CN105462999A - Method for screening beta-glucosaccharase gene from mildewed sugarcane leaves based on metagenomic technology - Google Patents

Abstract

The invention discloses a beta-glucosaccharase gene, wherein the nucleotide sequence of the beta-glucosaccharase gene is shown as the SEQ ID NO.1. The invention further discloses recombinant beta-glucosaccharase, wherein the amino acid sequence of the recombinant beta-glucosaccharase is shown as the SEQ ID NO.2. The invention also discloses a screening method of the recombinant beta-glucosaccharase. The screening method comprises the following steps: extraction of microbial metagenomic DNA from the mildewed sugarcane leaves; establishment of a metagenomic library; screening of the beta-glucosaccharase gene from the metagenomic library, wherein the nucleotide sequence of the beta-glucosaccharase gene is shown as the SEQ ID NO.1; and cloning and expression for the obtained beta-glucosaccharase gene, thus the recombinant beta-glucosaccharase is obtained, wherein the amino acid sequence of the recombinant beta-glucosaccharase is shown as the SEQ ID NO.2. The recombinant beta-glucosaccharase has extremely high activity and is not sensitive to hydrolysis products under the alkaline condition.

Description

From the Caulis Sacchari sinensis leaf gone mouldy, the method for beta-glucosidase gene is screened based on grand gene engineering

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of beta-glucosidase gene, the invention still further relates to a kind of restructuring beta-glucosidase, the invention still further relates to a kind of method of beta-glucosidase of recombinating.

Background technology

Along with the continuous increase of consumption of fossil fuels speed, the aggravation of environment and resources crisis, day by day urgent with exploitation to the demand of substitute energy biomass energy.Mierocrystalline cellulose is as the chief component of plant cell wall; it is the carbohydrate the most extensive, content is the abundantest that the earth distributes; the optimal starting material producing the new forms of energy such as bio-ethanol or other liquid fuel; can effectively alleviating energy crisis and ecocrisis, promote the Sustainable development of global economy.

Occurring in nature also exists the cellulosic biosystem of multiple efficient degradation, and the lignocellulose lytic enzyme utilizing microorganism to produce carrys out a kind of effective way that lignocellulose degradation is cellulose utilization.The degraded of lignocellulose needs the synergy of multiple enzyme, mainly comprises endo cellulase (EC3.2.1.4) exocellulase (EC3.2.1.91) and beta-glucosidase (EC3.2.1.21).Endo cellulase mainly acts on the amorphous cellulose element in indefinite form district in cellulosic molecule, and the β-Isosorbide-5-Nitrae-glycosidic link in random hydrolysis cellulosic molecule, produces new polysaccharide chain end or soluble cellooligsaccharides; Exocellulase mainly acts on reduced form end or the Non end of fibrous polysaccharaide chain, and hydrolysis β-Isosorbide-5-Nitrae-glycosidic link, discharges cellobiose or glucose molecule; The oligosaccharides (mainly cellobiose) that inscribe and exocellulase produce mainly is hydrolyzed to glucose by the later stage of native cellulolytic by beta-glucosidase.In cellulosic degradation process, beta-glucosidase participates in the final step of cellulose hydrolysis, is often considered to the rate-limiting enzyme of cellulose degradation process, is also utilize cellulase to carry out one of Main Bottleneck of efficient Wood Adhesives from Biomass simultaneously.

Beta-glucosidase is widely distributed at occurring in nature, and be prevalent in plant, microorganism and mammiferous enteron aisle, the character of the beta-glucosidase of different sources is different, thus causes the range of application that differs from one another.At present, the beta-glucosidase reported mostly be acidicenzym, its optimal reaction pH is mostly between pH4.5-5.0.In addition, research shows generally, and beta-glucosidase is very responsive to its hydrolysate, and the glucose of extremely low concentration just can the activity of feedback inhibition beta-glucosidase.Improve cellulosic degradation efficiency, be badly in need of finding the beta-glucosidase possessing new zymologic property.

Summary of the invention

The object of this invention is to provide a kind of beta-glucosidase gene.

The present invention also provides a kind of restructuring beta-glucosidase.

The present invention also provides a kind of screening method of beta-glucosidase of recombinating, and activity is high and to the highstrung problem of hydrolysate in the basic conditions to solve the enzyme that exists in prior art.

First technical scheme of the present invention is, a kind of beta-glucosidase gene, its nucleotide sequence is as shown in SEQIDNO.1.

Second technical scheme of the present invention is, a kind of restructuring beta-glucosidase, its aminoacid sequence is as shown in SEQIDNO.2.

3rd technical scheme of the present invention is that a kind of screening method of beta-glucosidase of recombinating, comprises the following steps:

1), the extraction of molded sugar cane leaf microorganism macro genome DNA: collect the Caulis Sacchari sinensis leaf 10g gone mouldy, and cut to 1-3cm length, put into 250ml triangular flask; Add enrichment culture liquid, 72h is cultivated in 30 DEG C of concussions; Collected by centrifugation thalline, thalline is resuspended in 1.35mlDNA extracting buffer, adds 0.15ml20%SDS after mixing, 65 DEG C of water-bath 2h, and period turns upside down 10 times and liquid nitrogen freezing 2min every 20min; The centrifugal 10min of 6000g, collects supernatant, the chloroform of v such as to add, mixing of turning upside down; The centrifugal 10min of 6000g, collects supernatant, adds the Virahol of 0.6v, precipitation at room temperature 2h; The centrifugal 20min of 16000g, abandons supernatant, after precipitating the washing with alcohol twice with 75%, uses ddH ₂o dissolves, and obtains crude extract;

2), grand genomic library is built: the size detecting DNA fragmentation with 1% agarose gel electrophoresis, concentration and the purity of DNA is detected with nucleic acid electrophoresis detector, purifying is carried out to DNA, and with the partially digested STb gene of restriction enzyme BamHI, reclaims the endonuclease bamhi of 3-10kb; Build grand genomic library;

3), from grand genomic library filter out beta-glucosidase gene, its nucleotide sequence is as shown in SEQIDNO.1;

4) clone the beta-glucosidase gene obtained, express, obtain beta-glucosidase recombinant protein, its aminoacid sequence is as shown in SEQIDNO.2.

Further, step 1) in enrichment culture liquid comprise following component: Xylo-Mucine 5g/L; NaNO ₃2g/L; K ₂pO ₃1g/L; KCl0.5g/L; MgSO ₄0.5g/L; FeSO ₄0.01g/L, surplus is water, and above total amount is 100ml.

Further, step 1) in DNA extracting buffer comprise following component: 100mMTris-HCl, 100mMEDTA-Na ₂, 100mM phosphoric acid buffer, 1.5MNaCl, 1%CTAB, above component total amount is 1.35ml, and wherein, the pH of Tris-HCl is 8.0, EDTA-Na ₂pH be 8.0, the pH of phosphoric acid buffer is 8.0.

Further, step 2) in build grand genomic library and be specially: to be connected with pUC118/BamHI (BAP) carrier to spend the night reclaiming the endonuclease bamhi that obtains, connect after product PCR primer purification kit carries out purifying and mix with Electroporation-competent cells, place 5min on ice, transfer DNA/cell mixture is in the 2mm electroporation container of precooling, be 2 at voltage, under the condition of 500V, pulse is carried out to electroporation container, add the LB of 900 μ l immediately in electroporation container, 37 DEG C, 180r/min, 30min is cultivated in concussion, converted product is applied to containing 100 μ g/ml penbritins, on the flat board of 0.5mM IPTG pyranoside and the chloro-3-indoles of the 100 bromo-4-of μ Μ 5--β-D-galactoside, flat board is inverted in 37 DEG C of incubators, cultivate 15-18h, build storage capacity thus and reach 100000 transformants, grand genomic library that diversity is good.

Further, step 3) in from grand genomic library, filter out beta-glucosidase gene be specially:

3.1) screening of beta-glucosidase gene: overnight culture is copied on screening flat board, cultivate 72h for 37 DEG C, select the clone that color is black, wherein, screening flat board is: peptone 10g/l, yeast powder 5g/l, NaCl10g/l, Vitamin C2 1g/l, citric acid high ferro ammonium 2.5g/l, 100 μ g/mlAmp and 0.5mMIPTG;

3.2) final election of beta-glucosidase gene: picking color in screening culture medium is the clone of black, being inoculated into 10mL contains in the LB substratum of 100 μ g/mLAmp, 0.5mMIPTG, 37 DEG C, 180r/min incubated overnight, 6000 × g, centrifugal 5min collects thalline, phosphate buffered saline buffer (100mM, pH7.0) thalline is washed once, collected by centrifugation thalline, phosphate buffered saline buffer Eddy diffusion thalline, ultrasonic disruption thalline, collected by centrifugation supernatant carries out the detection of enzymic activity as crude enzyme liquid; Get 100 μ L crude enzyme liquids and 100 μ l10mM p-nitrophenyl-β-D-Glucose glycosides, place 20min for 37 DEG C, pNPG solution can be made yellow to be positive colony from colourless becoming, obtain a sub-pUC118-1-1 of positive colony by screening;

The plasmid of positive colony is sent to order-checking company check order, sequencing result shows, and the nucleotide sequence of beta-glucosidase gene is by 972 based compositions, and its nucleotide sequence is as shown in SEQIDNO.1.

Further, in step 4, the beta-glucosidase gene obtained is cloned, is expressed, obtain beta-glucosidase recombinant protein and be specially:

4.1), the clone of gene fragment: according to sequencing result design primer: Glu1 and Glu2, NcoI and the XhoI restriction enzyme site that can insert pET-28a (+) carrier is introduced at primer two ends, and primer sequence is as follows:

Glu1:5 ' ATGGCGGCCATTTACGGTCGGCATAT ' 3, its sequence is as shown in SEQIDNO.3;

Glu2:3 ' CTACCACGTCATCTTCAATCCCAACT ' 5, its sequence is as shown in SEQIDNO.4;

Utilize two primers, with plasmid pUC118-1-1 for template carries out pcr amplification reaction, PCR program is 98 DEG C, 4mim, 98 DEG C, 30s; 56 DEG C of 30s; 72 DEG C, 30s; 25cycles, 72 DEG C, 10min; PCR primer is with using NcoI and XhoI double digestion 14h after PCR primer Purification Kit, connect with through same pET-28a (+) (Invitrogen) expression vector processed, Transformed E scherichiacoliBL21 (DE3), conversion fluid is coated on the LB solid medium of 50 μ g/mL containing kantlex, 37 DEG C of overnight incubation, random picking 10 strain list colony inoculation extracts plasmid DNA, after double digestion checking, delivers order-checking;

4.2), to recombinate the acquisition of beta-glucosidase Glu417 crude enzyme liquid and restructuring beta-glucosidase: will containing the bacterial strain line through sequence verification correct plasmid to containing in the LB solid medium of 50 μ g/mL kantlex, 37 DEG C of overnight incubation, random picking recombinant bacterium is seeded in the LB liquid nutrient medium containing 50 μ g/mL kantlex, 37 DEG C, 180r/min shaking table overnight incubation, by the inoculum size of 1:100 be forwarded to 50mL containing 50 μ g/mL kantlex LB liquid nutrient medium in, when growing to OD ₆₀₀iPTG is added to final concentration 0.3mM, 37 DEG C, 200r/min cultivates 15 hours, 14 when=0.6, the centrifugal 5min of 000 × g, abandons supernatant, thalline is resuspended in 50mL, in the phosphate buffered saline buffer of 0.1M, pH8.0, use sonicator smudge cells, 4 DEG C, 12, the centrifugal 20min of 000 × g, collect supernatant, obtain big and heavy histone, its nucleotide sequence is as shown in SEQIDNO.2.

The invention has the beneficial effects as follows:

1) the present invention screens a beta-glucosidase gene from the grand genomic library of the Caulis Sacchari sinensis leaf gone mouldy, by genetic engineering technique to its functional study, find that this gene can at solution expression with high efficiency in EscherichiacoliBL21 (DE3), SDS-PAGE electrophoretic analysis determines that the molecular weight of this enzyme is 35.9kDa.

2) DNA sequence dna shown in SEQIDNO.1 is cloned on prokaryotic expression carrier by the present invention, and proceeds in EscherichiacoliBL21 (DE3) competent cell, and obtain recombinant protein by abduction delivering, study its zymologic property, result is as follows:

The first, in escherichia coli expression body, this recombinant protein has solution expression with high efficiency.

The second, with p-nitrophenyl-β-D-Glucose glycosides for substrate, the optimal reactive temperature recording recombinant protein is 35 DEG C; Optimal reaction pH is 8.0, in the scope of pH4.0-11.0, keep good stability; The enzyme activity of glucose to recombinase of lower concentration has promoter action, and the glucose of high density does not significantly affect the enzyme activity of enzyme, and the suppression constant Ki of glucose is 1.38M; Recombinase shows stronger tolerance to ethanol, the enzyme activity of ethanol on enzyme of lower concentration does not significantly affect, as alcohol concn be 5% and 10% time, the residual enzyme vigor of enzyme is respectively 98% and 91%, when alcohol concn reaches 30%, recombinase still keeps the residual enzyme vigor of 47%; The enzyme activity of NaCl to enzyme of lower concentration has promoter action, and the enzyme activity of NaCl on recombinase of high density does not significantly affect, and NaCl concentration reaches 2.5M, still has the enzyme activity of 76%.

Accompanying drawing explanation

Fig. 1 is the SDS-PAGE electrophorogram in the embodiment of the present invention 1; Wherein, M is standard protein molecular weight Maker, and 1 is that 2 is recombinant protein crude extract not containing the protein crude extract administration of recombinant plasmid;

Fig. 2 is the effect diagram of temperature to restructuring beta-glucosidase enzymic activity;

Fig. 3 is the effect diagram of temperature to restructuring beta-glucosidase stability;

Fig. 4 is the effect diagram of pH to restructuring beta-glucosidase enzymic activity;

Fig. 5 is the effect diagram of pH to restructuring beta-glucosidase stability;

Fig. 6 is the effect diagram of glucose concn to restructuring beta-glucosidase enzymic activity;

Fig. 7 is that alcohol concn is to restructuring beta-glucosidase enzymic activity effect diagram;

Fig. 8 is that NaCl is to restructuring beta-glucosidase enzymic activity effect diagram.

Embodiment

Below in conjunction with embodiment, the present invention is described in detail.

The foundation of the grand genomic library of embodiment 1 and the acquisition of positive colony, gene cloning and expression

1) extraction of molded sugar cane leaf microorganism macro genome DNA: collect the Caulis Sacchari sinensis leaf 10g gone mouldy, and cut to 1-3cm length, put into 250ml triangular flask.Add enrichment culture liquid (g/L: Xylo-Mucine, 5; NaNO ₃, 2; K ₂pO ₃, 1; KCl, 0.5; MgSO ₄, 0.5; FeSO ₄, 0.01.) and 100ml, 72h is cultivated in 30 DEG C of concussions.Collected by centrifugation thalline, thalline is resuspended in 1.35mlDNA extracting buffer (100mMTris-HCl [pH8.0], 100mMEDTA-Na ₂[pH8.0], 100mM phosphoric acid buffer [pH8.0], 1.5MNaCl, 1%CTAB), add 0.15ml20%SDS after mixing, 65 DEG C of water-bath 2h, period turns upside down 10 times and liquid nitrogen freezing 2min every 20min; The centrifugal 10min of 6000g, collects supernatant, the chloroform of v such as to add, mixing of turning upside down; The centrifugal 10min of 6000g, collects supernatant, adds the Virahol of 0.6v, precipitation at room temperature 2h; The centrifugal 20min of 16000g, abandons supernatant, after precipitating the washing with alcohol twice with 75%, uses ddH ₂o dissolves, and obtains crude extract.

2) grand genome electrophoresis detection: the size detecting DNA fragmentation with 1% agarose gel electrophoresis.

3) detection of macro genome DNA concentration: the concentration and the purity that detect DNA with nucleic acid electrophoresis detector.Result is as shown in table 1, compared with By Direct Pyrolysis process, sample through pre-treatment enrichment culture, and adds the treatment steps such as liquid nitrogen freezing cracking in cracking process, the macro genome DNA concentration obtained is apparently higher than untreated sample, and the former concentration is about 2 times of the latter.

Table 1 slightly puies forward the quantitative of DNA and purity detecting

4) RNA isolation kit purify DNA: reclaim test kit specification sheets according to glue and carry out.

5) enzyme cuts genome DNA: with the partially digested STb gene of restriction enzyme BamHI, reclaim the endonuclease bamhi of 3-10kb, method is with RNA isolation kit purify DNA.

6) electrophoresis detection of endonuclease bamhi: method is with grand genome electrophoresis detection.

7) structure of cloning vector and conversion: to be connected with pUC118/BamHI (BAP) carrier to spend the night reclaiming the endonuclease bamhi that obtains, connect after product PCR primer purification kit carries out purifying and mix with Electroporation-competent cells, place 5min on ice, transfer DNA/cell mixture is in the 2mm electroporation container of precooling, pulse (2 is carried out to electroporation container, 500V), add the LB of 900 μ l immediately in electroporation container, 37 DEG C of C, 180r/min, 30min is cultivated in concussion, converted product is applied to containing 100 μ g/ml penbritins (Amp), on the flat board of 0.5mM IPTG pyranoside (IPTG) and the chloro-3-indoles of the 100 bromo-4-of μ Μ 5--β-D-galactoside, flat board is inverted in 37 DEG C of incubators, cultivate 15-18h.Construct a storage capacity thus and reach 100000 transformants, grand genomic library that diversity is good.

8) screening of grand genomic library and the qualification of positive colony.

A: the screening of beta-glucosidase gene

Overnight culture is copied to screening (peptone 10g/l, yeast powder 5g/l, NaCl10g/l, Vitamin C2 1g/l, citric acid high ferro ammonium 2.5g/l) on flat board (containing 100 μ g/mlAmp and 0.5mMIPTG), cultivate 72h, select the clone that color is black for 37 DEG C.

B: the final election of beta-glucosidase gene

The clone of picking black in screening culture medium, being inoculated into 10mL contains in the LB substratum of 100 μ g/mLAmp, 0.5mMIPTG, 37 DEG C, 180r/min incubated overnight, 6000 × g, centrifugal 5min collects thalline, and phosphate buffered saline buffer (100mM, pH7.0) washs thalline once, collected by centrifugation thalline, phosphate buffered saline buffer Eddy diffusion thalline, ultrasonic disruption thalline, collected by centrifugation supernatant is as the detection of crude enzyme liquid enzymic activity.Get 100 μ l crude enzyme liquids and 100 μ l10mM p-nitrophenyl-β-D-Glucose glycosides (pNPG), place 20min for 37 DEG C, pNPG solution can be made yellow to be positive colony from colourless becoming, to obtain positive colony (pUC118-1-1) by screening.

The plasmid of positive colony is sent to order-checking company check order, sequencing result shows, the nucleotide sequence of beta-glucosidase gene is by 972 based compositions, its nucleotide sequence is as shown in such as SEQIDNO.1, the polypeptide of this DNA encoding, containing 324 amino acid, its aminoacid sequence as shown in SEQIDNO.2, by its called after Glu417.

9) clone of gene fragment: according to sequencing result design primer: Glu1 and Glu2, NcoI and the XhoI restriction enzyme site that can insert pET-28a (+) carrier is introduced at primer two ends, and primer sequence is as follows:

Glu1:5 ' ATGGCGGCCATTTACGGTCGGCATAT ' 3, its nucleotide sequence is as shown in SEQIDNO.3;

Glu2:3 ' CTACCACGTCATCTTCAATCCCAACT ' 5, its nucleotide sequence is as shown in SEQIDNO.4;

Utilize two primers, with plasmid pUC118-1-1 for template carries out pcr amplification reaction, PCR program is 98 DEG C, 4mim, 98 DEG C, 30s; 56 DEG C of 30s; 72 DEG C, 30s; 25cycles, 72 DEG C, 10min.PCR primer is with using NcoI and XhoI double digestion 14h after PCR primer Purification Kit, connect with through same pET-28a (+) (Invitrogen) expression vector processed, Transformed E scherichiacoliBL21 (DE3), conversion fluid is coated on the LB solid medium containing kantlex (50 μ g/mL), 37 DEG C of overnight incubation, random picking 10 strain list colony inoculation extracts plasmid DNA, after double digestion checking, delivers order-checking.

10) to recombinate the acquisition of beta-glucosidase Glu417 crude enzyme liquid and molecular weight detection

Extremely contain containing the bacterial strain line through sequence verification correct plasmid in the LB solid medium of kantlex (50 μ g/mL), 37 DEG C of overnight incubation, random picking recombinant bacterium is seeded in the LB liquid nutrient medium containing kantlex (50 μ g/mL), 37 DEG C, 180r/min shaking table overnight incubation, by the inoculum size of 1:100 be forwarded to 50mL containing kantlex (50 μ g/mL) LB liquid nutrient medium in, when growing to OD ₆₀₀iPTG is added to final concentration 0.3mM, 37 DEG C, 200r/min cultivates 15 hours, 14 when=0.6, the centrifugal 5min of 000 × g, abandons supernatant, thalline is resuspended in 50mL, in the phosphate buffered saline buffer (pH8.0) of 0.1M, with sonicator (Sonics company) smudge cells, 4 DEG C, 12, the centrifugal 20min of 000 × g, collect supernatant, obtain big and heavy histone, its nucleotide sequence is as shown in SEQIDNO.2.

The crude enzyme liquid of acquisition is carried out SDS-PAGE gel electrophoresis analysis, SDS-PAGE electrophoresis result shows, polypeptide described in SEQIDNO.1 coded by nucleotide sequence obtains high expression in EscherichiacoliBL21 (DE3), and all recombinant proteins are all solvable, formed without inclusion body, the molecular size range of SDS-PAGE electrophoresis detection recombinant protein Glu417 is about 35.9kDa.(as shown in Figure 1).

Embodiment 2 is recombinated the zymology Quality Research of beta-glucosidase

Get 100 μ l crude enzyme liquids, add 100 μ lpNPG, 35 DEG C of water-bath 15min, add 100 μ l0.5MNa2CO ₃, contrast with the crude enzyme liquid of deactivation simultaneously, absorb in the light-metering of 405nm place.

1) to recombinate the optimal reactive temperature of beta-glucosidase Glu417 and temperature stability

Be measure its enzymic activity as stated above under the condition of 20-60 DEG C in temperature of reaction, obtain its optimal reactive temperature (being designated as 100% time the highest with enzyme activity).25,30,35,40,45,50,55,60 and 65 DEG C of insulation 2h, 35 DEG C measure residual enzyme and live, obtain the thermostability of enzyme.As shown in Figures 2 and 3, the optimal reactive temperature of Glu417 is 35 DEG C to result, and when temperature is lower than 35 DEG C, Glu417 is stable, and along with the rising of temperature, the stability of Glu417 reduces gradually, under 55 DEG C of conditions, process 2h, and the relative activity of enzyme is lower than 30%.

2) to recombinate the optimal reaction pH of beta-glucosidase and pH stability

In pH6.0-10.5 damping fluid, measure its enzymic activity as stated above respectively, obtain its optimal reaction pH (being designated as 100% time the highest with enzyme activity).At room temperature condition, by enzyme liquid pH4.0,5.0,6.0,7.0,8.0,9.0, preserve 2h in the damping fluid of 10.0 and 11.0,35 DEG C measure residual enzymes and live, obtain the pH stability of enzyme.As shown in Figures 4 and 5, the optimal reaction pH of Glu417 is 8.0 to result.Glu417 keeps high stability in the scope of pH4.0-11.0.

3) glucose concn is on the impact of beta-glucosidase enzymic activity

In enzyme liquid, add glucose makes its final concentration be respectively 0.5,1.0,1.5, and 2.0 and 2.5M, room temperature places 2h, then surveys enzyme activity at the standard conditions, not add the enzyme liquid vigor of glucose for 100%.As shown in Figure 6, the enzyme activity of glucose to Glu417 of lower concentration has promoter action to result, and the glucose of high density does not significantly affect the enzyme activity of Glu417, and the suppression constant Ki of glucose is 1.38M.

4) ethanol is on the impact of beta-glucosidase enzymic activity

In enzyme liquid, add dehydrated alcohol makes its final concentration be respectively 5%, 10%, 20%, 30% and 50%, room temperature places 2h, then enzyme activity is surveyed at the standard conditions, not add the enzyme liquid vigor of ethanol for 100%, as shown in Figure 7, the enzyme activity of ethanol on Glu417 of lower concentration does not significantly affect result, when alcohol concn is 5% and 10%, the residual enzyme vigor of Glu417 is respectively 98% and 91%, and along with the raising of alcohol concn, the enzyme activity of Glu417 reduces gradually, when alcohol concn reaches 30%, the residual enzyme vigor of Glu417 is 47%.

5) NaCl is on the impact of beta-glucosidase enzymic activity

In enzyme liquid, add NaCl makes its final concentration be 0.5M, 1M, 1.5M, 2M and 2.5M, and room temperature places 2h, then surveys enzyme activity at the standard conditions, not add the vigor of the enzyme liquid of NaCl for 100%.As depicted in figure 8, the enzyme activity of NaCl to Glu417 of lower concentration has promoter action to result, and the enzyme activity of NaCl on Glu417 of high density does not significantly affect, and NaCl concentration reaches 2.5M, and Glu417 still has the enzyme activity of 76%.

Claims (8)

1. a beta-glucosidase gene, is characterized in that, its nucleotide sequence is as shown in SEQIDNO.1.

2. a restructuring beta-glucosidase, it is characterized in that, its aminoacid sequence is as shown in SEQIDNO.2.

3. to recombinate the screening method of beta-glucosidase, it is characterized in that, comprise the following steps:

1), the extraction of molded sugar cane leaf microorganism macro genome DNA: collect the Caulis Sacchari sinensis leaf 10g gone mouldy, and cut to 1-3cm length, put into 250ml triangular flask; Add enrichment culture liquid, 72h is cultivated in 30 DEG C of concussions; Collected by centrifugation thalline, thalline is resuspended in 1.35mlDNA extracting buffer, adds 0.15ml20%SDS after mixing, 65 DEG C of water-bath 2h, and period turns upside down 10 times and liquid nitrogen freezing 2min every 20min; The centrifugal 10min of 6000g, collects supernatant, the chloroform of v such as to add, mixing of turning upside down; The centrifugal 10min of 6000g, collects supernatant, adds the Virahol of 0.6v, precipitation at room temperature 2h; The centrifugal 20min of 16000g, abandons supernatant, after precipitating the washing with alcohol twice with 75%, uses ddH ₂o dissolves, and obtains crude extract;

2), grand genomic library is built: the size detecting DNA fragmentation with 1% agarose gel electrophoresis, concentration and the purity of DNA is detected with nucleic acid electrophoresis detector, purifying is carried out to DNA, and with the partially digested STb gene of restriction enzyme BamHI, reclaims the endonuclease bamhi of 3-10kb; Build grand genomic library;

3), from grand genomic library filter out beta-glucosidase gene, its nucleotide sequence is as shown in SEQIDNO.1;

4), to the beta-glucosidase gene obtained clone, express, obtain beta-glucosidase recombinant protein, its aminoacid sequence is as shown in SEQIDNO.2.

4. the screening method of restructuring beta-glucosidase according to claim 3, is characterized in that, described step 1) in enrichment culture liquid comprise following component: Xylo-Mucine 5g/L; NaNO ₃2g/L; K ₂pO ₃1g/L; KCl0.5g/L; MgSO ₄0.5g/L; FeSO ₄0.01g/L, surplus is water, and above total amount is 100ml.

5. the screening method of restructuring beta-glucosidase according to claim 3, is characterized in that, described step 1) in DNA extracting buffer comprise following component: 100mMTris-HCl, 100mMEDTA-Na ₂, 100mM phosphoric acid buffer, 1.5MNaCl, 1%CTAB, above component total amount is 1.35ml, and wherein, the pH of Tris-HCl is 8.0, EDTA-Na ₂pH be 8.0, the pH of phosphoric acid buffer is 8.0.

6. the screening method of restructuring beta-glucosidase according to claim 3, it is characterized in that, described step 2) in build grand genomic library and be specially: to be connected with pUC118/BamHI (BAP) carrier to spend the night reclaiming the endonuclease bamhi that obtains, connect after product PCR primer purification kit carries out purifying and mix with Electroporation-competent cells, place 5min on ice, transfer DNA/cell mixture is in the 2mm electroporation container of precooling, be 2 at voltage, under the condition of 500V, pulse is carried out to electroporation container, add the LB of 900 μ l immediately in electroporation container, 37 DEG C, 180r/min, 30min is cultivated in concussion, converted product is applied to containing 100 μ g/ml penbritins, on the flat board of 0.5mM IPTG pyranoside and the chloro-3-indoles of the 100 bromo-4-of μ Μ 5--β-D-galactoside, flat board is inverted in 37 DEG C of incubators, cultivate 15-18h, build storage capacity thus and reach 100000 transformants, grand genomic library that diversity is good.

7. the screening method of restructuring beta-glucosidase according to claim 3, is characterized in that, described step 3) in from grand genomic library, filter out beta-glucosidase gene be specially:

3.1) screening of beta-glucosidase gene: overnight culture is copied on screening flat board, cultivate 72h for 37 DEG C, select the clone that color is black, wherein, screening flat board is: peptone 10g/l, yeast powder 5g/l, NaCl10g/l, Vitamin C2 1g/l, citric acid high ferro ammonium 2.5g/l, 100 μ g/mlAmp and 0.5mMIPTG;

3.2) final election of beta-glucosidase gene: the black clone of picking in screening culture medium, being inoculated into 10mL contains in the LB substratum of 100 μ g/mLAmp, 0.5mMIPTG, 37 DEG C, 180r/min incubated overnight, 6000 × g, centrifugal 5min collects thalline, and phosphate buffered saline buffer (100mM, pH7.0) washs thalline once, collected by centrifugation thalline, phosphate buffered saline buffer Eddy diffusion thalline, ultrasonic disruption thalline, collected by centrifugation supernatant is as the detection of crude enzyme liquid enzymic activity; Get 100 μ L crude enzyme liquids and 100 μ l10mM p-nitrophenyl-β-D-Glucose glycosides, place 20min for 37 DEG C, pNPG solution can be made yellow to be positive colony from colourless becoming, obtain a sub-pUC118-1-1 of positive colony by screening;

The plasmid of positive colony is sent to order-checking company check order, sequencing result shows, and the nucleotide sequence of beta-glucosidase gene is by 972 based compositions, and its nucleotide sequence is as shown in SEQIDNO.1.

8. the screening method of restructuring beta-glucosidase according to claim 3, is characterized in that, clones, expresses, obtain beta-glucosidase recombinant protein and be specially in described step 4 to the beta-glucosidase gene obtained:

4.1), the clone of gene fragment: according to sequencing result design primer: Glu1 and Glu2, NcoI and the XhoI restriction enzyme site that can insert pET-28a (+) carrier is introduced at primer two ends, and primer sequence is as follows:

Glu1:5 ' ATGGCGGCCATTTACGGTCGGCATAT ' 3, its sequence is as shown in SEQIDNO.3;

Glu2:3 ' CTACCACGTCATCTTCAATCCCAACT ' 5, its sequence is as shown in SEQIDNO.4;

Utilize two primers, with plasmid pUC118-1-1 for template carries out pcr amplification reaction, PCR program is 98 DEG C, 4mim, 98 DEG C, 30s; 56 DEG C of 30s; 72 DEG C, 30s; 25cycles, 72 DEG C, 10min; PCR primer is with using NcoI and XhoI double digestion 14h after PCR primer Purification Kit, connect with through same pET-28a (+) (Invitrogen) expression vector processed, Transformed E scherichiacoliBL21 (DE3), conversion fluid is coated on the LB solid medium of 50 μ g/mL containing kantlex, 37 DEG C of overnight incubation, random picking 10 strain list colony inoculation extracts plasmid DNA, after double digestion checking, delivers order-checking;

4.2), to recombinate the acquisition of beta-glucosidase Glu417 crude enzyme liquid and restructuring beta-glucosidase: will containing the bacterial strain line through sequence verification correct plasmid to containing in the LB solid medium of 50 μ g/mL kantlex, 37 DEG C of overnight incubation, random picking recombinant bacterium is seeded in the LB liquid nutrient medium containing 50 μ g/mL kantlex, 37 DEG C, 180r/min shaking table overnight incubation, by the inoculum size of 1:100 be forwarded to 50mL containing 50 μ g/mL kantlex LB liquid nutrient medium in, when growing to OD ₆₀₀iPTG is added to final concentration 0.3mM, 37 DEG C, 200r/min cultivates 15 hours, 14 when=0.6, the centrifugal 5min of 000 × g, abandons supernatant, thalline is resuspended in 50mL, in the phosphate buffered saline buffer of 0.1M, pH8.0, use sonicator smudge cells, 4 DEG C, 12, the centrifugal 20min of 000 × g, collect supernatant, obtain big and heavy histone, its nucleotide sequence is as shown in SEQIDNO.2.