical data: demographic data, risk factors of cardiovascular diseases, cardiovascular disease condition, selected time merge disease and drug combination situation, the index such as routine blood test, hepatic and renal function, blood fat, serum hs-CRP, immunity.The platelet aggregation rate that the arachidonic acid (ArachidonicAcid, AA) simultaneously adopting optics turbidimetry to have detected selected patient is induced.This research is by the approval of Ethics Committee of Peking University First Hospital, and full-fledged research object signs Informed Consent Form all on pretreatment.
The research object clinical data that is selected in all adopt SPSS17.0 software to analyze.Measurement data adopts
represent, compare between two groups and adopt t inspection; Enumeration data percentage ratio represents, the comparison between two groups adopts the χ2-test,chi-square test of four fold table, and each factor and thrombocyte hyperergy strength of association odds ratio (OR) value and 95% credibility interval (95%CI) represent.Logistic regression analysis corrects the predisposing factors such as age, sex, weight index, smoking, hypertension, with bilateral P<0.05 for difference has statistical significance.
1, platelet aggregation rate detects
Gather selected detection in peripheral blood of patients underwent 3mL, take concentration as the arachidonic acid (arachidonicacid of 0.5mg/mL, AA) as inductor, by optics turbidimetry for Determination platelet aggregation rate (plateletagglutinationratio, PA).Thrombocyte hyperergy (Highonaspirinplateletreactivity, HAPR) PA value >=3/4 being defined as selected patient is always selected in the PA dividing value of patient, this research PA dividing value is 15.22%, accordingly selected patient is divided into HAPR group and non-thrombocyte hyperergy group (No-Highonaspirinplateletreactivity, No-HAPR) group.
2, the mensuration of PA
PACK-4 hyperchannel platelet aggregation instrument (Helena, the U.S.) is used to measure platelet aggregation rate.Be taken into the peripheral blood sample selecting patient, in 37 DEG C, the centrifugal 10min of 800r/min, draw upper strata platelet rich plasma (platelet-richplasma, PRP), obtain the blood specimen drawing PRP.By drawing the blood specimen of PRP, in the centrifugal 10min of 4000r/min, it is for subsequent use that absorption upper strata PFP is prepared as platelet-poor plasma (platelet-poorplasma, PPP).The platelet count drawn in the blood specimen of PRP is adjusted to (300-400) × 10
9/ L is placed in colorimetric cylinder, and adding concentration is that the inductor of the arachidonic acid (arachidonicacid, AA) of 0.5mg/mL measures.
3, cardiovascular event defines and follows up a case by regular visits to
The definition of cardiovascular event: the situation of Aspirin issues to give birth to states at least one symptom: unstable angina, acute coronary syndrome, non-lethality cerebral apoplexy, in-stent restenosis, dead, and visualisation shows former Coronary Artery Lesions progress.All selected patients after discharge 3 months, 6 months and 12 monthlyly follow up a case by regular visits in outpatient service, determine cardiovascular event.
Coronary Artery Lesions progress is defined as and at least meets with the next item down: >=50% stenotic lesion blood vessel number or sections number comparatively before increase; Original narrow >=30% lesion vessels, again check CAG and point out stenosis amplification > 20%; Originally row CAG checks that prompting is without narrow blood vessel, and check CAG point out its stenosis >=30%.
According to the clinical data of above-mentioned selected patient, choose the selected patient of wherein 40 routine coronary artery bracket postoperative rule Aspirin for carrying out order-checking research.All the other 310 routine patients are used for the quantitative PCR checking research after microRNA screening.The clinical data of selected patient is in table 1.
The clinical data of table 1, selected patient
Embodiment 2, for predicting the screening of acetylsalicylic acid to the gene marker of Patients with Cardiovascular/Cerebrovascular Diseases clinical efficacy
Still there is the typical patient of cardiovascular event, called after cardiovascular event group in the acetylsalicylic acid Antiplatelet therapy picking out 20 routine coronary artery bracket postoperative rule application 100mg/d in the selected patient of 40 routine coronary artery bracket postoperative rule Aspirin; There is not the selected patient of cardiovascular event, called after control group in the acetylsalicylic acid Antiplatelet therapy of match 20 routine coronary artery bracket postoperative rule application 100mg/d.The selected patient of cardiovascular event group and control group in age, sex, weight index, smoking, hypertension, hyperlipidaemia, previously myocardial infarction all without obvious significant difference (P>0.05); Also no difference of science of statistics (P>0.05) in laboratory examination and essential drugs treatment etc.
Adopt quantitative PCR analysis instrument 7500 system to carry out quantitative analysis to the microRNA (table 2) of 10 in cardiovascular event group and control group, obtain the relative expression quantity relative to U6 of these 10 microRNA in whole blood.
10 microRNA sequences are as shown in table 2 below, and dye method quantification PCR primer sequence is as shown in table 3 below.
Table 2, microRNA sequence
The quantification PCR primer sequence of table 3, microRNA
It is as follows that microRNA extracts concrete operation step:
1. take out anticoagulation and the blood plasma of-80 DEG C of cryogenic freezings, rapidly respectively get 200 μ l blood and 100 μ l blood plasma after dissolving on ice, add 1mlLB10 respectively, vibration mixing.
2. room temperature leaves standstill 5min.
3. often use 1mlLB10 to add 0.2ml chloroform or 50 μ l4-Bromoanisole, thermal agitation 30 seconds, incubated at room 3min.
4.4 DEG C, 10,000 × g centrifugal 15min (detect in milling cutter and cause DNA pollution, can suitably leave a part of aqueous phase).
5. the aqueous phase that transfer is colourless, in new centrifuge tube, adds the dehydrated alcohol that 1/3 transfer liquid is long-pending, puts upside down mixing gently, now may occur precipitation.
6. the solution obtained is added in RNASpinColumn together with precipitation, 12,000 × g4 DEG C of centrifugal 30s, retain effluent liquid.
7. measure effluent volume, transfer in clean 1.5ml or 2mlRNase-free centrifuge tube, the dehydrated alcohol (now may occur precipitation) adding 1.25 times of effluent volumes puts upside down mixing gently.
8. the solution obtained is added in miRNASpinColumn together with precipitation, 12,000 × g4 DEG C of centrifugal 30s, abandoned stream fluid.
9. add 500 μ lWB10 (please first check whether before use and add dehydrated alcohol), 12,000 × g4 DEG C of centrifugal 30s, abandoned stream fluid.
10. repeating step 9 once.
11.12,000 × g4 DEG C of centrifugal 2min, thoroughly remove residual ethanol, leave standstill several minutes thoroughly dry miRNASpinColumn in room temperature.
MiRNASpinColumn is put into 1.5mlRNase-freeTube by 12., and add the central authorities of 30 μ lRNase-freeWater at centrifugal column, room temperature leaves standstill 1min.
13.12,000 × g4 DEG C of centrifugal 2min, wash-out miRNA.
RNA is placed in-80 DEG C of preservations by 14..
CDNA Template preparation: use TransScriptGreenmiRNATwo-StepqRT-PCRSuperMix (AQ202) to prepare cDNA template, reaction system and reaction system are as following table:
| Agent/composition | Volume |
| Total RNA | 4μl |
| 2×TS miRNA Reaction Mix | 10μl |
| TransSctipt miRNA RT Enzyme Mix | 1μl |
| RNase-free Water to final volume | 20μl |
Reaction conditions: hatch 1h for 37 DEG C, 85 DEG C of heating 5s inactivation RT enzymes.
QPCR quantitative experiment: each sample arranges 3 technology and repeats, often pair of primer arranges NTC for contrast (namely without the contrast of template), internal reference is U6, the primer of internal reference is U6-F:GCTTCGGCAGCACATATACTAAAAT and U6-R:CGCTTCACGAATTTGCGTGTCAT, and the reaction system of internal reference and condition are as following table:
Reaction conditions:
The reaction system of microRNA is: the system of 20 μ l, be specially cDNA template 1 μ l, 2 × TransStartTopGreenqPCRSuperMix quantitative reagent 10 μ l, front primer (front primer sequence is corresponding microRNA primer sequence in table 3) 0.4 μ l, rear primer 0.4 μ l, ddH
2o8.2 μ l.Wherein, the reagent in the test kit (wherein, primer is in 2 × TransStartTopGreenqPCRSuperMix quantitative reagent) of 2 × TransStartTopGreenqPCRSuperMix quantitative reagent and rear primer to be the article No. of Beijing Quanshijin Biotechnology Co., Ltd be AQ202-01.Reaction conditions is: 95 DEG C of 30s; 95 DEG C of 5s, 58 DEG C of 15s, 72 DEG C of 10s), 30 circulations.
Ratio as the expression amount of microRNA in cardiovascular event group and the expression amount of this microRNA in control group is greater than 1, this microRNA cardiovascular event group up-regulated; Ratio as the expression amount of microRNA in cardiovascular event group and the expression amount of this microRNA in control group is less than 1, this microRNA cardiovascular event group down-regulated expression; Ratio as the expression amount of microRNA in cardiovascular event group and the expression amount of this microRNA in control group equals 1, and this microRNA cardiovascular event group expresses indifference.Quantitative PCR the result shows that 4 microRNA (miR-30c-5p, miR-16-2-3p, miR-98-5p and miR-3158-5p) expression amounts in cardiovascular event group and control group table 4 are variant, and the expression amount of other microRNA does not have significant difference.
When microRNA is when the expression amount of cardiovascular event group is more than 1 times of the expression amount of control group, show that this microRNA is risk profile microRNA, can be used as the biological indicator evaluating therapeutic effect of aspirin.
The sequenced genes the selection result of table 4, cardiovascular event group and control group
Note: in table 4, UP represents cardiovascular event group up-regulated, and DOWN represents cardiovascular event group down-regulated expression; In " FOLD " row, between each numeric representation two generation sequencing result examination cardiovascular event group and control group, microRNA expresses and changes multiple.
Embodiment 3, for predicting the checking of acetylsalicylic acid to the microRNA marker of Patients with Cardiovascular/Cerebrovascular Diseases clinical efficacy
According to the platelet aggregation rate detection method in embodiment 1, the selected patient of the quantitative fluorescent PCR checking research after being used for microRNA screening to 310 examples divides into groups, and wherein HAPR group totally 74 routine patients, No-HAPR group is totally 236 routine patients.
The selected patient of the quantitative fluorescent PCR checking research after being used for microRNA screening to 310 examples carries out whole blood microRNA extraction, extracted whole blood microRNA is carried out reverse transcription, is placed in-20 DEG C of preservations; 10 microRNA in SYBRGreen fluorescence quantifying PCR method his-and-hers watches 2 are used to increase, the relative expression quantity (table 5) relative to U6 of these 10 microRNA in quantitative analysis HAPR group and No-HAPR group, method, with embodiment 2, assesses the dependency of these 10 microRNA and acetylsalicylic acid clinical efficacy.
Table 5, the relative expression quantity of 10 microRNA in HRP and No-HPR is two groups
With SPSS16.0 software with No-HAPR group for contrast, by two groups of patients' 4 express discrepant microRNA (miR-30c-5p, miR-16-2-3p, miR-98-5p and miR-3158-5p) and the cardiovascular event factor of causing danger carry out COX regression analysis (table 6).COX regression result shows that cardiovascular event occurrence risk significant correlation still occurs for miR-30c-5p, miR-3158-5p and smoking factor and patients with coronary heart disease rule Aspirin.
Table 6, COX regression analysis cardiovascular event are caused danger factor and microRNA occurrence risk
ROC tracing analysis miR-30c-5p is for evaluation Ah Si reactive predictive value (Fig. 1), the area under curve of miR-30c-5p is 0.720, sensitivity is 54.84%, specific degree is 82.25%, the area under curve of miR-30c-5p, between 0.7-0.9, has diagnostic value to the evaluation of acetylsalicylic acid clinical efficacy.ROC tracing analysis miR-3158-5p is for evaluation Ah Si reactive predictive value (Fig. 2), the area under curve of miR-3158-5p is 0.726, sensitivity is 83.87%, specific degree is 51.52%, the area under curve of miR-3158-5p, between 0.7-0.9, has diagnostic value to the evaluation of acetylsalicylic acid clinical efficacy.The area under curve of miR-16-2-3p is 0.668, the area under curve of miR-98-5p is 0.596, the equal <0.7 of area under curve of miR-16-2-3p and miR-98-5p, shows that the diagnostic value of these two microRNA to acetylsalicylic acid clinical efficacy is lower.
3-5 times (in the present invention being 5.613 times) that thrombocyte hyperergy (HAPR) patient miR-30c-5p relative expression quantity Ct value (scope-15.23 ~ 21.67) is non-thrombocyte hyperergy (No-HAPR) patient relative expression quantity Ct value (scope-13.89 ~ 19.28) is judged to be according to the relative expression quantity of two groups of patient miR-30c-5p.Concrete, when using the patient meeting the cardiovascular high-risk patient inclusion criteria in embodiment 1 as detected object, according to the above results, obtain detected result criterion as follows: when using the patient meeting the cardiovascular high-risk patient inclusion criteria in embodiment 1 as detected object, if the relative expression quantity of miR-30c-5p is in scope (-15.23 ~ 21.67) and for the 3-5 of the cardiovascular high-risk patient of No-HAPR is doubly more than (in the present invention being 5.613 times) in the venous blood of detected object, this detected object is thrombocyte hyperergy (HAPR) patient under aspirin for treatment, if the 3-5 of the cardiovascular high-risk patient of relative expression quantity not sufficient No-HAPR of miR-30c-5p doubly (in the present invention being 5.613 times) in the venous blood of detected object, this detected object is thrombocyte hyperergy (No-HAPR) patient under non-aspirin for treatment.
0.3-0.047 times (in the present invention being 0.047 times) that thrombocyte hyperergy (HAPR) patient miR-3158-5p relative expression quantity Ct value (scope-16.46 ~ 26.93) is non-thrombocyte hyperergy (No-HAPR) patient relative expression quantity Ct value (scope-19.14 ~ 29.42) is judged to be according to the relative expression quantity of two groups of patient miR-3158-5p.Concrete, when using the patient meeting the cardiovascular high-risk patient inclusion criteria in embodiment 1 as detected object, according to the above results, obtain detected result criterion as follows: when using the patient meeting the cardiovascular high-risk patient inclusion criteria in embodiment 1 as detected object, if in the venous blood of detected object the relative expression quantity of miR-3158-5p in scope (-16.46 ~ 26.93) and less than the cardiovascular high-risk patient of No-HAPR 0.3-0.047 doubly (in the present invention, being 0.047 times), this detected object is thrombocyte hyperergy (HAPR) patient under aspirin for treatment, if the relative expression quantity of miR-3158-5p is more than 0.3-0.047 times (being 0.047 times) of the cardiovascular high-risk patient of No-HAPR in the present invention in the venous blood of detected object, this detected object is thrombocyte hyperergy (No-HAPR) patient under non-aspirin for treatment.
Cardiovascular event group and control group comparison are found that miR-30c-5p and miR-3158-5p can form the diagnositc system of acetylsalicylic acid clinical efficacy by this research, and these two microRNA can be used as biological markers for assessment of acetylsalicylic acid reactivity simultaneously.
Claims (10)
1. the system detecting miR-30c-5p expression amount is predicted in preparation or assists prediction acetylsalicylic acid to the application in cardiovascular patient curative effect product.
2. the system detecting miR-30c-5p expression amount is being predicted or is being assisted prediction acetylsalicylic acid to the application in cardiovascular patient curative effect.
3. application according to claim 1 and 2, is characterized in that: the system of described detection miR-30c-5p expression amount is the system utilizing quantitative PCR detection miR-30c-5p expression amount.
4. according to described application arbitrary in claim 1-3, it is characterized in that: the system of described detection miR-30c-5p expression amount comprises the primer that nucleotides sequence is classified as sequence 1.
5., according to described application arbitrary in claim 1-4, it is characterized in that: described miR-30c-5p expression amount is the expression amount of miR-30c-5p in peripheral blood.
6. according to described application arbitrary in claim 1-5, it is characterized in that: described system comprises microRNA data handling system, according to the expression amount of described miR-30c-5p, described microRNA data handling system, for calculating the expression amount of the miR-30c-5p of the cardiovascular patient from aspirin for treatment to be predicted, predicts that aspirin for treatment is to the curative effect of described cardiovascular patient to be predicted.
7. using miR-30c-5p as the prediction of mark or auxiliary prediction acetylsalicylic acid, the system of cardiovascular patient curative effect is being prepared to prediction or assisted prediction acetylsalicylic acid to the application in cardiovascular patient curative effect product.
8. prediction or auxiliary prediction acetylsalicylic acid are to the product of cardiovascular patient curative effect, are the system of described detection miR-30c-5p expression amount arbitrary in claim 1-6.
9. predict that acetylsalicylic acid is to the method for cardiovascular patient curative effect, comprising: detect the miR-30c-5p expression amount from cardiovascular patient to be predicted; If the expression amount of miR-30c-5p is higher in the venous blood of described cardiovascular patient, described cardiovascular patient is or candidate is that the risk of thrombocyte hyperergy (HAPR) patient under aspirin for treatment is larger, if the expression amount of miR-30c-5p is lower in the venous blood of detected object, described cardiovascular patient is or candidate is that the risk of thrombocyte hyperergy (HAPR) patient under aspirin for treatment is less.
10., according to arbitrary described application in claim 1-7 or product according to claim 8 or method according to claim 9, it is characterized in that: described cardiovascular patient is the patient with following at least one risk factors of cardiovascular diseases: suffer from stable angina pectoris, acute coronary syndrome, percutaneous coronary intervention (pci) operation, coronary artery bypass surgery and ischemic cerebral vascular.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510989205.1A CN105463092B (en) | 2015-12-24 | 2015-12-24 | The system for detecting miR-30c-5p expression quantity is predicting aspirin to the application in cardiovascular patient curative effect |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510989205.1A CN105463092B (en) | 2015-12-24 | 2015-12-24 | The system for detecting miR-30c-5p expression quantity is predicting aspirin to the application in cardiovascular patient curative effect |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105463092A true CN105463092A (en) | 2016-04-06 |
| CN105463092B CN105463092B (en) | 2019-03-05 |
Family
ID=55601245
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510989205.1A Active CN105463092B (en) | 2015-12-24 | 2015-12-24 | The system for detecting miR-30c-5p expression quantity is predicting aspirin to the application in cardiovascular patient curative effect |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105463092B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110951870A (en) * | 2020-01-03 | 2020-04-03 | 中国人民解放军总医院 | Application of miRNA expression quantity in predicting therapeutic effect of clopidogrel |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140303025A1 (en) * | 2013-03-15 | 2014-10-09 | The Translational Genomics Research Institute | Methods for the diagnosis and prognosis of neurodegenerative diseases |
| CN104975112A (en) * | 2015-07-08 | 2015-10-14 | 深圳国际旅行卫生保健中心 | Detection method based on throat swab sample for influenza virus and detection kit for influenza virus |
-
2015
- 2015-12-24 CN CN201510989205.1A patent/CN105463092B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140303025A1 (en) * | 2013-03-15 | 2014-10-09 | The Translational Genomics Research Institute | Methods for the diagnosis and prognosis of neurodegenerative diseases |
| CN104975112A (en) * | 2015-07-08 | 2015-10-14 | 深圳国际旅行卫生保健中心 | Detection method based on throat swab sample for influenza virus and detection kit for influenza virus |
Non-Patent Citations (3)
| Title |
|---|
| OKSUZ Z ET AL.: "Serum microRNAs; miR-30c-5p, miR-223-3p, miR-302c-3p and miR-17-5p could be used as novel non-invasive biomarkers for HCV-positive cirrhosis and hepatocellular carcinoma", 《MOL BIOL REP》 * |
| YIANNAKOPOULOU ET AL.: "Targeting epigenetic mechanisms and microRNAs by aspirin and other non steroidal anti-inflammatory agents - implications for cancer treatment and chemoprevention", 《CELLULAR ONCOLOGY》 * |
| 曾小莉等: "阿司匹林对冠心病患者血小板微小RNA-223影响及意义", 《中华实用诊断与治疗杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105463092B (en) | 2019-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wanhainen et al. | Screening of circulating microRNA biomarkers for prevalence of abdominal aortic aneurysm and aneurysm growth | |
| Miyamoto et al. | Circulating microRNA as a biomarker for recovery in pediatric dilated cardiomyopathy | |
| JP6211511B2 (en) | Universal screening test (UST) based on miRNA | |
| Kondkar et al. | Utility of circulating microRNAs as clinical biomarkers for cardiovascular diseases | |
| Maciejak et al. | Circulating miR-30a-5p as a prognostic biomarker of left ventricular dysfunction after acute myocardial infarction | |
| Romaine et al. | Circulating microRNAs and hypertension—from new insights into blood pressure regulation to biomarkers of cardiovascular risk | |
| Silbiger et al. | Novel genes detected by transcriptional profiling from whole-blood cells in patients with early onset of acute coronary syndrome | |
| Zhou et al. | Circular RNAs as novel biomarkers for cardiovascular diseases | |
| Zhuo et al. | LncRNA SNHG8 is identified as a key regulator of acute myocardial infarction by RNA-seq analysis | |
| Li et al. | Detection of Differentially Expressed MicroRNAs in Rheumatic Heart Disease: miR‐1183 and miR‐1299 as Potential Diagnostic Biomarkers | |
| Halimi et al. | Clinical translation of human microRNA 21 as a potential biomarker for exposure to ionizing radiation | |
| Li et al. | Platelet microRNA for predicting acute myocardial infarction | |
| Yu et al. | Intrarenal microRNA signature related to the fibrosis process in chronic kidney disease: identification and functional validation of key miRNAs | |
| Bejleri et al. | Diagnostic and prognostic circulating microrna in acute stroke: a systematic and bioinformatic analysis of current evidence | |
| Cheng et al. | Plasma miRNA-122-5p and miRNA-151a-3p identified as potential biomarkers for liver injury among CHB patients with PNALT | |
| Hakimzadeh et al. | Circulating microRNAs characterizing patients with insufficient coronary collateral artery function | |
| Xu et al. | Characterization of serum miRNAs as molecular biomarkers for acute Stanford type A aortic dissection diagnosis | |
| Shah et al. | Combining serum microRNA and CA-125 as prognostic indicators of preoperative surgical outcome in women with high-grade serous ovarian cancer | |
| Moushi et al. | MicroRNAs as possible biomarkers for screening of aortic aneurysms: a systematic review and validation study | |
| Fiori et al. | Using epigenetic tools to investigate antidepressant response | |
| Padilla et al. | Identification of genes whose expression is altered by obesity throughout the arterial tree | |
| Wu et al. | Long non-coding RNA TCONS_00000200 as a non-invasive biomarker in patients with intracranial aneurysm | |
| Li et al. | MicroRNAs as potential biomarkers for the diagnosis of chronic kidney disease: a systematic review and meta-analysis | |
| Gao et al. | The potential biomarkers for the formation and development of intracranial aneurysm | |
| TW201231671A (en) | Method and kit for in vitro diagnosis of atherosclerosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |