CN104877979A

CN104877979A - Metagenome-derived beta-mannanase, and encoding gene and expression thereof

Info

Publication number: CN104877979A
Application number: CN201410072258.2A
Authority: CN
Inventors: 周志华; 邹根; 魏勇军; 严兴
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences
Priority date: 2014-02-28
Filing date: 2014-02-28
Publication date: 2015-09-02
Anticipated expiration: 2034-02-28
Also published as: CN104877979B

Abstract

The invention relates to a metagenome-derived beta-mannanase, and an encoding gene and an expression thereof. A beta-mannanase gene is cloned from a biogas slurry metagenome library by the inventor, a protein encoding the gene can well hydrolyze a glycosidic bond in an incision mode, and the gene can be highly expressed in various hosts. The beta-mannanase has good stability and high activity under neutral-weak acidic conditions, and can be well applied in industrial production.

Description

A kind of 'beta '-mannase of first genomic source, its encoding gene and expression thereof

Technical field

The invention belongs to biological technical field; More specifically, the present invention relates to a kind of originated from fungus 'beta '-mannase, its encoding gene and efficient heterogenous expression thereof.

Background technology

'beta '-mannase (mannan endo-β-Isosorbide-5-Nitrae-mannosidase; EC3.2.1.78) be the enzyme of main chain β-Isosorbide-5-Nitrae-D-mannopyrane glycosidic link of class degraded mannosans, glucomannan, polygalactomannan and a gala glucomannan, it belongs to a kind of hemicellulase, has purposes widely.Now be mainly used in both at home and abroad the bleaching of paper industry paper pulp, the broken glue of oil well, degrading plant glue produces oligose and be used as bifidus bacillus somatomedin, as antinutritional factor in the protective foods that anti-disease, anti-aging is old and fodder industry.

'beta '-mannase brief introduction.'beta '-mannase is a kind of hydrolysis of hemicellulose enzyme, and to degrade β-Isosorbide-5-Nitrae-glycosidic link in the mode of inscribe, the non-reducing end of degraded product is seminose.In hemicellulose, the content of mannosans is only second to xylan, and a large amount of accumulation as starch in many plants, and such as, mannosans is mass storage in the plants such as coconut, palm, Gua Erdou, acacia, red Chinese scholartree, konjaku.'beta '-mannase is mainly derived from the microorganisms such as bacterium, actinomycetes, fungi.Most animals (mammals, birds, fish etc.) then can not synthesize this enzyme, once the microorganism of animal digestive tract can not secrete enough mannases to the mannosans of degrading in food, the water combination that mannosans is easy and a large amount of, the stickiness of chyme is increased, thus easily reduces digestive tube to the absorption of nutrition.And the manna oligosaccharide that mannosans enzyme liberating mannosans produces is a kind of biological chemistry probiotics, enteric microorganism composition can be improved, the intestinal microflora that to be formed with bifidus bacillus and milk-acid bacteria be advantage.This is because manna oligosaccharide can be utilized by bifidus bacillus and milk-acid bacteria selective fermentation as nutritive substance, and promotes its growth and breeding, and the pathogenic bacterium such as intestinal bacteria, Salmonellas then cannot utilize and cause hungry dead.In addition; manna oligosaccharide can also in conjunction with the acceptor on pathogenic bacteria cell walls; thus stop the glycosyl on pathogenic bacteria and intestinal mucosa to combine; protect the complete of the structure and function of alimentary canal mucous membrane; manna oligosaccharide can also combine with toxin; alleviate the absorption of these antigens, the cellular immunization of enhancing body and humoral immunization.Manna oligosaccharide is Non-digestible material, and this mixture can be excreted by digestive tube smoothly, therefore with health role.Manna oligosaccharide not only participates in immunomodulatory directly, partly can also replace microbiotic, plays the effect reducing body tissue antibiotic remains.

The application of 'beta '-mannase.'beta '-mannase and manna oligosaccharide can be widely used in the industrial circles such as food, medical treatment, feed, weaving, oil, if manna oligosaccharide is one of the most effective two qi factor, can be oral, and be widely used for both at home and abroad in healthcare products.'beta '-mannase also can be used for carrying vegetables oil from bean, reduces the viscosity of coffee, chocolate, cocoa liq-uor.β-Gan glycanase and zytase synergy can be used for paper industry.The gel breaker that 'beta '-mannase also can be used as petroleum fracturing liquid has the advantages such as effect is high, cost is low, formation injury is little.Particularly this enzyme of profit is hydrolyzed konjaku to prepare highly purified seminose, and its city's prospect is very wide.The mountain area that konjaku as raw materials for production divides in Sichuan widely, Yunnan, Guizhou, West of Hubei Province etc. are less-developed, the scale operation of enzyme also has for supporting the poor areas with technology and important pushes away effect.And most critical is mannase is added in feed, except increasing zootrophic specific absorption and resistibility, it can also promote the secretion of quasi-insulin growthing factor I GF-1, promote the synthesis of protein, improve lean ratio, surmount the effect of traditional zymin, become a kind of novel feed additive for promoting growth.Thus, in recent years study hotspot both domestic and external has been become gradually to the research of mannase.But domestic each research about R&D institution is limited to laboratory stage mostly, the fermenting enzyme reported enzymolysis product alive composition is unstable, and production cost is higher, is difficult to seize competitive advantage.Screen high specific activity enzyme gene, using gene engineering technique builds the efficient microorganism producing enzyme, carries out the proterties of molecular breeding modified enzyme, optimizes the enzyme-squash techniqued technique of manna oligosaccharide, be international study hotspot and direction, also there is good scientific meaning and application prospect.

The production of 'beta '-mannase.The research of 'beta '-mannase production method relates to recombinant expressed, characteristic research, the aspect such as gene clone and production purifying of enzyme.1958, people reported the fungi that can produce 'beta '-mannase first time.Screened, the mutagenesis of the production bacterial strain of a large amount of 'beta '-mannase afterwards.In China, Chinese Academy of Sciences Ma Yan and etc. utilize Alkaliphilic bacillus N16-5 to take Rhizoma amorphophalli powder as raw material, fermentative production 'beta '-mannase, fermentation broth enzyme vigor reaches 150U/ml, extract yield (microorganism journal more than 80% of manna oligosaccharide, 1991,31 (6): 443 ~ 448).Although 'beta '-mannase is extensively present in microbe, more and more research finds, the 'beta '-mannase enzymatic properties in prokaryotic micro-organisms source than eukaryotic microorganisms originate excellent.Although the matrix that microorganism produces 'beta '-mannase is not identical, the 'beta '-mannase of most microorganism is all the outer inducible enzymes of born of the same parents, needs to add beta-mannase (Rhizoma amorphophalli powder or red locust bean gum etc.) in the medium.Along with the widespread use of genetically engineered and protein engineering, the research work of 'beta '-mannase more and more concentrates on gene clone, the research such as active engineering of recombinant expressed and enzyme comes up.

Therefore, this area awaits utilizing genetically engineered and protein engineering, identifies 'beta '-mannase that is new, excellent effect further.

Summary of the invention

The object of the present invention is to provide high expression in intestinal bacteria and Trichodermareesei of a kind of 'beta '-mannase (ManI) and its encoding gene (man1) and application; The invention still further relates to the mutant of this enzyme; The invention still further relates to the expression vector containing described encoding gene and encoding gene thereof, promoter sequence, auxiliary sequencel and host cell; The invention still further relates to the recombinant bacterium and mutant thereof of expressing encoding gene, the invention still further relates to the method utilizing described beta-mannase enzyme liberating glucomannan, polygalactomannan, gala glucomannan, mannosans to produce manna oligosaccharide and seminose.

In a first aspect of the present invention, provide a kind of isolated polypeptide, this polypeptide is selected from lower group:

(a) polypeptide as shown in SEQ ID NO:3;

B () has the polypeptide of the aminoacid sequence shown in 14-317 position in SEQ ID NO:2;

(c) by the aminoacid sequence of (a) or (b) polypeptide through one or more (as 1-20, preferably 1-10; More preferably 1-5; More preferably 1-3) replacement of amino-acid residue, disappearance or interpolation form, and have the polypeptide derivative by (a) of (a) polypeptide function;

D () has the protein fragments of the SEQ ID NO:3 of (a) or (b) polypeptide function (preferably, the sequence thereto of itself and SEQID NO:2 is higher than 70%; More preferably higher than 75%; More preferably higher than 80%; More preferably higher than 85%; More preferably higher than 90%; More preferably higher than 95%; More preferably higher than 98% or 99%);

E () has sequence label at the N of (a) or (b) polypeptide or C-terminal, or have the polypeptide of signal peptide sequence at its N-terminal.

In another aspect of this invention, provide a kind of polynucleotide of separation, it comprises a nucleotide sequence, and this nucleotide sequence is selected from lower group: the polynucleotide of (1) coding said polypeptide; (2) complementary with polynucleotide (1) polynucleotide.

In a preference, the nucleotide sequence of these polynucleotide is as shown in SEQ ID NO:1 or SEQ ID NO:2.

In another aspect of this invention, provide a kind of carrier, it is characterized in that, it contains described polynucleotide.

In another preference, described carrier is carrier for expression of eukaryon.

In another preference, described carrier is trichoderma reesei expression carrier, such as pHDt/sk.

In another aspect of this invention, provide a kind of genetically engineered host cell, it contains described carrier, or is integrated with described polynucleotide in its genome.

In a preference, described host cell is prokaryotic cell prokaryocyte or eukaryotic cell; Be preferably filamentous fungal cells (as Trichodermareesei etc.).

In another preference, described host cell is non-germ cells.

In another preference, described host cell is eukaryotic cell.

In another preference, described host cell is Trichodermareesei.

In another aspect of this invention, provide a kind of preparation method of described polypeptide, the method comprises: the host cell described in (i) cultivation; (ii) culture containing described polypeptide is collected; (iii) from culture, described polypeptide is isolated.

In another aspect of this invention, the purposes of the culture of described polypeptide or described host cell is provided, for hydrolyzing glucosidic bonds; It is preferably β-Isosorbide-5-Nitrae-D-glycosidic link; Or for the formation of manna oligosaccharide.

In another aspect of this invention, provide a kind of composition, it contains described polypeptide or contains culture and medical science, bromatology, feed or the industrial acceptable carrier of described host cell.

In another aspect of this invention, a kind of method of hydrolyzing glucosidic bonds or formation manna oligosaccharide is provided, the method comprises: with the substrate that described polypeptide process is to be hydrolyzed, described substrate is selected from: glucomannan, polygalactomannan, gala glucomannan, mannosans, konjaku, red locust bean gum or their mixture.

In a preference, under pH4.5-8.0 condition, with the substrate that described polypeptide process is to be hydrolyzed; Preferably pH is 5.0-7.5; More preferably pH is 5.5-7.5 (as 6.0,6.5,7.0).

In another preference, under temperature 40-75 DEG C of condition, with the substrate that described polypeptide process is to be hydrolyzed; Preferably temperature is 45-70 DEG C; More preferably temperature is 50-65 DEG C.

In another aspect of this invention, provide the purposes of described polypeptide, described purposes includes, but is not limited to:

(1) for hydrolyzing glucosidic bonds; Preferably be hydrolyzed β-Isosorbide-5-Nitrae-D-glycosidic link;

(2) polysaccharide (as glucomannan, polygalactomannan, galactoglucomannan, mannosans etc.) containing β-Isosorbide-5-Nitrae-D-glycosidic link for being hydrolyzed main chain produces manna oligosaccharide;

(3) for hydrolysis of lignocellulose;

(4) for as fodder additives; Or

(5) for as foodstuff additive.

Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.

Accompanying drawing explanation

Fig. 1, the recombination bacillus coli genome electrophorogram after checking primer PCR.The electrophoresis result (fragment is 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp from top to bottom successively) of swimming lane M to be Marker the be DL2000 of Takara in figure, the swimming lane 1-5 electrophorogram that to be 5 intestinal bacteria ManI positive colony DNA be after template amplification man1 gene.

The expression of Fig. 2, man1 gene, the purifying SDS-PAGE of expression product scheme.Wherein, swimming lane 1 be albumen Marker electrophoresis result (band from top to bottom represents 97.2 successively, 66.4,44.3,29.0,20.1kDa), swimming lane 2 be Escherichia coli bacteria liquid ultrasonic after lysate; Swimming lane 3 be ultrasonic after lysate precipitation; Swimming lane 4 is lysate supernatant; Swimming lane 5 is 40mM imidazole elution.

The mensuration of Fig. 3, ManI purifying protein optimum condition and stability.

Fig. 3 A, ManI purifying protein enzyme activity curve at different temperatures, 60 DEG C is ManI purifying protein optimal reactive temperature.

The enzyme activity curve of Fig. 3 B, ManI purifying protein under different pH, pH3 ~ 6.0 measure damping fluid to be final concentration are the NaAc of 100mM, and it is final concentration 100mMNa that pH6.0 ~ 8.0 measure damping fluid ₂hPO ₄/ NaH ₂pO ₄; It is final concentration 100mM Tris-HCl that pH8.0 ~ pH9.5 measures damping fluid, and wherein optimal pH is 6.0, and between pH5.0 ~ 8, all have the vigor of more than 50%, and ManI purifying protein reaction pH a wider range is described, the soda acid scope that can adapt to is wider.

Fig. 3 C, ManI purifying protein tolerance detected result at different temperatures, ◆ the enzyme activity at representing 55 DEG C, ■ represents the enzyme activity at 60 DEG C, the enzyme activity at ▲ expression 65 DEG C.

The tolerance detected result of Fig. 3 D, ManI purifying protein under different pH damping fluid, purifying protein ManI measures enzyme activity be incubated 30 minutes at the temperature of 60 DEG C in corresponding pH damping fluid after, at the NaAc of pH3 ~ 6.0 incubation buffer to be final concentration be 100mM, pH6.0 ~ 8.0 incubation buffer is final concentration 100mM Na ₂hPO ₄/ NaH ₂pO ₄; PH8.0 ~ pH9.5 incubation buffer is final concentration 100mM Tris-HCl.

Fig. 4, the Trichodermareesei 'beta '-mannase transformant genome electrophorogram after checking primer PCR.The electrophoresis result (band from top to bottom represents 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp successively) of swimming lane M to be Marker the be DL2000 of Takara in figure, swimming lane A1-A3 is the electrophorogram after 3 Trichodermareesei transformant genomic templates amplification man1 genes.

The SDS-PAGE expressed in Trichodermareesei transformant of Fig. 5, man1 gene schemes.Wherein, swimming lane M be albumen Marker electrophoresis result (band from top to bottom represent successively molecular weight be 97.2,66.4,44.3,29.0,20.1kDa), swimming lane CK is Trichodermareesei wild-type fermented liquid supernatant; Swimming lane A1-A3 is 3 Trichodermareesei transformant fermented liquid supernatant, and arrow indication is beta-mannase zymoprotein position.

Fig. 6, with restructuring ManI albumen or acid treatment 1-11 substrate, observe its effect to substrate.Wherein, the untreated red locust bean gum of 1:1ul and Rhizoma amorphophalli powder mixture; 2:1ul1% glucose; 3:1ul1% seminose; 4:2ul acid treatment Rhizoma amorphophalli powder; 5:2ul ferment treatment Rhizoma amorphophalli powder; 6:2ul acid treatment Rhizoma amorphophalli powder and red locust bean gum blends; 7:2ul ferment treatment Rhizoma amorphophalli powder and red locust bean gum blends; 8:1ul1% semi-lactosi; 9:1ul1% seminose; The red locust bean gum of 10:2ul acid treatment; The red locust bean gum of 11:2ul ferment treatment.

Embodiment

The present inventor has been cloned into a beta-mannase gene from natural pond liquid unit genomic library, through identifying that it can hydrolyzing glucosidic bonds, particularly β-Isosorbide-5-Nitrae-D-mannopyrane glycosidic link well.The present inventor is this gene of high expression in intestinal bacteria and Trichodermareesei also.'beta '-mannase of the present invention is good at neutrality stable under acidic conditions on the weak side, active high, can be applied to industrial production well.

As used herein, term " polypeptide of the present invention ", " albumen of the present invention ", " 'beta '-mannase of the present invention ", " ManI albumen ", " TrManI albumen ", " ManI polypeptide ", " TrManI polypeptide ", " 'beta '-mannase ManI " or " 'beta '-mannase TrManI " are used interchangeably, and all refer to have albumen or the polypeptide of 'beta '-mannase ManI aminoacid sequence (SEQ ID NO:3 or its variant form or derivative).They comprise containing or do not contain the beta-glucosidase ManI of initial methionine.

As used herein, term " gene of the present invention ", " man1 gene ", " man1 ", " Trman1 gene ", " Trman1 " refer to the polynucleotide with beta-mannase coding gene sequence (SEQ ID NO:1, SEQ ID NO:2 or their variant form or derivative).

As used herein, term " intestinal bacteria positive colony of the present invention ", " intestinal bacteria recon of the present invention ", " E. coli transformant of the present invention ", " ManI intestinal bacteria positive colony ", " ManI intestinal bacteria recon " or " ManI E. coli transformant " are used interchangeably, all refer to take intestinal bacteria as host, heterogenous expression 'beta '-mannase ManI aminoacid sequence (SEQ ID NO:3 or its variant form or derivative).

As used herein, term " Trichodermareesei transformant of the present invention ", " Trichodermareesei recon of the present invention ", " TrManI Trichodermareesei recon " or " TrManI Trichodermareesei transformant " are used interchangeably, all refer to take Trichodermareesei as host, heterogenous expression 'beta '-mannase ManI aminoacid sequence (SEQ ID NO:3 or its variant form or derivative).

As used herein, described " seminose " refers to a kind of monose containing six carbon atom.Molecular formula C ₆h ₁₂o ₆.Described " beta-mannase " is the polymer of " β-D type seminose with linearity (1-4)-link ".

As used herein, described " β-Isosorbide-5-Nitrae-D-glycosidic link " includes " β-Isosorbide-5-Nitrae-D-mannopyrane glycosidic link ".

As used herein, " separation " refers to that material is separated from its primal environment (if natural substance, namely primal environment is natural surroundings).As the polynucleotide under the native state in active somatic cell and polypeptide do not have separation and purification, but same polynucleotide or polypeptide as from native state with in other materials existed separately, then for separation and purification.

Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, improvement on synthesis, preferred recombinant polypeptide.Polypeptide of the present invention can be native purified product, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (such as, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to recombinant production scheme, polypeptide of the present invention can be glycosylated, can be maybe nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises the fragment of ManI albumen, derivative and analogue.As used herein, term " fragment ", " derivative " and " analogue " refer to the polypeptide substantially keeping biological function that natural ManI albumen of the present invention is identical or activity.Polypeptide fragment of the present invention, derivative or analogue can be the polypeptide that (i) has one or more conservative or non-conservative amino acid residue (preferred conservative amino acid) and be substituted, and the amino-acid residue of such replacement can may not be and encoded by genetic code, or (ii) has the polypeptide of substituted radical in one or more amino-acid residue, or (iii) mature polypeptide and another compound (such as extend the compound of polypeptide transformation period, such as polyoxyethylene glycol) merge the polypeptide formed, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide formed (as leader sequence or secretion sequence or be used for the sequence of this polypeptide of purifying or proprotein sequence, or with the fusion rotein of the formation of antigen I gG fragment).According to instruction herein, these fragments, derivative and analogue belong to the known scope of those skilled in the art.

In the present invention, term " ManI polypeptide " refers to the polypeptide of the SEQ ID NO:3 sequence with ManI protein-active.This term also comprise have with ManI albumen identical function, the variant form of SEQ ID NO:3 sequence.These variant forms comprise (but being not limited to): one or morely (be generally 1-50, preferably 1-30, more preferably 1-20, more preferably 1-10,1-5 best) amino acid whose disappearance, insertion and/or replacement, and add or disappearance one or several (being generally within 20, is preferably within 10, within being more preferably 5) amino acid at C-terminal and/or N-terminal.Such as, in the art, when replacing with similar nature or similar amino acid, the function of protein can not usually be changed.Such as, to add or disappearance one or several amino acid also can not change the function of protein usually at C-terminal and/or N-terminal; Again such as, only express the catalyst structure domain of this albumen, and do not express carbohydrate binding domain and also can obtain the catalysis same with intact proteins.Therefore this term also comprises active fragments and the reactive derivative of ManI albumen.Such as, variation can occur in outside the conserved functional domains (14-317 position) of SEQ ID NO:3.Variation can be 1-3 aminoacid deletion, replacement and insertion.

The variant form of this polypeptide comprises: homologous sequence, conservative variant, allelic variant, natural mutation, induced mutants, the albumen coded by DNA can hybridized with man1DNA under high or low stringency conditions and the polypeptide utilizing the antibody of anti-ManI polypeptide to obtain or albumen.Present invention also offers other polypeptide, as comprised the fusion rotein of ManI polypeptide or its fragment.Except the polypeptide of almost total length, present invention includes the fragment of ManI polypeptide.Usually, this fragment have ManI peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.

Invention also provides the analogue of ManI albumen or polypeptide.The difference of these analogues and natural ManI polypeptide can be the difference on aminoacid sequence, can be also the difference do not affected on the modified forms of sequence, or have both at the same time.These polypeptide comprise genetic variant that is natural or induction.Induce variation body can be obtained by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also by site-directed mutagenesis or the biological technology of other known moleculars.Analogue also comprises the analogue with the residue (as D-amino acid) being different from natural L-amino acids, and has the analogue of amino acid (as β, gamma-amino acid) that is that non-natural exists or synthesis.Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide exemplified.

(usually the not changing primary structure) form of modification comprises: the chemically derived form of the polypeptide that body is interior or external is as acetylize or carboxylated.Modify and also comprise glycosylation, as carried out glycosylation modified and polypeptide that is that produce in those in the synthesis of polypeptide and processing or further procedure of processing.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) by being exposed to by polypeptide and completing.Modified forms also comprises the sequence with phosphorylated amino acid residue (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Also comprise and modified thus improve its anti-proteolysis performance or optimize the polypeptide of solubility property.

In the present invention, " ManI albumen conservative variation polypeptide " refers to compared with the aminoacid sequence of SEQ ID NO:3, has 20 at the most, preferably at the most 10, more preferably at the most 5, best at the most 3 amino acid replace by the similar or close amino acid of character and form polypeptide.These conservative variation's polypeptide preferably carry out amino acid replacement according to table 1 and produce.

Table 1

Initial residue	Representational replacement	Preferred replacement
			Ala(A)	Val;Leu;Ile	Val
Arg(R)	Lys;Gln;Asn	Lys
			Asn(N)	Gln;His;Lys;Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro;Ala	Ala
			His(H)	Asn;Gln;Lys;Arg	Arg
Ile(I)	Leu;Val;Met;Ala;Phe	Leu
			Leu(L)	Ile;Val;Met;Ala;Phe	Ile
Lys(K)	Arg;Gln;Asn	Arg
			Met(M)	Leu;Phe;Ile	Leu
Phe(F)	Leu;Val;Ile;Ala;Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr;Phe	Tyr
			Tyr(Y)	Trp;Phe;Thr;Ser	Phe
Val(V)	Ile;Leu;Met;Phe;Ala	Leu

The aminoterminal of ManI albumen of the present invention or carboxyl terminal also can contain one or more polypeptide fragment, as protein tag.Any suitable label may be used to the present invention.Such as, described label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out purifying to albumen.Table 2 lists some labels wherein and sequence thereof.

The sequence of table 2, label

In order to make the protein excretion of translation express (as being secreted into extracellular), also can at signal peptide sequences of signal peptide replacement such as the amino amino end pelB of described ManI own.Signal peptide can be cut from intracellular secretory process out at polypeptide.

Polynucleotide of the present invention can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-strand.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can the varient of or degeneracy identical with the coding region sequence shown in SEQ ID NO:1, SEQID NO:2.As used herein, " varient of degeneracy " refers to that coding has the protein of SEQ ID NO:3 in the present invention, but with the differentiated nucleotide sequence of coding region sequence shown in SEQ ID NO:1, SEQ ID NO:2.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:3 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional coding sequence; The encoding sequence (with optional additional coding sequence) of mature polypeptide and non-coding sequence.Term " polynucleotide of coded polypeptide " can be the polynucleotide comprising encoding such peptides, also can be the polynucleotide also comprising additional code and/or non-coding sequence.

The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, the sum analogous to general Dedekind sum of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient of non-natural generation.These nucleotide variants comprise and replace varient, Deletion variants and insertion varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be the replacement of one or more Nucleotide, disappearance or insertion, but can not from the function of polypeptide changing in fact its coding.

The invention still further relates to and above-mentioned sequence hybridization and have at least 50% between two sequences, preferably at least 70%, the more preferably polynucleotide of at least 80% homogeny.The present invention be more particularly directed to polynucleotide interfertile with polynucleotide of the present invention under stringent condition (or high stringency conditions).In the present invention, " stringent condition " refers to: (1) compared with the hybridization under low ionic strength and comparatively high temps and wash-out, as 0.2 × SSC, 0.1%SDS, 60 DEG C; Or be added with denaturing agent during (2) hybridization, and as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 DEG C etc.; Or (3) homogeny only between two sequences, at least more than 90%, is just hybridized when being more preferably more than 95%.Further, the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in SEQ ID NO:3.

The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment ", at least containing 15 Nucleotide, is better at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to be separated the polynucleotide of coding ManI albumen.

Polypeptide in the present invention and polynucleotide preferably provide with the form be separated, and are more preferably purified to homogeneous.

Man1 Nucleotide full length sequence of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the cDNA storehouse prepared by ordinary method well known by persons skilled in the art as template, amplification and relevant sequence.When sequence is longer, usually needs to carry out twice or repeatedly pcr amplification, and then the fragment that each time amplifies is stitched together by proper order.

Once obtain relevant sequence, just relevant sequence can be obtained in large quantity with recombination method.This is normally cloned into carrier, then proceeds to cell, is then separated from the host cell after propagation by ordinary method and obtains relevant sequence.In addition, also relevant sequence can be synthesized by the method for synthetic.

The method of application round pcr DNA amplification/RNA is optimized for and obtains gene of the present invention.When being particularly difficult to obtain the cDNA of total length from library, preferably can use RACE method (RACE-cDNA end rapid amplification), primer for PCR suitably can be selected according to sequence information of the present invention disclosed herein, and using conventional procedures synthesis.Using conventional procedures is as the DNA/RNA fragment increased by gel electrophoresis abstraction and purification.

The present invention also relates to the carrier comprising polynucleotide of the present invention, and with the host cell that carrier of the present invention or ManI albumen coded sequence produce through genetically engineered, and the method for polypeptide of the present invention is produced through recombinant technology.

By the recombinant DNA technology of routine, polynucleotide sequence of the present invention can be utilized express or the ManI polypeptide of Restruction.In general following steps are had:

(1). with the polynucleotide (or varient) of coding ManI polypeptide of the present invention, or transform or suitable host cell of transduceing with the recombinant expression vector containing these polynucleotide;

(2). the host cell cultivated in suitable substratum;

(3). separation, protein purification from substratum or cell.

In the present invention, man1 polynucleotide sequence can be inserted in recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell is viral, mammalian cell is viral as adenovirus, retrovirus or other carriers.As long as can copy in host and stablize, any plasmid and carrier can be used.A key character of expression vector is usually containing replication orgin, promotor, marker gene and translation controlling elements.

Method well-known to those having ordinary skill in the art can be used for building containing ManI DNA sequences encoding and the suitable expression vector of transcribing/translating control signal.These methods comprise recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.Described DNA sequence dna can be effectively connected in the suitable promotor in expression vector, synthesizes to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; Eukaryotic promoter comprise CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus LTRs and some other known can the promotor expressed in protokaryon or eukaryotic cell or its virus of controlling gene.Expression vector also comprises ribosome bind site and the transcription terminator of translation initiation.

In addition, expression vector preferably comprises one or more selected marker, to be provided for the phenotypic character selecting the host cell transformed, as Tetrahydrofolate dehydrogenase, neomycin resistance and green fluorescent protein (GFP) that eukaryotic cell is cultivated, or for colibacillary tsiklomitsin or amicillin resistance.Comprise the carrier of above-mentioned suitable DNA sequence dna and suitably promotor or control sequence, may be used for transforming suitable host cell, with can marking protein.

Host cell can be prokaryotic cell prokaryocyte, as bacterial cell; Or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell is as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast etc. of CHO, COS, 293 cells or Bowes melanoma cells.As optimal way of the present invention, described host cell is fungal cell, such as yeast cell, fungal cell; Be more preferably Pichia pastoris or Trichodermareesei cell.Trichodermareesei is the main production microorganism of commercial wood cellulase, 'beta '-mannase ratio in the past in its enzyme system and activity all on the low side, be only the vigor of 1U/mL, 'beta '-mannase is a kind of hemicellulase, may limit its zymin to a certain extent to the degraded containing high mannosans biomass.And the successful expression of ManI of the present invention in intestinal bacteria and Trichodermareesei, illustrate that this GH5 family beta-mannase gene man1 can directly or express after optimizing in multiple host, has industrial application potentiality more widely.

When polynucleotide of the present invention are expressed in higher eucaryotic cells, if will make to transcribe to be enhanced when inserting enhancer sequence in the carrier.Enhanser is the cis-acting factors of DNA, usually nearly to 300 base pairs, acts on promotor transcribing with enhancing gene.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period, the polyoma enhancer in replication origin side in late period and adenovirus cancers etc.

Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.When host be prokaryotic organism as intestinal bacteria time, the competent cell that can absorb DNA can be gathered in the crops at exponential growth after date, uses CaCl ₂method process, step used is well-known in this area.Another kind method uses MgCl ₂.If needed, transform and also can be undertaken by the method for electroporation.When host is eukaryote, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical methods is as microinjection, electroporation, liposome packaging etc.

The transformant obtained can be cultivated by ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to host cell used, substratum used in cultivation can be selected from various conventional medium.Cultivate under the condition being suitable for host cell growth.When after host cell growth to suitable cell density, the promotor selected with the induction of suitable method (as temperature transition or chemical induction), cultivates for some time again by cell.

Recombinant polypeptide in the above methods can be expressed or be secreted into extracellular in cell or on cytolemma.If needed, can utilize its physics, the albumen of being recombinated by various separation method abstraction and purification with other characteristic of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation process, combination by protein precipitant process (salting-out method), centrifugal, the broken bacterium of infiltration, super process, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The purposes of the ManI of restructuring includes, but is not limited to: hydrolysis of lignocellulose, is hydrolyzed to manna oligosaccharide and seminose by the beta-mannase in hemicellulose, promotes the hydrolysis of lignocellulose; 'beta '-mannase and manna oligosaccharide can be widely used in the industrial circles such as food, medical treatment, feed, weaving, oil, and one of hydrolysate manna oligosaccharide is the most effective two qi factor, may be used in healthcare products.One of hydrolysate seminose is unique for saccharic nutrient substance clinically at present, is distributed widely in body fluid and tissue, especially at nerve, skin, testis, retina, liver and intestines.It is directly utilized synthesis glycoprotein, participates in immunomodulatory; 'beta '-mannase can be used for carrying vegetables oil from bean, reduces the viscosity of coffee, chocolate, cocoa liq-uor; β-Gan glycanase and zytase synergy can be used for paper industry; The gel breaker that 'beta '-mannase can be used as petroleum fracturing liquid has the advantages such as power is high, cost is low, formation injury is little; 'beta '-mannase also can be added in feed, except increasing zootrophic specific absorption and resistibility, it can also promote the secretion of quasi-insulin growthing factor I GF-1, promotes the synthesis of protein, improve lean ratio, the over ride effect of traditional zymin.The molecular modification technology of some albumen and host is well known in the art, and the β-Gan glycanase generated after therefore adopting these technological transformations and host are also contained in the present invention.

The peptide molecule that can suppress or stimulate ManI protein function finding therapeutic value is can be used for the restructuring ManI protein screening peptide library of expressing.

On the other hand, the present invention also comprises and has specific polyclonal antibody and monoclonal antibody to man1DNA or the polypeptide of its fragment coding, especially monoclonal antibody.Here, " specificity " refers to that antibody capable is incorporated into man1 gene product or fragment.Preferably, refer to that those can be combined with man1 gene product or fragment but nonrecognition and be incorporated into the antibody of other non related antigen molecule.In the present invention antibody comprise those can in conjunction with and suppress the molecule of ManI albumen, also comprise the antibody that those do not affect ManI protein function.The present invention also comprise those can with the antibody modified or be combined without the man1 gene product of modified forms.

Utilize albumen of the present invention, by various conventional screening assays, can filter out and with ManI albumen, interactional material occur, as inhibitor, agonist or antagonist etc.

Present invention also offers a kind of composition, in the ManI polypeptide of the present invention that it contains significant quantity and bromatology, feed is upper, medically or industrial acceptable carrier or vehicle.This kind of carrier comprises (but being not limited to): water, damping fluid, glucose, seminose, glycerine, ethanol and combination thereof.Those skilled in the art can according to the significant quantity of ManI polypeptide in the practical use determination composition of composition.

The material regulating ManI enzymic activity of the present invention also can be added in described composition.Any material with raising enzymic activity function is all available.Those skilled in the art can determine to add according to the practical use of composition the material improving enzyme characteristic alive.

After obtaining ManI enzyme of the present invention, according to prompting of the present invention, those skilled in the art can apply this enzyme easily to play the effect of hydrolysis substrate (particularly mannosans).As optimal way of the present invention, additionally provide a kind of method forming seminose and manna oligosaccharide, the method comprises: with the substrate that ManI ferment treatment of the present invention is to be hydrolyzed, described substrate comprises glucomannan, polygalactomannan and beta-mannase etc., or their mixture.Usually, under pH5.0-7.5, preferably 5.5-6.5 condition, with the substrate that described ManI ferment treatment is to be hydrolyzed.Usually under 45-70 DEG C, preferably 55-65 DEG C of condition, with the substrate that described ManI ferment treatment is to be hydrolyzed.

In an example of the present invention, provide a kind of polynucleotide of separation, its coding has the polypeptide of aminoacid sequence shown in SEQ IDNO:3.Polynucleotide of the present invention screens the positive colony that obtains from natural pond liquid unit genomic library and obtain sequence by order-checking, then passes through PCR isolated.Its sequence is as shown in SEQID NO:1, and the polynucleotide sequence total length that it comprises is 1017 bases, and encoding full leng is 338 amino acid whose ManI albumen (SEQ ID NO:3).In described ManI albumen (SEQ ID NO:3) sequence, be glycosyl hydrolase the 5th family aminoterminal conserved functional domains from N-terminal 14-317 amino acids.The sequence SEQ ID NO:1 be separated is after optimizing, as shown in SEQ ID NO:2, described ManI recombinant protein can efficient secretory expression in Trichodermareesei recon, and host's fermented liquid all has very strong beta-mannase enzymic activity, proves a kind of 'beta '-mannase efficiently.More preferably, in Trichodermareesei host can under Mierocrystalline cellulose and wheat bran are induced jointly more efficient secreting, expressing.

Experiment proves that 'beta '-mannase of the present invention has very high beta-mannase enzymic activity, energy secreting, expressing efficiently in host, optimal pH and optimum temperuture and cellulase industrial strain Trichodermareesei enzyme system basically identical, thus there is huge application prospect.

'beta '-mannase of the present invention and host's fermented liquid can act on glucomannan, polygalactomannan and beta-mannase, glucomannan, polygalactomannan and beta-mannase etc. are hydrolyzed into manna oligosaccharide, seminose etc., the degraded of lignocellulose can be promoted, hydrolysate is bifidus bacillus somatomedin simultaneously, can be used in the old protective foods of anti-disease, anti-aging and fodder industry as antinutritional factor.

Beta-glucosidase gene encoding sequence of the present invention can in host cell this 'beta '-mannase of Expression product, for being hydrolyzed to the biomass containing mannosans such as coconut, palm, Gua Erdou, acacia, red Chinese scholartree, konjaku, produce manna oligosaccharide or seminose.Experiment proves, compared with existing 'beta '-mannase, 'beta '-mannase ManI optimal reaction pH of the present invention is neutral, all has greater activity in wider pH scope, under optimum condition, lives reach more than 2625U/mg than enzyme.There is the potential being applied to the industries such as medical science, food, feed well.

Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, conveniently condition such as J. Pehanorm Brooker etc. is write usually, Molecular Cloning: A Laboratory guide, the third edition, Science Press, the condition described in 2002, or according to the condition that manufacturer advises.

The acquisition of embodiment 1, 'beta '-mannase ManI and encoding gene thereof

1, first genome Fosmid library of anaerobism natural pond liquid fermentation system is set up

1.1 extract anaerobically fermenting large fragment unit genomic dna by the following method

Get 8ml natural pond liquid, get after centrifugal and precipitate and use 20ml PBS damping fluid (137mmol l ^-1naCl, 2.7mmol l ^-1kCl, 1.5mmol l ^-1kH ₂pO ₄, 8.1mmol l ^-1na ₂hPO ₄, pH7.4) and wash 3 times.

Precipitation 7.68ml DNA extraction buffer resuspended (100mM Tris-HCl [pH8.0], 100mMEDTA, 100mM Na ₃pO ₄, 1.5M NaCl, 1% (w/v) CTAB), add after Proteinase K (final concentration 1mg/ml) and SDS (final concentration 1% (w/v)) hatch 20min at 55 DEG C and hatch 10min at 70 DEG C again.Thick lysate, after the centrifugal 10min of 17,000g, collects supernatant.With phenol: chloroform: use chloroform again after primary isoamyl alcohol (25:24:1) extracting supernatant twice: primary isoamyl alcohol (24:1) extracting supernatant once.With the isopropanol precipitating DNA of 0.6 times of volume, precipitate with 200 μ l TE (10mM Tris-HCl, 1mM EDTA, pH8.0) dissolving DNA.

Filling and phosphorylation of 1.2 yuan of genomic dnas

Use the DNA End-Repair Kit test kit of Epicentre company to fill and phosphorylation 5 μ g unit genomic dnas, operate and carry out according to test kit specification sheets.

First genomic DNA fragment of 1.3 acquisition about 40kb sizes

By through filling the genome DNA sample with phosphorylation, carry out pulsed field gel electrophoresis (damping fluid: 0.5 × TBE; Voltage: 6V/cm, time: 18h, switch time:7s, corner: 120 degree, temperature 14 DEG C), the adhesive tape of about 36-48kb is cut off, reclaims DNA by the method for electroelution, and about 50ng/ μ l is concentrated to recovery DNA.

The connection of 1.4 yuan of genomic DNA fragments and Fosmid carrier

Use the Fast-link test kit of Epicentre company that first genomic DNA fragment and Fosmid carrier pCC2FOS (purchased from the blunt end cloning in Epicentre company, are operated and carried out according to test kit specification sheets.

The packaging in 1.5 libraries

Use the Maxplax Lambda test kit of Epicentre company to carry out the packaging in library, operate and carry out according to test kit specification sheets.

The bed board in 1.6 libraries and preservation

Certain dilution packaging particle 10 μ L is mixed with 200 μ L competent cells, places 20min for 37 DEG C; What add 900 μ L contains 10mM MgSO ₄lB liquid nutrient medium (1% (w/v) peptone, 0.5% (w/v) yeast extract paste, 1% (w/v) NaCl, pH7.0), LB flat board (1%% (w/v) peptone, 0.5%% (w/v) yeast extract paste of being coated on after 40 minutes containing 12.5 μ g/ml paraxin is cultivated for 37 DEG C, 1%% (w/v) NaCl, 1.8%% (w/v) agar powder, pH7.0) on, and 37 DEG C of incubated overnight.Picked clones is to LB liquid freezing media (1%% (w/v) peptone containing 12.5 μ g/ml paraxin, 0.5%% (w/v) yeast extract paste, 1%% (w/v) NaCl, 6.5%% (v/v) glycerine, pH7.0) in 386 orifice plates, frozen in-70 DEG C of Ultralow Temperature Freezers.

2,454 high throughput sequencing technologies obtain acquisition and the splicing of natural pond liquid fermentation system unit genome short sequence

Utilize 454 high-throughput techniques to carry out high-flux sequence to the anaerobically fermenting large fragment unit genomic dna that the method for part 1.1 is extracted, obtain 519 altogether, 015 first genome short sequence, mean length is 236bp.Utilize the method for BLASTX using ’ – e1e-2 ' with ’ – Q11 ' is as parameter, to download GH1 from CAZy database, 3,5,9,10, sequence similar to these reference gene in first genome short sequence, as reference data storehouse, all extracts by the gene of 11,48 and 74 families.Then the joining method in Geneious4.8 professional version software is utilized to carry out splicing (splicing correlation parameter Custion Sensitivity, WordLength=18, Index Word Length=13, Maximum Gap Size=1, Maximum Gap perRead=20, Maximum Mismatches=20, Maximum Ambiguity=4), and utilize the method for MegaBLAST to extend splicing the contigs obtained.Finally obtain the contigs containing cellulose enzyme gene that 163 are greater than 1kb altogether.Wherein have a long 1109bp of contigs, called after contig8188, wherein contained GH5 gene man1 fragment length is 978bp, and gene is imperfect.

3, the method for sequence screening screens the Fosmid clone with contigs8188 fragment from library

With 384 orifice plate inoculating needles, Fosmid clone is copied to (LB formula is the same, and wherein every hole is added with the paraxin of 12.5 μ g/ml) in 384 orifice plates of the LB liquid nutrient medium containing 100 μ l another new every hole from 384 orifice plates.Cultivate after 20 hours, collect the bacterium liquid on whole 384 orifice plates for 37 DEG C, and utilize the Large Construct Kit of Qiagen company to extract the DNA of mixing Fosmid.Contig8188 is utilized to design primer: SEQ ID NO:4:GGCCGGAAACTCGCCGACAA and SEQ ID NO:5:ACTGGAACGACATCGGCGGG, object fragment is the DNA fragmentation of the 746bp on contig8188.The DNA utilizing these each 384 orifice plates primer pair being set up to first genome Fosmid library of anaerobism natural pond liquid fermentation system to propose carries out sequence screening, screening conditions are: carry out carrying out amplified reaction to the fragment of contig8188 with the PCR system of 25 μ l: comprising each 0.4 μM of pair of primers, 4 kinds of dNTPs (Takara company) of each 0.2 μM, the Fosmid DNA of each 384 orifice plates of 5ng is as template, the rTaq enzyme of 0.75U, 10 × rTaq damping fluid of 2.5ul TAKARA company.The reaction conditions of amplification gene fragment, with reference to its specification sheets setting PCR program: 94 DEG C, 30s; 94 DEG C, 30,50 DEG C, 30s, 72 DEG C of 1min, totally 35 circulations; 72 DEG C of 10min; 4 DEG C of insulations.

After obtain the positive 384 orifice plate containing contig8188 with primer screening, with 384 orifice plate inoculating needles, positive 384 orifice plates are copied to (LB formula is the same, and wherein every hole is added with the paraxin of 12.5 μ g/ml) in 384 orifice plates of the LB liquid nutrient medium containing 100 μ l in another new every hole again.Cultivate after 20 hours for 37 DEG C, then the overnight culture on positive colony plate often being arranged and often arranging is mixed with 10ul respectively, totally 40 samples.Again sequence screening is carried out to these 40 samples, amplified reaction is carried out: comprising each 0.4 μM of pair of primers with the PCR system of 25 μ l, 4 kinds of dNTPs (Takara company) of each 0.2 μM, each sample gets the overnight culture of 2ul as template, the rTaq enzyme of 0.75U, 10 × rTaq damping fluid of 2.5ul TAKARA company.The reaction conditions of amplification gene fragment, with reference to its specification sheets setting PCR program: 94 DEG C, 30s; 94 DEG C, 30,50 DEG C, 30s, 72 DEG C of 1min, totally 35 circulations; 72 DEG C of 10min; 4 DEG C of insulations.Finally obtain positive Fosmid and clone BF088I5.

4,454 high throughput sequencing technologies obtain the functional gene on Fosmid positive colony

Choose Fosmid positive colony BF088I5 in the LB substratum (paraxin containing 12.5 μ g/ml) of 100ml, carry out liquid culture and collect thalline.Then, the Large ConstructKit of Qiagen company is used to extract the DNA of Fosmid.Fosmid DNA 454 high throughput sequencing technologies are checked order, after utilizing 454Newbler splicing to splice, complete Fosmid gene order can be obtained, obtain the scaffold of 35kb.Meanwhile, predict with Fgensb software the opening code-reading frame that complete Fosmid gene order may exist, and determine the gene order of the GH5 family man1 of total length in contig8188.

Embodiment 2, the man1 expression in intestinal bacteria

1, the structure of recombinant expression vector in host e. coli

The ORF encoding gene being template clone mannase gene man1 with natural pond liquid DNA or Fosmid DNA by PCR (polypeptide shown in SEQ ID NO:1, coding SEQ ID NO:3), forward primer used is: 5 ' CCG gAATTCaTGGCTGGTGAACGTATAAGAATC3 ' (SEQ ID NO:6), its 5 ' end adds EcoR I recognition site: gAATTC; Reverse primer is 5 ' CCG cTCGAGaGAAGGCTCTCCTTGCGACTTCCTT3 ' (SEQ ID NO:7), its 5 ' end adds Xho I recognition site: cTCGAG.

Cla I and Xba I double digestion is used by after PCR primer purifying, application Axygen PCR primer post reclaims the DNA fragmentation that test kit recovery enzyme is cut, by this DNA fragmentation and the carrier pET28 that reclaims after same double digestion, connect at 16 DEG C with T4DNA ligase enzyme and spend the night, obtain recombinant expression vector pET28a-ecoman1.The His label (6 × His-Tag) that the N of expression product and C-terminal provide with expression vector, is convenient to subsequent purification.

2, the conversion of man1 gene in intestinal bacteria and checking

The above-mentioned plasmid pET28a-ecoman1 built is transformed in e. coli bl21 (Invitrogen, CA, USA) bacterial strain, by the bacterium colony grown on the LB flat board containing kantlex, with forward primer 5 ' CCG gAATTCaTGGCTGGTGAACGTATAAGAATC3 ' (SEQ ID NO:6) and b reverse primer are reverse primer is 5 ' CCG cTCGAGaGAAGGCTCTCCTTGCGACTTCCTT3 ' (SEQ ID NO:7) bacterium colony PCR identifies positive colony, and after order-checking, also checking is correct.

Result as shown in Figure 1, all has object fragment to expand in 5 positive colony bacterial strains P1, P2, P3, P4 and P5.

3, the expression of man1 gene in intestinal bacteria and the purifying of expression product

(1) expression of man1 gene

Inoculation intestinal bacteria P1 be cloned into 5mL contain 100 μ g/ml penbritins LB substratum in, 37 DEG C, 200rpm overnight incubation.Get 1ml nutrient solution in 100ml LB nutrient solution, 37 DEG C, 200rpm is cultured to OD ₆₀₀for 0.6-0.8.Adding IPTG after cooling to final concentration is 25 μMs, and in 16 DEG C, 200rpm continues cultivation 16 hours, collected by centrifugation thalline.With lysate (lysis buffer:NaH ₂pO ₄50mmol/L, NaCl300mmol/L, pH7.4) suspend the thalline collected, and the lysate after ultrasonic disruption cell is crude enzyme liquid.Crude enzyme liquid centrifugal 10 minutes at 12000 × g, collects lysate supernatant, is required crude enzyme liquid.

With Ni post (Ni-NTA Column) the purifying lysate supernatant purchased from Qiagen company, washings used (wash bufer): NaH during purifying ₂pO ₄50mmol/L, NaCI300mmol/L, pH7.0; The elutriant (elution bufer) of different imidazole concentration (20,40,60,100,200,500): NaH ₂pO ₄50mmol/L, NaCl300mmol/L, imidazoles 20-500mmol/L, pH7.0, wherein best with purification effect during 40mM imidazoles wash-out.Protein SDS-PAGE electrophoresis detection is carried out, as shown in Figure 2 with 5 μ l elutriants.Wherein swimming lane 1 is albumen Marker (molecular weight be followed successively by from big to small 97.2,66.4,44.3,29 and 20.1kDa), swimming lane 2 be ultrasonic after lysate; Swimming lane 3 be ultrasonic after lysate precipitation; Swimming lane 4 is lysate supernatant; Swimming lane 5 is 40mM imidazole elution.Target protein a large amount of wash-out during 40mM imidazoles wash-out, single slice can be seen after electrophoresis, illustrate and now obtained highly purified ManI target protein, all elutriants containing target protein are merged, the concentrated dialysis of the vivaspin6 super filter tube retained with GE company 10Kd, uses 20mM pH7.4NaH simultaneously ₂pO ₄displacement damping fluid, to remove imidazoles.

The analysis of embodiment 3, restructuring ManI albumen zymologic property

The mensuration that the enzyme of mannase is lived adopts DNS method, and concrete operations are as follows:

(1) DNS preparation

Take 10 grams of NaOH, be dissolved in about 400ml ddH ₂in O, then take 10g dinitrosalicylic acid, 2g phenol, 0.5g sodium sulphite anhydrous 99.3,200g Rochelle salt, be dissolved in about 300ml ddH ₂in O, two kinds of solution mixing, constant volume, to 1 liter, keeps in Dark Place.

(2) typical curve preparation

Get 9 thin wall centrifugal tubes, add solution by table 3.

Table 3

Standard specimen is numbered	1	2	3	4	5	6	7
								Seminose total amount (μ g)	0	10	20	30	40	50	60
Seminose volume (μ l)	0	1	2	3	4	5	6
								Supplement pure water (μ l)	100	99	98	97	96	95	94

Mannose concentration is 10mg/ml.Upper every part, table standard specimen adds DNS100 μ l, and boiling water bath 5min develops the color, and microplate reader surveys 540nm photoabsorption, and standard specimen 1 is blank.Various kinds performance number prepares graticule after subtracting blank.

(3) standard enzyme activity determination

In 100 μ l reaction systems, (major ingredient is polygalactomannan to add the Viscogum BE that final concentration is 1% (w/w), semi-lactosi and seminose are the saccharan that the ratio of 1:4 is formed with β-Isosorbide-5-Nitrae-D-glycosidic link), final concentration is the Na of 100mM ₂hPO ₄/ NaH ₂pO ₄damping fluid, then add and be diluted to certain dilution appropriate enzyme liquid with this damping fluid and react 10 minutes at appropriate temperatures, add 100 μ l DNS termination reactions (contrast for first adding after 100 μ l DNS enzyme-added liquid again in above-mentioned reaction system) again, 95 DEG C of reactions colour developing in 5 minutes in PCR instrument, survey 540nm absorbance value by microplate reader, sample measurements utilizes typical curve to calculate Mei Huo unit (U) after deducting contrast.

In 100 μ l reaction systems, (remove starch, major ingredient is glucomannan, and glucose and seminose are that the ratio of 1:2 is with β-1 to add the Rhizoma amorphophalli powder that final concentration is 1% (w/w), the saccharan that 4-D-glycosidic link is formed), final concentration is the Na of 100mM ₂hPO ₄/ NaH ₂pO ₄damping fluid, then add and be diluted to certain dilution appropriate enzyme liquid with this damping fluid and react 10 minutes at appropriate temperatures, add 100 μ lDNS termination reactions (contrast for first adding after 100 μ l DNS enzyme-added liquid again in above-mentioned reaction system) again, 95 DEG C of reactions colour developing in 5 minutes in PCR instrument, survey 540nm absorbance value by microplate reader, sample measurements utilizes typical curve to calculate Mei Huo unit (U) after deducting contrast.

Mei Huo unit (U) defines: 1U produces the enzyme amount needed for 1 μm of ol reducing sugar (simple sugars) for per minute catalytic hydrolysis Viscogum BE or Rhizoma amorphophalli powder.

The definition of Rate activity unit: the enzyme activity (U/mg) contained by every milligram of protein.

Result shows, ManI is 2625U/mg to the Rate activity at Viscogum BE (polygalactomannan) optimal pH 6.0,60 DEG C; Rate activity 1438U/mg albumen at ManI is 7.4,60 DEG C to Rhizoma amorphophalli powder (glucomannan) optimal pH.

(4) ManI optimal pH measures

PH scope is 3 ~ 9.5, and every 0.5 unit is a gradient, and the buffer of different pH value is: pH3 ~ 6.0 final concentration is the NaAc of 100mM; PH6.0 ~ 8.0 are 100mMNa with final concentration ₂hPO ₄/ NaH ₂pO ₄; PH8.0 ~ pH9.5 final concentration is 100mM Tris-HCl.Enzyme liquid is added in the system of each pH damping fluid, by standard enzyme determination step alive mensuration enzyme is alive as previously mentioned.Under 50 DEG C of reaction conditionss, ManI is at the Na of pH6.0 ₂hPO ₄/ NaH ₂pO ₄rate activity in damping fluid is the highest, as 100%, and the enzyme activity under each pH value that converts.

As shown in Figure 3 B, ManI optimal pH is 6.0 to result, and between pH5.0 ~ 8.0, all have the vigor of more than 50%, and reaction pH a wider range of ManI is described, the soda acid scope that can adapt to is wider.

(5) ManI optimum temperuture measures

Under optimal pH 6.0 condition, be between 30-70 DEG C in temperature range, press the measuring method step measurements alive of standard enzyme as previously mentioned.

As shown in Figure 3A, the optimum temperuture of ManI is 60 DEG C to result, therefore with the enzyme activity at this temperature for 100%, the enzyme activity at each temperature that converts.ManI can keep the vigor of the highest vigor more than 50% in the temperature range of 45-65 DEG C, illustrates that the range of reaction temperature of ManI is wider.

(6) ManI temperature tolerance measures

ManI enzyme liquid is stored in optimal pH damping fluid, after differing temps (55 DEG C, 60 DEG C, 65 DEG C) keeps different time (15min, 30min, 45min, 60min), at pH6.0, at 60 DEG C, measures enzyme activity.Its contrast be nonheat-treated enzyme liquid at pH6.0, the vigor measured at 60 DEG C, as 100%, converts and is incubated the residue relative activity after different time at different temperatures.

As shown in Figure 3 C, when ManI preserves 15min at 65 DEG C, vigor quickly falls to less than 30% of maximum vigor to result; When keeping at 60 DEG C, 55 DEG C, enzyme activity declines comparatively slow, and during maintenance 30min, enzyme activity just drops to less than 50% of maximum enzyme vigor.

(7) the pH tolerance of ManI measures

By enzyme liquid in the damping fluid of different pH, keep different time 30min respectively under optimum temperuture (60 DEG C) after, under corresponding pH, 60 DEG C measure enzyme activity.In pH6.0, preserving 30min with ManI, is 100% at the Rate activity of 60 DEG C of reaction 10min, the enzyme activity after conversion ManI preserves different time in each pH value damping fluid.

Result as shown in Figure 3 D, ManI has wider pH tolerance: keep 30min in the damping fluid of pH4.5-8 after, all can keep more than 50% of the highest vigor (preserving 30min with ManI in pH6.0, is 100% at the Rate activity of 60 DEG C of reaction 10min).

Embodiment 4, the man1 secreting, expressing in host's Trichodermareesei

1, the structure of expression vector

Encode from the above-mentioned gene ORF be separated to, carry out sequence optimisation according to trichoderma reesei expression codon usage frequency (http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi species=51453), the sequence of optimization is as shown in SEQ ID NO:2.Trichoderma reesei expression Zhi Qu GH5 family conserved regions (refers to 40-915 position in SEQ ID NO:2; Coding corresponds to the albumen of 14-317 amino acids in SEQ ID NO:3), be: 5 ' TCTAGAATGGCTGGCGATCGGAAGAT3 ' (SEQ IDNO:8) that its 5 ' end adds XbaI recognition site: TCTAGA with forward primer; Reverse primer is 5 ' TCTAGAACGCCGTTGCTGGTCCAG3 ' (SEQ ID NO:9), and its 5 ' end adds XbaI recognition site.

XbaI enzyme cutting is used by after PCR primer purifying, application AxygenPCR product post reclaims the DNA fragmentation that test kit recovery enzyme is cut, by this DNA fragmentation and the carrier pHDt/sk of recovery that cuts through same enzyme (see Microbial Cell Factories, 2012,11:21) after dephosphorylation process, connect at 16 DEG C with T4DNA ligase enzyme and spend the night, obtain recombinant expression vector pHDt/sk-trman1.

2, the expression of man1 gene in Trichodermareesei

The above-mentioned plasmid pHDt/sk-trman1 built is transformed into agrobacterium tumefaciens AGL1 (see Microbial Cell Factories, 2012, 11:21), Trichodermareesei RC30-8 bacterial strain is transformed into (see Microbial Cell Factories under the mediation of agrobacterium tumefaciens, 2012, 11:21), the transformant grown is inoculated in SDB nutrient solution, after 2 days, extracting DNA is template, be that 5 ' TCTAGAGCACGCCATTGGAAGTCCACGC3 ' (SEQ ID NO:9) PCR identifies positive transformant by forward primer 5 ' TCTAGAATGGCTGGCGATCGGAAGAT3 ' (SEQ ID NO:8) and reverse primer.Result as shown in Figure 4, all has object fragment to expand in 3 positive transformants A1, A2, A3.

Inoculation Trichodermareesei transformant A1 is in 10ml SDB nutrient solution, and 28 DEG C of 200rpm cultivate 2 days.Get 1ml nutrient solution and contain the inorganic salt nutrient solution of inductor (3% (w/v) Microcrystalline Cellulose and 2% (w/v) wheat bran) (according to w/v:0.4%KH to 10ml ₂pO ₄, 0.28% (NH ₄) ₂sO ₄, 0.06%MgSO ₄7H ₂o, 0.05%CaCl ₂, 0.06% urea, 0.3% peptone, 0.1%Tween80,0.5%CaCO ₃, 0.001%FeSO ₄7H ₂o, 0.00032%MnSO ₄h ₂o, 0.00028%ZnSO ₄7H ₂o, 0.0004%CoCl ₂, pH is adjusted to 5.5) in, 28 DEG C of 200rpm cultivate 7 days.4 DEG C of collected by centrifugation fermented supernatant fluids.

Supernatant is SDS-PAGE can testing goal albumen, as Fig. 5.Supernatant can record very high beta-mannase enzymic activity, is A1:413U/mL respectively; A2:436U/mL; 342U/mL.

Embodiment 5, restructuring ManI albumen are to the hydrolysis of mannosans

By 1% (w/w) Viscogum BE, (major ingredient is polygalactomannan, semi-lactosi and seminose are that the ratio of 1:4 is with β-1,4-D-glycosidic link formed saccharan) or the Rhizoma amorphophalli powder of 1% (w/w) (remove starch, major ingredient is glucomannan, glucose and seminose are that the ratio of 1:2 is with β-1, the saccharan that 4-D-glycosidic link is formed), or the ManI albumen of their mixture and 20U at pH7.4, act on 12h at 60 DEG C and obtain hydrolysate.Identified by the above-mentioned product TLC of 2 μ l, wherein standard model is glucose and seminose, and semi-lactosi and seminose; Separately there are the sweet dew hypoglycemic 1ul of concentrated hydrochloric acid 20 DEG C of acidolysis 1% mannosans 1ul and 1% or their mixture as a reference.Developping agent is: ethyl acetate: positive acetone: water=6:1:3 (V/V/V); Developer is methyl alcohol: the vitriol oil=4:1.

With restructuring ManI albumen or each substrate of acid treatment.Wherein, the untreated red locust bean gum of 1:1ul and Rhizoma amorphophalli powder mixture (after quality 1:1 mixing, the concentration being made into 1% (w/v) is dissolved in the phosphoric acid buffer of pH6.00.1M) are as substrate; 2:1ul1% (w/v) glucose is as substrate; 3:1ul1% (w/v) seminose (monose) is as substrate; 4:2ul acid treatment Rhizoma amorphophalli powder (Rhizoma amorphophalli powder being dissolved in the concentrated hydrochloric acid of 12M using the ratio of 1% (w/v)) is as substrate; 5:2ul ferment treatment Rhizoma amorphophalli powder (Rhizoma amorphophalli powder is dissolved in the phosphoric acid buffer of pH6.00.1M with the ratio of 1% (w/v), adds the ManI ferment treatment that final concentration is 0.02mg/ml concentration) is as substrate; 6:2ul acid treatment Rhizoma amorphophalli powder and red locust bean gum blends (being dissolved in the concentrated hydrochloric acid of 12M after Rhizoma amorphophalli powder and red locust bean gum 1:1 being mixed using the ratio of 1% (w/v)) are as substrate; 7:2ul ferment treatment Rhizoma amorphophalli powder and red locust bean gum blends (be dissolved in the phosphoric acid buffer of pH6.00.1M after Rhizoma amorphophalli powder and red locust bean gum 1:1 being mixed with the ratio of 1% (w/v), add the ManI ferment treatment that final concentration is 0.02mg/ml concentration) are as substrate; 8:1ul1% semi-lactosi is as substrate; 9:1ul1% (w/v) seminose (monose) is as substrate; The red locust bean gum of 10:2ul acid treatment (red locust bean gum being dissolved in the concentrated hydrochloric acid of 12M using the ratio of 1% (w/v)) is as substrate; The red locust bean gum of 11:2ul ferment treatment (red locust bean gum is dissolved in the phosphoric acid buffer of pH6.00.1M with the ratio of 1% (w/v), adds the ManI ferment treatment that final concentration is 0.02mg/ml concentration) is as substrate.Result, as Fig. 6, all can obtain manna oligosaccharide.

The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims

1. an isolated polypeptide, is characterized in that, this polypeptide is selected from lower group:

(a) polypeptide as shown in SEQ ID NO:3;

C the aminoacid sequence of (a) or (b) polypeptide is formed through the replacement of one or more amino-acid residue, disappearance or interpolation by (), and have the polypeptide derivative by (a) of (a) polypeptide function;

D () has the protein fragments of the SEQ ID NO:3 of (a) or (b) polypeptide function;

2. the polynucleotide be separated, it is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is selected from lower group:

(1) to encode the polynucleotide of polypeptide as claimed in claim 1;

(2) complementary with polynucleotide (1) polynucleotide.

3. polynucleotide as claimed in claim 2, it is characterized in that, the nucleotide sequence of these polynucleotide is as shown in SEQ ID NO:1 or SEQ ID NO:2.

4. a carrier, is characterized in that, it contains the arbitrary described polynucleotide of claim 2-3.

5. a genetically engineered host cell, is characterized in that, it contains carrier according to claim 4, or is integrated with the arbitrary described polynucleotide of claim 2-3 in its genome.

6. host cell as claimed in claim 5, it is characterized in that, described host cell is prokaryotic cell prokaryocyte or eukaryotic cell; Be preferably filamentous fungal cells.

7. a preparation method for polypeptide according to claim 1, is characterized in that, the method comprises:

I () cultivates the host cell described in claim 5 or 6;

(ii) culture containing polypeptide according to claim 1 is collected; With

(iii) from culture, polypeptide according to claim 1 is isolated.

8. the purposes of the culture of polypeptide according to claim 1 or the host cell described in claim 5 or 6, for hydrolyzing glucosidic bonds; It is preferably β-Isosorbide-5-Nitrae-D-glycosidic link; Or

For the formation of manna oligosaccharide.

9. a composition, is characterized in that, it contains polypeptide according to claim 1 or contains culture and medical science, bromatology, feed or the industrial acceptable carrier of host cell contained by claim 5 or 6.

10. the method for a hydrolyzing glucosidic bonds or formation manna oligosaccharide, it is characterized in that, the method comprises: with the substrate that polypeptide process according to claim 1 is to be hydrolyzed, described substrate is selected from: glucomannan, polygalactomannan, gala glucomannan, mannosans, konjaku, red locust bean gum or their mixture.

11. methods as claimed in claim 10, is characterized in that, under pH4.5-8.0 condition, with the substrate that polypeptide process according to claim 1 is to be hydrolyzed; Preferably pH is 5.0-7.5; More preferably pH is 5.5-7.5.

12. methods as claimed in claim 10, is characterized in that, under temperature 40-75 DEG C of condition, with the substrate that polypeptide process according to claim 1 is to be hydrolyzed; Preferably temperature is 45-70 DEG C; More preferably temperature is 50-65 DEG C.

Described in 13. claims 1, the purposes of polypeptide, is characterized in that, described purposes comprises:

(2) polysaccharide of β-Isosorbide-5-Nitrae-D-glycosidic link is contained to produce manna oligosaccharide for being hydrolyzed main chain;

(3) for hydrolysis of lignocellulose;

(4) for as fodder additives; Or

(5) for as foodstuff additive.