CN105441436A - Individualized medication detection kit for receptor blocker - Google Patents

Abstract

The invention belongs to the technical field of biological detection, and in particular relates to an individualized medication detection kit for a receptor blocker. A detection primer group comprises a positive direction outer side primer F3: SEQ ID NO:1, a negative position outer side primer B3: SEQ ID NO:2, a positive direction inner side primer FIP: SEQ ID NO:3, a negative direction inner side primer BIPC: SEQ ID NO:4 and a negative direction inner side primer BIPG: SEQ ID NO:5. The detection kit provided by the invention is simple in step, quick in response, efficient, high in specificity and simple and convenient in identification, so that the detection kit has a broader application prospect.

Description

A kind of personalized medicine detection kit of beta blocker

Technical field

The invention belongs to technical field of biological, relate to a kind of personalized medicine detection kit of beta blocker, be specifically related to a kind of detection kit of ADRB1 gene pleiomorphism and the reaction system of formation thereof.

Background technology

The subfamily that beta-2 adrenoceptor (β-adrenergicreceptor) is adrenoceptor, belongs to g protein coupled receptor superfamily, comprises β 1, β 2 and β 3 three kinds of different subtypes.This receptoroid is by regulating cAMP and L-type Ca in cell with Gs albumen coupling ²⁺the open frequency of passage is the action target spot of beta receptor agonist and beta-blockers.The appearance of ADRB1Gly389Arg (rs1801253) pleomorphism site, the generation of Arg389 and Gly389 two type acceptor can be caused, and investigators have confirmed that Arg389 receptor and G-protein coupling efficiency will apparently higher than Gly389 receptors, if so hyperpietic carries Arg389 homozygote gene, then can obtain curative effect more more obvious than Gly389 receptor type patient to Altace Ramipril metoprolol, therefore CFDA points out in " drug metabolism enzyme and the drug target technique of gene detection guide (try) " to announce for 2015: " after Arg389 homozygote genotype patients with heart failure application carvedilol and Metoprolol in Post, Left Ventricular Ejection Fraction improvement situation is better.Suggestion clinicist carries out ADRB1 polymorphic detection before application β1receptor blocade, and according to its genotype adjustment dosage, to improve curative effect, reduces the generation of untoward reaction.”

The testing product of current ADRB1 gene pleiomorphism mainly applies conventional solid chip, liquid-phase chip and quantitative fluorescent PCR etc., and it is high that these technique means exist cost all in various degree, the defect such as cycle long and false positive rate is high.Therefore, set up a kind of detection flux high, easy and simple to handle and cheap ADRB1 genetic polymorphism detection test kit just becomes very important.Isothermal duplication (LAMP) technology of ring mediation is a kind of isothermal amplification technique that Japanese Scientists proposed in 2000, its principal feature is 6 zone design, 4 special primers for target gene, under the effect of strand displacement archaeal dna polymerase (BstDNApolymerase), carry out constant-temperature amplification, only need within 15-90 minute, can 10 be produced ⁹-10 ¹⁰the product of the order of magnitude.Judged the genotype of sample to be tested by the change of direct visual perception system status after reaction terminates, without the need to open pipe, therefore enormously simplify operation steps, effectively can avoid sample cross contamination again simultaneously, and, only need ortho-water bath to carry out detection, again save a large amount of testing costs.

Summary of the invention

The present invention, in order to overcome the defect of aforesaid method, provides a kind of personalized medicine detection kit of beta blocker, has that susceptibility is high, specificity good and the advantage such as easy and simple to handle.

For reach this invention object, the present invention by the following technical solutions:

First aspect, a kind of personalized medicine detection kit of beta blocker, described test kit comprises detection primer sets, and described detection primer sets is as follows:

Forward Outside primer F3:SEQIDNO:1:GCCAACGTGGTGAAGGC;

Reverse Outside primer B3:SEQIDNO:2:AGACAGCCCGAGGCG;

Forward inner primer FIP:SEQIDNO:3:TTGGCGTAGCCCAGCCAGACCGCGAGCTGGTGC;

Reverse inner primer BIPC:SEQIDNO:4:CGTCTGCTCTGCTGCGCGGGCCGGTCTCCGTGG;

Reverse inner primer BIPT:SEQIDNO:5:GGTCTGCTCTGCTGCGCGGGCCGGTCTCCGTGG.

Preferably, the sequence shown in described SEQIDNO:1-4 is the C allelotrope for detecting rs1801253 site.

Preferably, the sequence shown in described SEQIDNO:1-3 and SEQIDNO:5 is the G allelotrope for detecting rs1801253 site.

In the present invention, the Outside primer of 4 primers is designated as forward Outside primer F3 and reverse Outside primer B3, and inner primer is designated as forward inner primer FIP and reverse inner primer BIP, and wherein FIP contains F1c and F2, and BIP contains B1c and B2.The present invention, on the basis of common LAMP, with 5 ' of the strictest F1c or B1c of specific requirements end for rs1801253 site design allele specific primer, detects the C allelotrope of rs1801253 and the G allelotrope of rs1801253 respectively.Introduce extra sudden change by the 3rd, the 5 ' end respectively at BIPC and BIPG, reduce the possibility of non-specific amplification further.

Preferably, described reaction system also comprises reaction buffer, dNTPs, hydroxynaphthol blue, trimethyl-glycine, BstDNA polysaccharase, measuring samples genomic dna and deionized water.

Preferably, described reaction buffer comprises Tris-HCl, KCl, (NH ₄) ₂sO ₄, MgSO ₄and Tween-20.

Second aspect, the invention provides the detection reaction system that detection kit as described in relation to the first aspect builds, described reaction system comprises the primer sets described in first aspect, reaction buffer, dNTPs, hydroxynaphthol blue, trimethyl-glycine, BstDNA polysaccharase, measuring samples genomic dna and deionized water.

Preferably, described reaction buffer comprises Tris-HCl, KCl, (NH ₄) ₂sO ₄, MgSO ₄and Tween-20.

Preferably, the concentration of described Tris-HCl is 10-30mM, can be such as 10mM, 11mM, 12mM, 13mM, 15mM, 16mM, 18mM, 20mM, 22mM, 23mM, 25mM, 26mM, 28mM or 30mM, be preferably 15-25mM, more preferably 20mM.

Preferably, the concentration of described KCl is 10-60mM, can be such as 10mM, 11mM, 12mM, 15mM, 20mM, 25mM, 30mM, 35mM, 40mM, 45mM, 46mM, 48mM, 50mM, 51mM, 52mM, 53mM, 55mM, 56mM, 57mM, 58mM, 59mM or 60mM, be preferably 50-55mM, more preferably 50mM.

Preferably, described (NH ₄) ₂sO ₄concentration be 5-13mM, can be such as 5mM, 6mM, 7mM, 8mM, 9mM, 10mM, 11mM, 12mM or 13mM, be preferably 8-12mM, more preferably 10mM.

Preferably, described MgSO ₄concentration be 2-8mM, can be such as 2mM, 3mM, 4mM, 5mM, 6mM, 7mM or 8mM, be preferably 2-6mM, more preferably 4mM.

Preferably, the volume fraction of described Tween-20 is 0.1-1%, such as, can be 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9% or 1%, is preferably 0.1%.

Preferably, the concentration of described dNTPs is 1-2mM, such as, can be 1mM, 1.1mM, 1.2mM, 1.3mM, 1.4mM, 1.5mM, 1.6mM, 1.7mM, 1.8mM, 1.9mM or 2mM, is preferably 1.2-1.8mM, more preferably 1.4mM.

Preferably, the concentration of described hydroxynaphthol blue is 108-130 μM, it can be such as 108 μMs, 109 μMs, 110 μMs, 111 μMs, 112 μMs, 115 μMs, 116 μMs, 118 μMs, 120 μMs, 122 μMs, 125 μMs, 126 μMs, 128 μMs or 130 μMs, be preferably 115-123 μM, more preferably 120 μMs.

Preferably, described beet paper mill wastewater is 0-1M, such as, can be 0M, 0.2M, 0.4M, 0.5M, 0.6M, 0.7M, 0.8M, 0.9M or 1M, is preferably 0.5-0.8M, more preferably 0.8M.

As optimal technical scheme, described reaction system comprises reaction system C and reaction system G, and wherein each 25 μ L reaction systems contain following component:

Damping fluid:

The third aspect, the invention provides a kind of using method of the reaction system as described in second aspect, described method comprises the steps:

By complete for component mixing each needed for reaction system C and reaction system G, be positioned over thermostat water bath and react, heat up after reaction and carries out inactivation treatment, then according to system colour-change result of determination.

Preferably, the temperature of described thermostat water bath is 55-70 DEG C, such as, can be 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C, 65 DEG C, 68 DEG C or 70 DEG C, is preferably 58-61 DEG C, more preferably 60 DEG C.

Preferably, the described reaction times is 15-90min, can be such as 15min, 16min, 18min, 20min, 25min, 30min, 35min, 40min, 45min, 50min, 51min, 52min, 53min, 55min, 56min, 58min, 60min, 61min, 62min, 64min, 65min, 70min, 75min, 80min, 85min or 90min, be preferably 55-62min, more preferably 60min.

Preferably, describedly according to system colour-change result of determination be:

Reaction system C is sky blue, and reaction system G is violet, then loci gene type to be measured is CC;

Reaction system C is violet, and reaction system G is sky blue, then loci gene type to be measured is GG;

Reaction system C is sky blue, and reaction system G is sky blue, then loci gene type to be measured is CG.

Compared with prior art, the present invention has following beneficial effect:

(1) test kit step of the present invention is simple: DNA amplification is placed in thermostat water bath after only needing reaction system to configure carries out reacting, and does not need the sex change carrying out double-stranded DNA in advance and the alternating temperature process such as sex change repeatedly, annealing, extension be similar in PCR circulating reaction;

(2) test kit high specific of the present invention: six regions of applying four primer identifying purpose fragments, and the order in these six regions, length, annealing temperature have corresponding requirements, specificity is very high, can according to whether react just can judge target gene existence whether, can be applicable to the somatotype qualitative detection of the similar bacterium of genetic background or virus;

(3) test kit reaction of the present invention fast, efficiently: whole reaction 1h can complete, and productive rate is high;

(4) test kit qualification of the present invention is easy: get final product result of determination by visual color change after having reacted, the observation of result can depart from operational requirement and the instrument restriction of gel imaging, add that reaction is that isothermal carries out, the circulating temperature change that need not rely on PCR instrument complexity has come, just can carry out in water-bath, make this detection kit have more wide application prospect.

Accompanying drawing explanation

Fig. 1 is the schematic diagram of test kit primer sets of the present invention;

Fig. 2 is the schematic diagram of FIP and BIP in test kit primer sets of the present invention;

Fig. 3 is the electrophorogram of the reaction product of M1-4 in the embodiment of the present invention 1;

Wherein, M-DNAmarker, causes down from above and is followed successively by 2400bp, 2200bp, 2000bp, 1800b, 1600bp, 1400bp, 1200bp, 1000bp, 800bp, 600bp, 400bp and 200bp; 1 ^cthe C reaction system of-M1 group; 1 ^gthe G reaction system of-M1 group; 2 ^cthe C reaction system of-M2 group; 2 ^gthe G reaction system of-M2 group; 3 ^cthe C reaction system of-M3 group; 3 ^gthe G reaction system of-M3 group; 4 ^cthe C reaction system of-M4 group; 4 ^gthe G reaction system of-M4 group;

Fig. 4 is the Sequencing chromatogram of M1 group in the embodiment of the present invention 1;

Fig. 5 is the Sequencing chromatogram of M2 group in the embodiment of the present invention 1;

Fig. 6 is the Sequencing chromatogram of M3 group in the embodiment of the present invention 1;

Fig. 7 is the Sequencing chromatogram of M4 group in the embodiment of the present invention 1.

Embodiment

For further setting forth the technique means and effect thereof that the present invention takes, further illustrate technical scheme of the present invention below in conjunction with the preferred embodiments of the present invention, but the present invention is not confined in scope of embodiments.

Unreceipted concrete technology or condition person in embodiment, according to the technology described by the document in this area or condition, or carry out according to product description.Agents useful for same or the unreceipted production firm person of instrument, be by the commercially available conventional products of regular channel.

Embodiment

Extract 4 people 1ml venous blood to preserve with EDTA anticoagulant tube, often 200ul blood got by pipe, and by the DNA extraction kit of full formula gold or other company, reference reagent box specification sheets extracts complete genome DNA as the template detected, and is labeled as M1, M2, M3 and M4 respectively.Carry out detection reaction with the test kit in the present invention, verify the implementation result of test kit of the present invention.

Allele-SpecificLAMP technology is adopted to template M, makes nucleic acid to be detected carry out LAMP reaction, be divided into two group reaction systems, one group for the allelic system C of C, one group for the allelic system G of G.Template Mn (n is group numbering, 1-4) is joined in system C and system G respectively, obtains reaction system C and G.

First, select the sequence of the primer sets as described in the application's first aspect to sample to react, described primer sets is as follows:

Forward Outside primer F3:SEQIDNO:1:GCCAACGTGGTGAAGGC;

Reverse Outside primer B3:SEQIDNO:2:AGACAGCCCGAGGCG;

Forward inner primer FIP:SEQIDNO:3:TTGGCGTAGCCCAGCCAGACCGCGAGCTGGTGC;

Reverse inner primer BIPC:SEQIDNO:4:CGTCTGCTCTGCTGCGCGGGCCGGTCTCCGTGG;

Reverse inner primer BIPT:SEQIDNO:5:GGTCTGCTCTGCTGCGCGGGCCGGTCTCCGTGG.

Institute responds and all arranges same reaction system, composed as follows:

Reaction system C:

Reaction system G:

During two reaction system reactions, at 60 DEG C, react 60min, be warming up to 80 DEG C afterwards and keep 20min to carry out inactivation treatment, lower the temperature afterwards, observe system colour-change.

Reaction is carried out according to above-mentioned detection method, and before reaction, system color is pansy, and after reaction, color and the genotype of each group reaction system judge as shown in table 1:

Table 1

As can be seen from Table 1, the reaction system C of M1-M4 all becomes sky blue, and the equal nondiscoloration of sample M1, M2 and M4 reaction system G, illustrate that these three samples do not have G allelotrope at rs1801253 place, namely the rs1801253 place of M1, M2 and M4 sample is that CC is homozygous; Sample M3 not only C system becomes sky blue, and G system also becomes sky blue simultaneously, illustrates that M3 is CG heterozygous at rs1801253 place.

For the accuracy of further confirmatory reaction, electrophoresis is carried out to the LAMP product of above-mentioned group, with the agarose gel electrophoresis qualification of 2%, electrophoresis 30min under 6v/cm voltage.The electrophorogram obtained as shown in Figure 3.The reaction system C of M1, M2 and M4 group presents typical scalariform band.Reaction system G does not then have band.M3 group reaction system C and G presents typical scalariform band, with coming to the same thing of detection method of the present invention.

Above-mentioned 4 other templates of experimental group are carried out somatotype by PCR-sequencing respectively, the Sequencing chromatogram obtained as shown in figs. 4-7, contrast gene sequencing collection of illustrative plates and the detected result of detection primer provided by the invention and composition known, the two detection coincide rate 100%.Can verify that result of the present invention is accurate.

In sum, test kit of the present invention can judge the genotype of reacting sample accurately, and test kit step of the present invention is simple: DNA amplification is placed in thermostat water bath after only needing reaction system to configure carries out reacting, and does not need the sex change carrying out double-stranded DNA in advance and the alternating temperature process such as sex change repeatedly, annealing, extension be similar in PCR circulating reaction; Reaction fast, efficient, specificity is high: whole reaction 1h can complete, and productive rate is high; Identify easy: after having reacted, get final product result of determination by visual color change, the visible observation of result can depart from operational requirement and the instrument restriction of gel imaging, add that expanding reaction is that isothermal carries out, the circulating temperature change that need not rely on PCR instrument complexity has come, just can carry out in water-bath, make this detection kit have more wide application prospect.

Applicant states, the present invention illustrates method detailed of the present invention by above-described embodiment, but the present invention is not limited to above-mentioned method detailed, does not namely mean that the present invention must rely on above-mentioned method detailed and could implement.Person of ordinary skill in the field should understand, any improvement in the present invention, to equivalence replacement and the interpolation of ancillary component, the concrete way choice etc. of each raw material of product of the present invention, all drops within protection scope of the present invention and open scope.

Claims (10)

1. a personalized medicine detection kit for beta blocker, is characterized in that, described test kit comprises detection primer sets, and described detection primer sets is as follows:

Forward Outside primer F3:SEQIDNO:1;

Reverse Outside primer B3:SEQIDNO:2;

Forward inner primer FIP:SEQIDNO:3;

Reverse inner primer BIPC:SEQIDNO:4;

Reverse inner primer BIPG:SEQIDNO:5.

2. detection kit according to claim 1, is characterized in that, the sequence shown in described SEQIDNO:1-4 is the C allelotrope for detecting rs1801253 site;

Preferably, the sequence shown in described SEQIDNO:1-3 and SEQIDNO:5 is the G allelotrope for detecting rs1801253 site.

3. detection kit according to claim 1 and 2, is characterized in that, described test kit also comprises reaction buffer, dNTPs, hydroxynaphthol blue, trimethyl-glycine, BstDNA polysaccharase, measuring samples genomic dna and deionized water.

Preferably, described reaction buffer comprises Tris-HCl, KCl, (NH ₄) ₂sO ₄, MgSO ₄and Tween-20.

4. the detection reaction system of the detection kit structure according to any one of claim 1-3, it is characterized in that, described reaction system comprises: the primer sets described in claim 1 or 2, reaction buffer, dNTPs, hydroxynaphthol blue, trimethyl-glycine, BstDNA polysaccharase, measuring samples genomic dna and deionized water.

5. reaction system according to claim 4, is characterized in that, described reaction buffer comprises Tris-HCl, KCl, (NH ₄) ₂sO ₄, MgSO ₄and Tween-20;

Preferably, the concentration of described Tris-HCl is 10-30mM, is preferably 15-25mM, more preferably 20mM;

Preferably, the concentration of described KCl is 10-60mM, is preferably 50-55mM, more preferably 50mM;

Preferably, described (NH ₄) ₂sO ₄concentration be 5-13mM, be preferably 8-12mM, more preferably 10mM;

Preferably, described MgSO ₄concentration be 2-8mM, be preferably 2-6mM, more preferably 4mM;

Preferably, the volume fraction of described Tween-20 is 0.1-1%, is preferably 0.1%.

6. the reaction system according to any one of claim 4 or 5, is characterized in that, the concentration of described dNTPs is 1-2mM, is preferably 1.2-1.8mM, more preferably 1.4mM;

Preferably, the concentration of described hydroxynaphthol blue is 108-130 μM, is preferably 115-123 μM, more preferably 120 μMs;

Preferably, described beet paper mill wastewater is 0-1M, is preferably 0.5-0.8M, more preferably 0.8M.

7. the reaction system according to any one of claim 4-6, is characterized in that, described reaction system comprises reaction system C and reaction system G, and wherein each 25 μ L reaction systems contain following component:

Damping fluid:

Deionized water adds to 25 μ L.

8., as a using method for the reaction system according to any one of claim 4-7, it is characterized in that, described method comprises the steps:

By complete for component mixing each needed for reaction system C and reaction system G, be positioned over thermostat water bath and react, heat up after reaction and carries out inactivation treatment, then according to system colour-change result of determination.

9. using method according to claim 8, is characterized in that, the temperature of described thermostat water bath is 55-70 DEG C, is preferably 58-61 DEG C, more preferably 60 DEG C;

Preferably, the described reaction times is 15-90min, is preferably 55-62min, more preferably 60min.

10. using method according to claim 8 or claim 9, is characterized in that, describedly according to system colour-change result of determination is:

Reaction system C is sky blue, and reaction system G is violet, then loci gene type to be measured is CC;

Reaction system C is violet, and reaction system G is sky blue, then loci gene type to be measured is GG;

Reaction system C is sky blue, and reaction system G is sky blue, then loci gene type to be measured is CG.