CN105420404A - Dual PCR (Polymerase Chain Reaction) primer for identifying campylobacter jejuni and campylobacter coli and identification method thereof - Google Patents
Dual PCR (Polymerase Chain Reaction) primer for identifying campylobacter jejuni and campylobacter coli and identification method thereof Download PDFInfo
- Publication number
- CN105420404A CN105420404A CN201610027763.4A CN201610027763A CN105420404A CN 105420404 A CN105420404 A CN 105420404A CN 201610027763 A CN201610027763 A CN 201610027763A CN 105420404 A CN105420404 A CN 105420404A
- Authority
- CN
- China
- Prior art keywords
- campylobacter
- pcr
- campylobacter jejuni
- primer
- coli
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention discloses a dual PCR (Polymerase Chain Reaction) primer for identifying campylobacter jejuni and campylobacter coli and an identification method thereof, which relate to a dual PCR primer and a detection method thereof. The primer is hipOF ATCAACATTGCGAGATAC, hipOR TAGACTTACAAGGCGAAT, cdtCF GGATATGCACTCTCAAGATTTG and cdtCR CTTGCTTAGTTCGGTTACAATAG. According to the dual PCR primer, specific hippuricase genes of the campylobacter coli and cdtC genes of the campylobacter jejuni are amplified, so as to establish a dual PCR method, amplification products of the hipO and cdtC genes are respectively 653bp and 313bp, and the two kinds of campylobacter can be detected in one PCR.
Description
Technical field
The present invention relates to a kind of double PCR primer and discrimination method thereof.
Background technology
Campylobacter jejuni (Campylobacterjejuni) and campylobacter coli (Campylobactercoli) belong to campylobacter, be the bacillary enteric pathogenic bacteria of people and animals' co-infection, humans and animals generation various diseases can be caused.Campylobacter shows harm in various degree to animals and humans, and bird infects this bacterium and diarrhea, liver sex change hemorrhage and egg drop reduction generally can be caused the symptom such as to be, turkey then can cause hepatitis and blue comb; Campylobacter jejuni also can cause sheep to miscarry, and causes great financial loss to aquaculture.Be acute enteritis to human disease's main manifestations, immunocompromised person also can secondary Guillain Barre syndrome (Guillain-Barrisyndrome, GBS).Campylobacter is mainly through drinking-water, the modes such as food are transmitted to animals and humans, its case load infected exceedes listeriosis, salmonellosis and shigellosis, caused by campylobacter jejuni more than 80% in the infection caused, about 10% is caused by campylobacter coli, and other Campylobacters also cause a disease once in a while.
In recent years, the report of China chicken group large-scale outbreak campylobacteriasis also gets more and more, although sickness rate is high, mortality ratio is low, how in chronic process, but it can not be ignored the impact that chicken group is potential, the clinical symptom that campylobacter jejuni and campylobacter coli infect is not obvious and be not easily distinguishable, and is therefore difficult to judge infection conditions by clinical symptom.Setting up quick and special detection method is the key point that efficient diagnosis campylobacter jejuni and campylobacter coli infect.At present mainly Zengjing Granule biochemical identification is identified to the conventional sense of Campylobacter, but because campylobacter jejuni and the campylobacter coli content in food samples is very low, growth conditions is harsher, conventional sense and authentication method loaded down with trivial details consuming time, along with the continuous discovery of false positive and false negative bacterial strain, some preliminary biochemical test projects can not effectively identify campylobacter jejuni and campylobacter coli, traditional discrimination method is faced with huge challenge, is therefore necessary to find the detection method more effectively differentiating campylobacter jejuni.In recent years along with molecular biology, particularly PCR method is fast-developing, has become quick, the instrument of reliable and Sensitive Detection pathogenic infection.PCR detection method has extensively applied at present among the isolation identification of bacterium, and it has simple, high specificity and susceptibility high fast.The target gene that the PCR method reported is commonly used has 16SrRNA, 23SrRNA, flaA or flaB, ceuE, cadF, hipO, cdtABC, glyA etc., and wherein hipO is specific to campylobacter jejuni, and it effectively can differentiate campylobacter jejuni.Cell lethality expansion toxin cdtC is one of important virulence factor of campylobacter coli.
Summary of the invention
The invention provides and a kind of differentiate campylobacter jejuni and campylobacter coli double PCR primer and discrimination method thereof.
The present invention selects hipO, and cdtC is target sequence, design Auele Specific Primer, sets up the discriminating of dual-PCR method for campylobacter jejuni and campylobacter coli.
One of the present invention differentiates campylobacter jejuni and campylobacter coli double PCR primer, is according to the campylobacter jejuni hipO gene order delivered in GenBank and campylobacter coli cdtC gene order, designs 2 pairs of Auele Specific Primers, specific as follows:
hipOFATCAACATTGCGAGATAC；
hipORTAGACTTACAAGGCGAAT；
cdtCFGGATATGCACTCTCAAGATTTG；
cdtCRCTTGCTTAGTTCGGTTACAATAG。
A kind of dual-PCR method differentiating campylobacter jejuni and campylobacter coli of the present invention, it carries out according to following steps:
One, the genomic dna of sample to be detected is extracted;
Two, with the genomic dna of step one for template, above-mentioned primer pair is put into same PCR reaction system, carries out pcr amplification;
Three, PCR primer detects through 1% agarose gel electrophoresis;
Four, amplified fragments is analyzed: have two amplified bands in 653bp and 313bp position, represent that sample is positive, simultaneously containing campylobacter jejuni and campylobacter coli in detected sample.
The present invention comprises following beneficial effect:
The present invention is by increasing to the specific histozyme gene (hipO) of campylobacter jejuni (comprising coli and De Lai subspecies) and campylobacter coli cdtC gene, set up dual-PCR method, to hipO, the amplified production of cdtC gene is respectively 653bp and 313bp, the difference of gene fragment size just can distinguish two bar segment on agarose gel electrophoresis, can detect two kinds of Campylobacters in a PCR.Pass through sequence homology analysis, bacterial strain hipO selected by the present invention, cdtC gene order and campylobacter jejuni and other bacterial strain homologys of campylobacter coli higher, therefore the foundation of this method is not only for the discriminating of campylobacter jejuni RM1221 bacterial strain and campylobacter coli RM5611 bacterial strain, and the campylobacter jejuni and the campylobacter coli that are also applicable to other bacterial strains are differentiated.The susceptibility of dual-PCR method reaches 6.68 × 10
-2μ g/ml; In specific test, campylobacter jejuni and campylobacter coli have specific band, other bacteriums do not amplify specific band, illustrate that the method has good specificity to campylobacter jejuni and campylobacter coli, and in Pass Test, the method is consistent with the result of single PCR method.The foundation of this method not only can accurately detect and identify campylobacter jejuni and campylobacter coli, greatly save cost and time that biochemical test consumes, and specificity, susceptibility are high, be more applicable for clinical sample isolation identification and epidemiology survey.The present invention not only can carry out Rapid identification to isolated suspicious bacterium colony, but also directly can carry out selective mechanisms to the enrichment liquid detecting sample, makes the separation of suspicious bacterial strain have more specific aim, thus improves recall rate.Realize campylobacter jejuni, campylobacter coli is easy, identify fast, can be applicable to all respects such as clinical diagnosis, food sanitation monitoring and import and export food the pathogenic microorganism examination, also provide support for sanitarian early warning.
Accompanying drawing explanation
Fig. 1 is the electrophorogram of the double PCR annealing temperature determined; Wherein, M:DL2000DNAMarker; 1:50 DEG C; 2:51 DEG C; 3:52 DEG C; 4:53 DEG C; 5:54 DEG C; 6:Negativecontrol;
Fig. 2 is PCR sensitivity Detection result electrophorogram; Wherein, M:DL2000DNAMarker; 1:66.8 μ g/ml; 2:6.68 μ g/ml; 3:6.68 × 10
-1μ g/ml; 4:6.68 × 10
-2μ g/ml; 5:6.68 × 10
-3μ g/ml; 6:6.68 × 10
-4μ g/ml; 7:Negativecontrol;
Fig. 3 is double PCR specific amplification experiment electrophorogram; Wherein, M:DL2000DNAMarker1:CampylobacterjejuniCampylobactercoli; 2: pasteurella multocida 3: monocyte Listeria; 4: clostridium perfringens; 5: salmonella typhi; 6: streptococcus aureus 7:Negativecontrol;
Fig. 4 is that clinical sample detects electrophorogram; Wherein, M:DL2000DNAMarker; 1: sample 1; Sample 2: sample 2; 3: sample 3; 4: sample 4; 5: sample 5; 6: sample 6; 7: sample 7; 8: sample 8; 9: sample 9; 10: sample 10; 11: sample 11; 12: sample 12; 13: sample 13; 14: sample 14; 15: sample 15; 16: sample 16; 17: sample 17; 18: sample 18; 19: sample 19; 20: sample 20.
Embodiment
Embodiment one: the one of present embodiment differentiates campylobacter jejuni and campylobacter coli double PCR primer, according to the campylobacter jejuni hipO gene order delivered in GenBank and campylobacter coli cdtC gene order, design 2 pairs of Auele Specific Primers, specific as follows:
hipOFATCAACATTGCGAGATAC；
hipORTAGACTTACAAGGCGAAT；
cdtCFGGATATGCACTCTCAAGATTTG；
cdtCRCTTGCTTAGTTCGGTTACAATAG。
Embodiment two: a kind of dual-PCR method differentiating campylobacter jejuni and campylobacter coli of present embodiment, it carries out according to following steps:
One, the genomic dna of sample to be detected is extracted;
Two, with the genomic dna of step one for template, above-mentioned primer pair is put into same PCR reaction system, carries out pcr amplification;
Three, PCR primer detects through 1% agarose gel electrophoresis;
Four, amplified fragments is analyzed: have two amplified bands in 653bp and 313bp position, represent that sample is positive, simultaneously containing campylobacter jejuni and campylobacter coli in detected sample.
Embodiment three: present embodiment and embodiment two unlike: the PCR system of pcr amplification is as follows:
Pcr amplification condition: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 52 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, and last 72 DEG C extend 5min.
Other is identical with embodiment two.
Content of the present invention is not limited only to the content of the respective embodiments described above, and the combination of one of them or several embodiment equally also can realize the object of inventing.
Beneficial effect of the present invention is verified by following examples:
Embodiment 1
1 materials and methods
1.1 test strain
Campylobacter jejuni RM1221, campylobacter coli RM5611 are purchased from ATCC; Pasteurella multocida, monocyte Listeria, clostridium perfringens, salmonella typhi, streptococcus aureus Jun You Harbin Veterinary Medicine Inst., China Academy of Agriculture preserve.
1.2 main agents
DL2000DNAMarker, Ex-TaqDNA polysaccharase, dNTP are all purchased from precious biotechnology Dalian company limited.
1.3 design of primers and synthesis
According to the campylobacter jejuni hipO gene order delivered in GenBank and campylobacter coli cdtC gene order, design 2 pairs of Auele Specific Primers, synthesize (see table 1) by Harbin Bo Shi biotech company.
Table 1 double PCR primer
The preparation of 1.4DNA template
Be inoculated on the TSA flat board containing 5% degreasing sheep blood after the campylobacter jejuni preserve glycerine and campylobacter coli melt at normal temperatures respectively, after inoculation, flat board is placed in sealed can, illustratively put into micro-aerobic aerogenesis bag, 24-48h is cultivated in 37 DEG C of micro-aerobic environments, picking list bacterium colony is cultivated in containing antibiotic brucella broth liquid nutrient medium, and water boil method extracts bacterial genomes DNA.
The optimization of 1.5PCR reaction conditions
PCR amplification system is 25 μ L:10 × ExBuffer2.5 μ L, dNTPs2 μ L, Ex-TaqDNA polysaccharase 0.25 μ L, hipO, and each 1 μ L of cdtC upstream and downstream primer, template are respectively 1 μ L, sterilizing ddH
2o14.25 μ L.By adding different concns dNTP, different concns primer, and according to different annealing temperature, reaction conditions is optimized.PCR primer detects through 1% agarose gel electrophoresis.
The sequential analysis of 1.6hipO, cdtC gene
The hipO of pcr amplification, cdtC gene is connected to pMD18-T carrier, is converted into DH5 α competent cell after reclaiming, and carries out enzyme cut qualification to the recombinant plasmid extracted, and send Harbin Bo Shi biotech company to check order the correct recombinant plasmid of qualification.In GenBank, use BLAST on-line analysis instrument, in GenBank, hipO, cdtC gene fragment order is analyzed.
The susceptibility of 1.7 double PCR amplifications
By the campylobacter jejuni of preparation and the mixing of campylobacter coli template equivalent, with the continuous 10 times of dilutions of the deionized water of sterilizing as double PCR reaction template, pcr amplification is carried out by the condition after optimizing, PCR primer is through 1% agarose gel electrophoresis, observe the brightness of object band, till absent variable band, determine greatest dilution.
The specificity of 1.8 double PCR amplifications
With the reaction conditions after optimization to campylobacter jejuni, campylobacter coli, pasteurella multocida, monocyte Listeria, clostridium perfringens, Salmonella typhi carries out double PCR detection, determines the specificity of the method.
1.9 Pass Test
23 parts are randomly drawed from through single PCR method qualification is containing the sample of Campylobacter, wherein 14 parts, campylobacter jejuni sample, 4 parts, campylobacter coli sample, contain 2 parts, the sample of campylobacter jejuni and campylobacter coli simultaneously, negative sample 3 parts, carry out double PCR detection, result and single PCR method result compare.
The PCR of 1.10 clinical samples detects
Gather the anus swab of 20 chickens, direct streak inoculation, in mCCDD substratum, is identified to the suspicious bacterium colony grown with the dual-PCR method set up and analyzes result after micro-aerobic cultivation 48h.
2 results
The optimum result of 2.1 double PCR amplification conditions
The amplified production of dual-PCR method to hipO and cdtC gene is respectively 653bp and 313bp; By on affecting the dNTP concentration of pcr amplification, the factor such as primer concentration and annealing temperature is optimized, this pcr amplification condition is finally defined as 95 DEG C of 5min; 95 DEG C of 30s, 52 DEG C of 30s, 72 DEG C of 30s, 30 circulations, last 72 DEG C extend 5min.DNTP final concentration 0.4mmol/L, hipO and cdtC primer final concentration is 25 μm of ol/L (see Fig. 1).
The sequential analysis of 2.2hipO, cdtC gene
Sequential analysis shows that campylobacter jejuni hipO gene order Campylobacter strains homology different from GenBank reaches 94%-99%, and campylobacter coli cdtC gene order campylobacter coli bacterial strain different from GenBank homology reaches 92%-98%.
The susceptibility of 2.3PCR amplification
Under the PCR reaction conditions optimized, carry out double PCR amplification to the template of 10 doubling dilutions, the susceptibility of this PCR method can reach 6.68 × 10
-2μ g/ml (see Fig. 2).
The specificity of 2.4PCR amplification
The pcr amplification condition after optimizing is utilized to carry out double PCR detection to reference culture and control strain, result campylobacter jejuni and campylobacter coli strain have amplified the gene fragment of hipO and cdtC, and other bacteriums then do not amplify specific fragment (see Fig. 3).
2.5 Pass Test results
Carry out double PCR detection to 23 samples chosen, result is that 2 samples detect campylobacter jejuni and campylobacter coli simultaneously, and 14 sample detection are to campylobacter jejuni, and 4 sample detection are to campylobacter coli, and result is consistent with single PCR result.Illustrate that campylobacter jejuni and the campylobacter coli double PCR authentication method of foundation can application in clinical Campylobacter detects.
The Preliminary Applications of 2.6PCR method
MCCDD substratum is inoculated in 20 the chicken anus swabs gathered, after micro-aerobic cultivation 48h, PCR qualification is carried out to the suspicious bacterium colony grown, the results are shown in Figure 4.Wherein sample 10 detects campylobacter jejuni and campylobacter coli simultaneously, sample 6 only detects campylobacter jejuni, sample 12 only detects campylobacter coli, result illustrates has 1 chicken to infect campylobacter jejuni and campylobacter coli simultaneously, 1 chicken only infects campylobacter jejuni, 1 chicken has only infected campylobacter coli, and other chickens had not both infected campylobacter jejuni and do not infected campylobacter coli yet.
From above-described embodiment, the method for the present embodiment is not only for the discriminating of campylobacter jejuni RM1221 bacterial strain and campylobacter coli RM5611 bacterial strain, and the campylobacter jejuni and the campylobacter coli that are also applicable to other bacterial strains are differentiated.The susceptibility of dual-PCR method reaches 6.68 × 10
-2μ g/ml, in specific test result, campylobacter jejuni and campylobacter coli have specific band, other bacteriums do not amplify specific band, illustrate that the method has good specificity to campylobacter jejuni and campylobacter coli, and in Pass Test, the method is consistent with the result of single PCR method.
Claims (3)
1. differentiate campylobacter jejuni and a campylobacter coli double PCR primer, it is characterized in that comprising following primer pair:
hipOFATCAACATTGCGAGATAC；
hipORTAGACTTACAAGGCGAAT；
cdtCFGGATATGCACTCTCAAGATTTG；
cdtCRCTTGCTTAGTTCGGTTACAATAG。
2. differentiate a dual-PCR method for campylobacter jejuni and campylobacter coli, it is characterized in that it carries out according to following steps:
One, the genomic dna of sample to be detected is extracted;
Two, with the genomic dna of step one for template, the primer pair of claim 1 is put into same PCR reaction system, carries out pcr amplification;
Three, PCR primer is through 1% agarose gel electrophoresis;
Four, amplification sheet is analyzed: have two amplified bands in 653bp and 313bp position, represent that sample is positive, containing campylobacter jejuni and campylobacter coli in detected sample.
3. a kind of dual-PCR method differentiating campylobacter jejuni and campylobacter coli according to claim 1, is characterized in that the PCR system of pcr amplification is as follows:
Pcr amplification condition: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 52 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, and last 72 DEG C extend 5min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610027763.4A CN105420404A (en) | 2016-01-15 | 2016-01-15 | Dual PCR (Polymerase Chain Reaction) primer for identifying campylobacter jejuni and campylobacter coli and identification method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610027763.4A CN105420404A (en) | 2016-01-15 | 2016-01-15 | Dual PCR (Polymerase Chain Reaction) primer for identifying campylobacter jejuni and campylobacter coli and identification method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105420404A true CN105420404A (en) | 2016-03-23 |
Family
ID=55498939
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610027763.4A Pending CN105420404A (en) | 2016-01-15 | 2016-01-15 | Dual PCR (Polymerase Chain Reaction) primer for identifying campylobacter jejuni and campylobacter coli and identification method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105420404A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111020039A (en) * | 2019-12-30 | 2020-04-17 | 广东省微生物研究所（广东省微生物分析检测中心） | Campylobacter jejuni species specific molecular target and rapid detection method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012073053A1 (en) * | 2010-11-30 | 2012-06-07 | Diagon Kft. | Procedure for nucleic acid-based molecular diagnostic determination of bacterial germ counts and kit for this purpose |
-
2016
- 2016-01-15 CN CN201610027763.4A patent/CN105420404A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012073053A1 (en) * | 2010-11-30 | 2012-06-07 | Diagon Kft. | Procedure for nucleic acid-based molecular diagnostic determination of bacterial germ counts and kit for this purpose |
Non-Patent Citations (3)
| Title |
|---|
| MAHDI GHORBANALIZADGAN等: "A Molecular Survey of Campylobacter jejuni and Campylobacter Coli Virulence and Diversity", 《IRANIAN BIOMEDICAL JOURNAL》 * |
| 刘俊华等: "实时荧光 PCR 方法快速检测空肠弯曲菌方法的建立", 《热带医学杂志》 * |
| 张腾飞等: "弯曲杆菌多重PCR检测方法的建立", 《湖北畜牧兽医》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111020039A (en) * | 2019-12-30 | 2020-04-17 | 广东省微生物研究所（广东省微生物分析检测中心） | Campylobacter jejuni species specific molecular target and rapid detection method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lindstrom et al. | Laboratory diagnostics of botulism | |
| Båverud et al. | Real-time PCR for detection and differentiation of Streptococcus equi subsp. equi and Streptococcus equi subsp. zooepidemicus | |
| Akbulut et al. | Development and application of real-time PCR assays to detect fragments of the Clostridium botulinum types A, B, and E neurotoxin genes for investigation of human foodborne and infant botulism | |
| CN103290119B (en) | Quintuple PCR (polymerase chain reaction) rapid detection method for main pathogenic bacteria in pork | |
| CN102363815B (en) | Reagent for detecting salmonellae by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for salmonellae | |
| CN105063218B (en) | The multiple quantitative PCR reagent kit of the difficult culture identification bacterium of four kinds of fast joint inspection | |
| Fach et al. | An innovative molecular detection tool for tracking and tracing Clostridium botulinum types A, B, E, F and other botulinum neurotoxin producing Clostridia based on the GeneDisc cycler | |
| CN104195266A (en) | Quadruple fluorogenic quantitative PCR kit for detecting three pathogens of infantile pneumonia | |
| Zhu et al. | Characterization of 23S rRNA gene mutation in primary and secondary clarithromycin-resistant Helicobacter pylori strains from East China | |
| CN102676664B (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| Singh et al. | Studies on occurrence and characterization of Clostridium perfringens from select meats | |
| CN102952886A (en) | Dual fluorescence quantitative PCR (polymerase chain reaction) detection method and detection kit for clostridium difficile enterotoxin A and B | |
| CN102634580A (en) | Primers and method for simultaneously detecting various pathogenic bacteria | |
| CN110468223B (en) | Primer, probe, kit and method for detecting nucleic acid of mycoplasma pneumoniae and bauxiella based on dUTP/UNG method | |
| CN105420404A (en) | Dual PCR (Polymerase Chain Reaction) primer for identifying campylobacter jejuni and campylobacter coli and identification method thereof | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN103305613B (en) | Giant salamander pathogenic hydrophila gingivalis PCR diagnostic kit | |
| CN104711351A (en) | Specific primer combination for detecting streptococcus pyogenes based on loop-mediated isothermal amplification method and application of specific primer combination | |
| CN102312013B (en) | Primers and probes for detecting 89K pathogenicity island genes of Streptococcus suis serotype 2, real-time fluorescence quantitative PCR method and kit thereof | |
| CN107299154A (en) | A kind of sheep Theileria luwenshuni and Anaplasma phagocytophilum double PCR primer special and dual PCR detection method | |
| Wang et al. | Construction of a one-step multiplex real-time PCR assay for the detection of serogroups A, B, and E of Pasteurella multocida associated with bovine pasteurellosis | |
| CN105087576A (en) | Detection kit for Yersinia rohdei causing enterocolitis and detection method | |
| AU2020103778A4 (en) | Primer Set for Detection of Streptococcus agalactiae, Detection Kit and Multiplex PCR Detection Method | |
| CN103740839A (en) | Universal type kit and method for detecting clostridium botulinum by fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| CN103014024B (en) | Target gene for detecting citrobacter freundii and detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160323 |