CN105441455B

CN105441455B - Chimeric nucleic acid molecule and application thereof in preparation of humanized antibody

Info

Publication number: CN105441455B
Application number: CN201510690809.6A
Authority: CN
Inventors: 葛良鹏; 刘作华; 游小燕; 邹贤刚; 吴梦; 杨松全; 林保忠; 刘雪芹; 黄勇; 丁玉春
Original assignee: Chongqing Camab Biotechnology Co ltd
Current assignee: Chongqing Jin Bo Bo Biotechnology Co., Ltd.
Priority date: 2015-10-21
Filing date: 2015-10-21
Publication date: 2020-08-28
Anticipated expiration: 2035-10-21
Also published as: CN105441455A; WO2017067043A1

Abstract

A nucleic acid molecule comprising a human immunoglobulin gene or fragment thereof, wherein: also includes host animal IgM constant region gene segment. The invention can efficiently prepare the fully humanized antibody, overcomes the incompatibility problem of the interaction of different species BCR and Ig alpha and Ig beta, and simultaneously, the expressed humanized antibody does not need to be secondarily reformed.

Description

Chimeric nucleic acid molecule and application thereof in preparation of humanized antibody

Technical Field

The invention belongs to the technical field of biology, and mainly relates to a nucleic acid molecule and application thereof in preparation of a humanized antibody.

Background

Antibodies are an important class of biomedical products that play an important role in the prevention and treatment of human diseases. Therapeutic antibodies have evolved through different stages of development, murine, chimeric, reshaped, resurfaced, and fully humanized antibodies.

A fully Humanized Antibody (Full Humanized Antibody) refers to an Antibody that has been genetically modified or immunized in a transgenic animal to obtain a protein sequence that is identical to that of a human Antibody. The fully humanized antibody does not contain animal protein, so that the side effect is low, the effect is better, and the fully humanized antibody becomes the main research and development direction of the current and future antibody engineering. At present, the fully humanized antibody is mainly produced by phage display technology and transgenic animal technology. In 2002, the first fully humanized antibody, Adalilimumab (Humira), produced by phage display technology was marketed. In 2006, the first fully humanized antibody Panitumumab from transgenic animals was approved for marketing in the us and europe.

The Phage Display-generating Antibody technology is relatively simple and mature, but is affected by the capacity of the Antibody library and the post-translational modification and effective folding of the Antibody, and the difficulty of obtaining high-affinity Antibody by the technology is high.

Transgenic animal fully Humanized antibodies (Humanized antibodies) are obtained by transferring all or part of human immunoglobulin genes into the genome of an animal by Transgenic or artificial chromosome transfer techniques [ deletion (or inactivation) of endogenous Antibody genes in the animal ], so that the animal expresses the human antibodies. The most advantage of using transgenic animals to produce fully humanized antibodies is that the probability of obtaining high affinity antibodies is high, and simultaneously, using one transgenic animal strain can produce different types of antibodies against different antigens, and the phage library is not required to be reconstructed against different antigens like phage display technology. However, with the progress of research, it was found that the human immunoglobulin gene fragment can be rearranged and expressed in animals, but the performance of producing human antibody protein is lower than the production effect of animal autoantibody before gene modification. In the case of mice, the reason for this is mainly that when antibodies act as B cell surface receptors (BCRs) in the primary stage of B cell development, their interaction with murine signaling proteins Ig α and Ig β is not optimal (i.e., murine BCRs interact best with murine Ig α and Ig β or human BCRs with human Ig α and Ig β), thus affecting the class switching, affinity maturation and B cell development of antibodies into mature antibody-producing plasma cells. To overcome this problem, Lee et al (Nature Biotechnology, 2014; 32 (4): 356-363) have replaced the variable region of mouse immunoglobulin with the variable regions of three human immunoglobulin genes (IgH, Ig kappa and Ig lambda), and the constant region has used the corresponding fragments of mouse immunoglobulin, and this strategy can overcome the above-mentioned problems to obtain chimeric antibody with variable region of human origin and constant region of mouse origin, and then transform the constant region of mouse origin into the constant region of human origin by downstream transformation to obtain fully humanized antibody. This method has the disadvantage of requiring a second modification to obtain fully humanized antibodies.

Disclosure of Invention

The invention aims to provide a nucleic acid molecule, which can efficiently prepare a fully humanized antibody, overcomes the incompatibility problem of the interaction of different species BCR with Ig alpha and Ig beta, and simultaneously, compared with a Lee method, the expressed humanized antibody does not need to be subjected to secondary modification.

The purpose of the invention is realized by the following measures:

the invention provides a nucleic acid molecule, which comprises a human immunoglobulin gene or a fragment thereof and a gene fragment of a IgM constant region of a host animal (namely, a gene fragment of IgH C mu).

Preferably, the above-mentioned gene fragment of the host animal IgM constant region is located in (substituted for) the corresponding constant region of the human immunoglobulin IgM heavy chain gene.

The host IgM constant region gene segment is a partial sequence of CH2, a sequence of CH3, a sequence of CH4, a sequence of TM1 and a sequence of TM2 of IgH C mu of a host animal, and a sequence among the sequences and a related polyA signal sequence. The human CH1 sequence binds to human Ig light chains, ensuring antibody structure, and the CH2 region ensures normal transcription and translation of human and mouse C regions. When the host is mouse, the gene segments of the murine IgM constant region for substitution are shown in <1> to <4425> of SEQ ID NO. 1; the hIg sequence replaced by the murine IgM constant region gene fragment is shown in SEQ ID NO. 2. When the host is a pig, the pig IgM constant region gene segment for substitution is shown in <1> to <4386> of SEQ ID NO.3, and the hIg sequence substituted by the pig IgM constant region gene segment is shown in SEQ ID NO. 4.

The structure of the gene segment of the host animal IgM constant region in the above nucleic acid molecule and the connection structure with the human immunoglobulin IgM gene or its segment are shown in FIGS. 1-1. Further, the nucleic acid molecules may also include FRT sequences, human Ig intron sequences (e.g., hIgM, hIgD); the connection structure of the gene segment of the host animal IgM constant region in the nucleic acid molecule, the human immunoglobulin IgM gene or the segment thereof, and FRT and human Ig introns (such as IgM and IgD) is shown in FIGS. 1-2. When the host is mouse, the FRT sequence is shown as SEQ ID NO.1<4426> to <4459>, and the human Ig intron sequence comprises SEQ ID NO.1<4460> to <4717 >; when the host is pig, FRT sequence is shown in SEQ ID NO.3<4387> to <4420>, and human Ig intron sequence is shown in SEQ ID NO.3<4421> to <4678 >.

For example, specifically, the CH1 and partial CH2 sequences of human IgM, the CH2 partial sequences of mouse, CH3, CH4, TM1 and TM2 sequences of mouse, and sequences therebetween and related PolyA signal sequences are linked in sequence with FRT, IgD intron, regulatory region of human IgHG3 (S γ 3) and IgHG3CH1 sequences to form a genetic vector expressing chimeric human mouse IgM and human IgG (see fig. 1-3). Alternatively, the CH1 and partial CH2 sequences of human IgM, the CH2 partial sequences of mouse, CH3, CH4, TM1 and TM2 sequences and sequences therebetween and the associated PolyA signal sequences are linked to FRT, IgM introns, regulatory regions of human IgD3 (S3) and IgD3CH1 sequences to form a gene vector expressing chimeric human mouse IgM and human IgD (fig. 1-4).

The human immunoglobulin gene includes a V region gene, a D region gene and a J region gene of a human immunoglobulin heavy chain gene. The human immunoglobulin heavy chain gene may further include hC gamma, hC alpha, hC and/or hC xi heavy chain gene, human 3' -regulatory region (hLCR), and the like.

For example, the gene cluster of the above nucleic acid molecule is shown in FIG. 2 (the black box position is the partial sequence (fragment) of the IgM constant region gene of the introduced host animal).

Through the transformation, the nucleic acid molecule expresses IgM homologous with the host animal at the early development stage in the animal body, and the IgM is used as a BCR, is favorable for interacting with the Ig alpha and the Ig beta of the animal, and promotes the type conversion of the antibody into IgG, affinity maturation and B cell development.

An expression vector comprising the nucleic acid molecule described above. A cell comprising the nucleic acid molecule or the vector. An animal, such as pig or mouse, comprises the nucleic acid molecule. A humanized antibody is prepared by rearranging and coding the nucleic acid molecules. The use of the above nucleic acid molecule or vector or cell in the preparation of a humanized antibody. The application of the nucleic acid molecule or the vector or the cell in preparing transgenic animals.

The human immunoglobulin gene after the transformation is transferred into an animal body to obtain a transgenic animal of the human immunoglobulin, or further hybridized with an animal which does not express the self immunoglobulin gene to obtain a genetically engineered animal which only expresses the human antibody protein. The antigen is used to immunize animals with transferred human immunoglobulin genes (heavy chain and light chain) to obtain fully humanized antibody. For example:

the method for preparing the transgenic animal by adopting the nucleic acid molecule or the vector or the cell comprises the following steps:

(1) obtaining the nucleic acid molecule;

(2) constructing the nucleic acid molecule into a vector;

(3) introducing a vector containing the nucleic acid molecule into a host cell (including stem cells, induced stem cells and somatic cells) or an embryo;

(4) implanting cells containing human Ig into embryos (chimera preparation) or somatic clones of host animals;

(5) breeding heterozygous and homozygous animals transformed with human Ig gene. (including crossing with an animal in which the host's endogenous immunoglobulin genes are inactivated).

The host animal is mammal such as mouse, rabbit, pig, cattle, sheep, chicken, horse, etc. The vector is artificial chromosome (such as yeast, bacteria), bacteriophage, plasmid, etc. The method for introducing the vector into the host cell comprises electroporation, virus infection, lipofection, microinjection and the like.

The gene segment of the IgM constant region of the host animal, the CH2 partial sequence, according to the present invention refers to a nucleotide sequence encoding a signal protein Ig alpha and/or Ig beta of the host animal.

Advantageous effects

1. The fully humanized antibodies produced by the present invention have high affinity.

2. The present invention can utilize one transgenic animal strain to produce various antibodies of different types, and the present invention is applicable to a variety of animals.

3. The host self-immunoglobulin of the present invention is not expressed or is below the detection limit.

4. The gene rearrangement efficiency of the invention is high, and the rearrangement, mutation and utilization rate of the VDJC gene are consistent with those of a human body.

5. The invention directly produces the full-humanized antibody without secondary modification, and the in vivo expression level can reach the level of healthy adults.

Drawings

FIG. 1-1 shows the structure of the gene fragment of the modified IgM constant region of the host animal and the connection structure with the human immunoglobulin IgM constant region gene or its fragment.

FIGS. 1-2 transformation vectors: comprises a gene segment of a host animal IgM constant region, a human immunoglobulin IgM constant region gene or a segment thereof, and a connecting structure with FRT, a screening gene, a human Ig intron (such as IgM, IgD) and the like.

FIGS. 1-3 show the gene fragment structure of IgM constant region of host animal after gene modification, the connection structure with human IgM gene fragment and the connection structure with other human Ig, such as human IgG3 gene or fragment

FIGS. 1-4 show the structure of IgM constant region gene fragment of host animal after gene modification and its connection structure with human IgM gene fragment and its connection structure with other human Ig, such as hlGD gene or fragment

FIG. 2 Structure of the modified human immunoglobulin heavy chain gene cluster

FIG. 3 example 1 Structure of human immunoglobulin Kappa light chain Gene Cluster

FIG. 4 example 1 Structure of human immunoglobulin lambda light chain Gene Cluster

FIG. 5 example 1 mouse immunoglobulin heavy chain Gene Cluster

FIG. 6 example 1 Gene targeting of knockout mouse immunoglobulin heavy chain Gene

FIG. 7 example 1 mouse immunoglobulin light chain Gene Cluster

FIG. 8 example 1 Gene targeting of knockout mouse immunoglobulin light chain Gene

Detailed Description

The present invention is described in detail below with reference to specific examples, which are given for the purpose of further illustrating the invention and are not to be construed as limiting the scope of the invention, and the invention may be modified and adapted by those skilled in the art in light of the above disclosure.

Example 1

The method comprises the following steps of transferring the modified human immunoglobulin gene into a mouse body, and immunizing the mouse containing the human immunoglobulin gene to obtain a fully humanized antibody:

1. optimized modification of human immunoglobulin gene

1) Modification of human immunoglobulin heavy chain gene

The IgM constant region gene fragment of the host animal is transferred to YAC or BAC vector containing human Ig through homologous recombination, and the gene cluster of the constructed human immunoglobulin heavy chain gene is shown in figure 2 (the black box position is the introduced gene fragment of the murine IgM constant region). Comprises a V region, a D region and a J region which are human immunoglobulin heavy chain genes in sequence, hIgHC mu, hIgHC gamma 3, hIgHC gamma 1, hIgHC alpha 1 and hLCR; wherein, hIgHC mu is subjected to gene modification, the corresponding regions (the DNA sequence is SEQ ID NO.2) of partial original hIgHC mu and IgHC are replaced by a CH2 partial sequence, a CH3 sequence, a CH4 sequence, a TM1 sequence, a TM2 sequence and sequences among the sequences, related PolyA signal sequences and the like (the DNA sequence is SEQ ID NO.1) of the murine IgHC mu, and the modified structure is shown as figures 1-1 and 1-3.

2) Modification of human immunoglobulin Kappa light chain gene

The human immunoglobulin kappa light chain gene includes all or part of the V region, J region, C region, and KDE region of the human immunoglobulin kappa light chain gene. The gene cluster is shown in FIG. 3.

3) Modification of human immunoglobulin lambda light chain gene

The human immunoglobulin lambda light chain gene includes all or part of the V region, J region and C region of the human immunoglobulin lambda light chain gene, as well as terminal enhancer structures. The gene cluster is shown in FIG. 4.

2. Cultivation of humanized antibody transgenic mice

1) Cultivation of mouse with human immunoglobulin heavy chain gene

The human immunoglobulin heavy chain gene constructed in the step 1) is transferred into a mouse body by utilizing the existing conventional transgenic technology. The transgenic mouse with the human immunoglobulin heavy chain obtained by double-standard screening of PCR detection and ELISA detection.

The PCR identifying primers used were:

PCR 1

For：TGCTTGGAACTGGATCAGGCAGTC

Rev：TTGCTTAACTCCACACCTGCTCCTG

PCR product size：329bp

PCR2

For：TTGAGGAGACTGTCCATCCTTCAC

Rev：GAGAGGGCATCTTGGTCTTCTTTC

PCR product size：471bp

the ELISA-identified antibodies used were: sigma (I1886) and sigma (A8792), with serum from healthy adults and healthy mice as controls.

2) Cultivation of mouse with transgenic human immunoglobulin kappa light chain gene

The human immunoglobulin kappa light chain gene constructed in 2) of step 1 was transferred into mice using an existing conventional transgenic technique. Transgenic mice with the human immunoglobulin kappa light chain obtained by double-standard screening were tested by PCR and ELISA.

The PCR identifying primers used were:

PCR 1：

FOR：TGCTCTGACCTCTGAGGACCTGTCTGTA

Rev：TTCAGGCAGGCTCTTACCAGGACTCA

PCR product size：616bp

PCR 2：

For：CACCCAAGGGCAGAACTTTGTTACT

Rev：GAGGAAAGAGAGAAACCACAGGTGC

PCR product size：596bp

the ELISA-identified antibodies used were: sigma (K3502) and sigma (A7164), with sera from healthy adults and healthy mice as controls.

3) Cultivation of mouse with human immunoglobulin lambda light chain gene

The human immunoglobulin lambda light chain gene constructed in 3) of step 1 is transferred into a mouse body by using the existing conventional transgenic technology. Transgenic mice of human immunoglobulin lambda light chain obtained by double-standard screening of PCR detection and ELISA detection.

The PCR identifying primers used were:

PCR 1：

For：AGCACAATGCTGAGGATGTTGCTCC

Rev：ACTGACCCTGATCCTGACCCTACTGC

PCR product size：562bp

PCR 2：

FOR：CTCTGCTGCTCCTCACCCTCCTCACTCAGG

REV：GAGAGTGCTGCTGCTTGTATATGAGCTGCA

PCR product size：462bp

the ELISA-identified antibodies used were: sigma (L1645) and sigma (A5175), with healthy adult and healthy mouse sera as controls.

4) Cultivation of immunoglobulin heavy chain knockout mice (FIGS. 5 and 6)

An immunoglobulin heavy chain gene knockout mouse is constructed by using a Crispr/Cas9 technology. IgHC mu of the mouse immunoglobulin heavy chain gene is selected as a gene knockout site (the knockout site and the gene knockout effect are shown in figure 6), and the immunoglobulin heavy chain gene knockout mouse is obtained. And (3) screening the obtained immunoglobulin heavy chain gene knockout mice by using PCR detection and ELISA detection double standards.

The PCR identifying primers used were:

For：AGCACCATTTCCTTCACCTGGAAC

Rev：CAAGGAGCAAATGACCATGTCTGG

PCR products: 760 bp. Then using BstEII enzyme to cut, the gene targeting is 753bp, and the gene targeting is two bands of 500bp and 260 bp.

The ELISA-identified antibodies used were: sigma (M8644) and sigma (A8786), with healthy adult and healthy mouse sera as controls.

5) Cultivation of immunoglobulin kappa light chain knockout mice (FIGS. 7 and 8)

The entire constant region (C region) of the immunoglobulin kappa light chain gene of the mouse was knocked out using a conventional gene knockout technique to obtain an immunoglobulin kappa light chain gene knockout mouse. The mouse immunoglobulin kappa light chain gene knockout mouse obtained by double standard screening is detected by PCR and ELISA.

The PCR identifying primers used were:

PCR1：

For：CCCTTCCCTAGCCAAAGGCAACTA

Rev：CACAACGGGTTCTTCTGTTAGTCC

PCR product size：466

PCR 2：

For：CACACCTCCCCCTGAACCTGAAAC

Rev：GTTGTGGGTAGTGCCCAGCCTTGC

PCR product size：464bp

the ELISA-identified antibodies used were: southern Biotech (1170-01) and southern Biotech (1170-05) with healthy adult and healthy mouse sera as controls.

6) Hybrid combination to obtain humanized antibody transgenic mouse

Hybridizing and breeding the mice obtained in the second step 1), 2), 3), 4) and 5), and detecting by PCR and ELISA to finally obtain the humanized antibody transgenic mice with high expression of human immunoglobulin, but without (or with low expression of) mouse immunoglobulin for the next step of research.

3. Obtaining fully humanized antibodies

1) OVA immunization of humanized antibody transgenic mice obtained in step 2 and 6)

Mice 8 weeks old were selected for immunization.

Initial immune:

[ 1 ] OVA (SigmaA7641) antigen was diluted with PBS to a final concentration of 5mg/ml, 50ug CpG (ODN1826, tlrl-1826, Invivogen) was added, and an appropriate amount of aluminum hydroxide (vac-alu-50, Invivogen) was added to make the concentration of aluminum hydroxide 1%.

② 0.75mL of antigen prepared in ① was mixed with CFA adjuvant (Sigma F5881) at a ratio of 1: 1 and mixed with MIXPAC^TMThe mice were immunized subcutaneously with 200ul (0.5mg) of the emulsion injected by syringe.

And (2) avoiding:

second immunization 16 days after priming, antigen was diluted with PBS to a final concentration of 2.5mg/ml, 25ug CpG was added, and an appropriate amount of aluminum hydroxide was added to make the concentration of aluminum hydroxide 1%.

② mixing ① prepared antigen 0.75mL with IFA adjuvant at a ratio of 1: 1, and mixing with MIXPAC^TMThe mice were immunized by intraperitoneal injection with 200ul (0.25mg) per injection.

And (3) three-step (I):

after the 16 th day of the secondary immunization, the tertiary immunization was performed, the antigen was diluted with PBS to a final concentration of 1.25mg/ml, 12.5ug of CpG was added, and an appropriate amount of aluminum hydroxide was added to make the concentration of aluminum hydroxide 1%.

② directly injecting antigen protein, preparing according to the method in (I), injecting 200ul (0.25mg) per mouse for intraperitoneal injection immunization.

2) Mouse antibody detection

10 days after 3 th immunization, mice No. 3554, 3555 and 3556 were respectively bled for ELISA detection, healthy adults and wild-type mice were used as controls, and the content of mouse IgG and the content of human IgG in the serum of the immunized mice were respectively detected, and the results are as follows:

firstly, detecting the content of mouse IgG

The kit is a mouse IgG ELISA kit (Abcam, ab157719)

3554: below detection limit

3555: below detection limit

3556: below detection limit

Healthy adults: below detection limit

Wild-type mice: 0.7mg/ml

The results show that: the humanized antibody mouse after immunization has extremely low expression level of the murine IgG.

② detection of human IgG in mouse serum

Human IgG ELISA kit (Abcam, ab100547) was used as the kit

3554：10.3mg/ml

3555：8.1mg/ml

3556：8.2mg/ml

Healthy adults: 10.2mg/ml

Wild-type mice: <0.1ng/ml

The results show that: the humanized antibody mouse after immunization has high human IgG expression level.

③ determination of OVA antibody affinity

Selecting a 3556 mouse, fusing spleen cells and hybridoma cells, screening monoclonal antibodies, screening 3 cell clones with the highest expression quantity by ELISA, and performing anti-OVA antibody affinity detection by using a competitive ELISA detection method (CEB459Ge, Cloud-Clone Corp), wherein the result shows that the antibody with the highest affinity is 230 pM.

The scheme for modifying the human immunoglobulin gene is also applicable to other mammals, for example, mammals such as pigs and the like are taken as host animals, and the beneficial effect of the expression of the fully humanized antibody can be realized.

Claims

1. A nucleic acid molecule comprising a human immunoglobulin gene, wherein: also comprises a transgenic host animal IgM constant region gene segment, wherein the host animal IgM constant region is positioned in a corresponding region of a primary human immunoglobulin IgM constant region; the host IgM constant region gene segment is a CH2 partial sequence, a CH3 sequence, a CH4 sequence, a TM1 sequence and a TM2 sequence of the host IgHC mu, and a sequence among the sequences and a related PolyA signal sequence; the host IgM constant region gene segment is shown in SEQ ID NO.1<1> - <4425> or SEQ ID NO.3<1> - <4386 >.

2. The nucleic acid molecule of claim 1, wherein the human immunoglobulin gene is linked to a host animal IgM constant region gene fragment as shown in FIGS. 1-1.

3. The nucleic acid molecule of claim 1, further comprising an FRT sequence, a human IgD intron sequence.

4. The nucleic acid molecule of claim 3, wherein the FRT sequence is as set forth in SEQ ID No.1<4426> <4459>, and the human IgD intron sequence comprises SEQ ID No.1<4460> <4717 >; or FRT sequence is shown in SEQ ID NO.3<4387> - <4420>, and human IgD intron sequence is shown in SEQ ID NO.3<4421> - <4678 >.

5. The nucleic acid molecule of claim 1 wherein the gene segments of the host animal IgM constant region are linked to the human immunoglobulin IgM gene and to the FRT, human IgD intron.

6. The nucleic acid molecule of claim 1, wherein the human immunoglobulin gene has been knocked out for human IgHC μ of the sequence of part of CH2, CH3, CH4, TM1 and TM2, and sequences there between and related PolyA signal sequences.

7. The nucleic acid molecule of claim 1, wherein the human immunoglobulin genes comprise V region genes, D region genes, J region genes of human IgH.

8. The nucleic acid molecule of claim 1, wherein the human immunoglobulin heavy chain gene further comprises an hC γ, hC α, hC, and/or hC ξ heavy chain gene and/or hLCR.

9. A vector comprising the nucleic acid molecule of any one of claims 1-8.

10. A cell comprising a nucleic acid molecule according to any one of claims 1 to 8 or a vector according to claim 9.

11. Use of a nucleic acid molecule according to any one of claims 1 to 8 or a vector according to claim 9 or a cell according to claim 10 for the preparation of a transgenic animal.

12. A method for producing a transgenic animal using the nucleic acid molecule of any one of claims 1 to 8 or the vector of claim 9 or the cell of claim 10, comprising the steps of:

(1) obtaining the nucleic acid molecule;

(2) constructing the nucleic acid molecule into a vector;

(3) introducing a vector containing the nucleic acid molecule into a host cell or embryo;

(4) implanting cells containing human Ig into an embryo or somatic clone of a host animal;

(5) breeding heterozygous and homozygous animals transformed with human Ig gene.