CN105420247B

CN105420247B - Rice adventitious root controls the application of gene C RLR1

Info

Publication number: CN105420247B
Application number: CN201510903118.XA
Authority: CN
Inventors: 毛传澡; 任美燕; 刘绍军; 胡晗; 吴运荣
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2015-12-09
Filing date: 2015-12-09
Publication date: 2018-09-07
Anticipated expiration: 2035-12-09
Also published as: CN105420247A

Abstract

The invention discloses the purposes of rice adventitious root control gene C RLR1 a kind of：Adjusting and controlling rice adventitious root generating ability, to adjust the root structure of rice, the final yield for improving crops.The rice adventitious root controls gene C RLR1 nucleotide sequences such as SEQ ID NO：Described in 1 or to add, replacing, be inserted into and lacking the allele and derivative that one or more nucleotide generate wherein.

Description

Rice adventitious root controls the application of gene C RLR1

Technical field

The invention belongs to plant genetic engineering fields.Specifically, the present invention relates to a kind of reverse genetrics approach clones Rice CRLR1 (Crown rootless1 recovery1) genes and transgenosis reply and RNAi technology experimental identification should Gene；It further relates to the root structure using the gene object adjusting and controlling rice adventitious root generating ability to adjust rice and improves crops Yield.

Background technology

Root system is plant anchoring and absorbs the vitals of moisture and nutrient from soil.Root system of plant can be divided mainly into directly Root system and the system of fibrous root.Fibrous root system plants root system is made of seminal root, adventitious root and lateral root, and adventitious root is fibrous root system plants root system Most important component part.Rice is the model plant of one of main cereal crops in the whole world and fibrous root system plants.

Adventitious root is the organ of postembryonal development, is generated in the stipes position of rice.Under normal circumstances, each section of rice is all There is adventitious root primordia, but the general adventitious root primordia in base portion section could develop and break through epidermis and form adventitious root.

Rice adventitious root former base originates in meristematic cell of the rhizome engaging portion adjacent to the pericycle innermost layer of vascular bundle.According to The genesis and development process of the report of Itoh etc. (2005), rice adventitious root can be divided into following 7 stages：Adventitious root primordia originates Cell is formed；Adventitious root primordia initiator cell becomes larger to form epidermis-endodermis initiator cell, central bundle initiator cell and root It is preced with initiator cell；Epidermis-endodermis initiator cell differentiation generates epidermis and endodermis；It is thin that endodermis cell differentiation generates cortex Born of the same parents；Stalace is generated, the basic structure of adventitious root is built up；Center pillar base cells start to extend, and cortical cell starts vacuolation；No Determine root restriction and finally breaks through the adventitious root that stem epidermis becomes ripe.

The research of molecular level far away from tectology research, up to the present, although there is several genes report shadows Ring adventitious root genesis and development, but relevant information also compare it is more scrappy.The mutation of CRL1/ARL1 and CRL4/GNOM1 is not all Determine root restriction initial period and generates defect, the two mutant (Inukai et related to the signal of auxin and transhipment respectively al.,2005；Liu et al.,2005；Kitomi et al.,2008；Liu et al.,2009).In addition Endogenous auxin The function gain mutation body of IAA3 Enhanced expressings and IAA23 also influence adventitious root occur (Nakamura et al., 2006；Ni et al.,2011).The mutation of WOX11 and CRL5 causes adventitious root primordia to largely reduce, the two mutant participate in auxin and Cytokinin signal, and regulate and control respectively in adventitious root growth course RR2 and RR1 genes expression (Zhao et al., 2009)。

Involved bibliography is specific as follows：

Inukai,Y.,Sakamoto,T.,Ueguchi-Tanaka,M.,Shibata,Y.,Gomi,K.,Umemura, I.,Hasegawa,Y.,Ashikari,M.,Kitano,H.,Matsuoka,M.(2005)Crown rootless1,which is essential for crown root formation in rice,is a target of an AUXIN RESPONSE FACTOR in auxin signaling.Plant Cell,17:1387-1396 is (as auxin response factor Downstream target gene participates in auxin signal pathway control Adventitious root initiation plant cells .17:1387-1396.).

Itoh,J.,Nonomura,K.,Ikeda,K.,Yamaki,S.,Inukai,Y.,Yamagishi,H.,Kitano, H.,Nagato,Y.(2005)Rice plant development:from zygote to spikelet.Plant Cell Physiol,46:23-47 (rice plant developments：From fertilized eggs to the growth course plant cell physiology .46 bloomed:23- 47.)。

Kitomi,Y.,Ogawa,A.,Kitano,H.,Inukai,Y.(2008)CRL4 regulates crown root formation through auxin transport in rice.Plant Root,2:(CRL4 of rice passes through tune to 19-28 Control auxin transhipment regulation and control Adventitious root initiation root systems of plant .2:19-28.).

Liu,H.,Wang,S.,Yu,X.,Yu,J.,He,X.,Zhang,S.,Shou,H.,Wu,P.(2005)ARL1,a LOB-domain protein required for adventitious root formation in rice.Plant J, 43:(ARL1 encodes the albumen of a LOB structural domain to 147-56, is Plant Js .43 necessary to rice adventitious root is formed: 147-56.)。

Liu,S.,Wang,J.,Wang,L.,Wang,X.,Xue,Y.,Wu,P.,Shou,H.(2009)Adventitious root formation in rice requires OsGNOM1 and is mediated by the OsPINs family.Cell Res,19:(OsGNOM1 is ground 1110-1119 by the formation cells of OsPINs families adjusting and controlling rice adventitious root Study carefully .19:1110-1119).

Nakamura,A.,Umemura,I.,Gomi,K.,Hasegawa,Y.,Kitano,H.,Sazuka,T.,and Matsuoka,M.(2006).Production and characterization of auxin-insensitive rice by overexpression of a mutagenized rice IAA protein.Plant J.46:297-306 (passes through increasing The I in Rice AA protein of one mutation of strongly expressed produces and describes the insensitive rice Plant Js .46 of auxin:297-306).

Ni,J.,Wang,G.,Zhu,Z.,Zhang,H.,Wu,Y.,and Wu,P.(2011).OsIAA23-mediated auxin signaling defines postembryonic maintenance of QC in rice.Plant J.68: (the auxin signal that OsIAA23 is mediated maintains Plant Js .433- to 433-442 after the embryo of rice quiescent center is determined 442)。

Zhao,Y.,Hu,Y.,Dai,M.,Huang,L.,Zhou,D.X.(2009)The WUSCHEL-Related Homeobox Gene WOX11 Is Required to Activate Shoot-Borne Crown Root Development in Rice.Plant Cell,21:((2009) WUSCHEL associated homologous box genes WOX11 is 736-748 Rice stem is activated to give birth to plant cells .21 necessary to indefinite root development:736-748).

Pearce,L.R.,Komander,D.,and Alessi,D.R.(2010).The nuts and bolts of AGC protein kinases.Nat.Rev.Mol.Cell Biol.11:(the detail of AGC protein kinases is natural by 9-22 Molecule and cell biology summarize .11:9-22).

Briggs,W.R.,and Christie,J.M.(2002).Phototropins 1 and 2:versatile plant blue-light receptors.Trends Plant Sci.7:204-210 (Phototropins 1 and 2：It is general Plant blue light receptor plant science trend .7:204-210).

L.,L.,Henriques,R.,and Anthony,R.G.(2003).Growth signalling pathways in Arabidopsis and the AGC protein kinases.Trends Plant Sci.8:424-431 (arabidopsis growth signals approach and AGC protein kinase plant science trend .8:424-431).

Rentel,M.C.,Lecourieux,D.,Ouaked,F.,Usher,S.L.,Petersen,L.,Okamoto, H.,Knight,H.,Peck,S.C.,Grierson,C.S.,Hirt,H.,and Knight,M.R.(2004).OXI1 kinase is necessary for oxidative burst-mediated signalling in Arabidopsis.Nature 427:(OXI1 kinases is that arabidopsis activity oxidative burst mediates necessary to signal path to 858-861 Natural .427:858-861).

Matsui,H.,Yamazaki,M.,Kishi-Kaboshi,M.,Takahashi,A.,and Hirochika,H. (2010).AGC kinase OsOxi1 positively regulates basal resistance through suppression of OsPti1a-mediated negative regulation.Plant Cell Physiol.51: (agc kinase OsOxi1 is thin by inhibiting the basic resistance plants of negative regulation approach positive regulation that OsPti1a is mediated by 1731-1744 Born of the same parents' physiology .51:1731-1744).

Hirt,H.,Garcia,A.V.,and Oelmuller,R.(2011).AGC kinases in plant development and defense.Plant Signal Behav.6:(agc kinase is in development of plants and prevents by 1030-1033 Effect plant signal behaviors .6 in imperial:1030-1033).

Hiei,Y.,Ohta,S.,Komari,T.and Kumashiro,T.(1994)Efficient Transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.Plant J.6:271-282 (passes through agrobacterium-mediated transformation height Imitate the analysis Plant Js .6 of rice transformation and T-DNA border sequences:271-282).

Jia,L.Q.,Wu,Z.C.,Hao,X.,Carrie,C.,Zheng,L.B.,Whelan,J.,Wu,Y.R.,Wang, S.F.,Wu,P.,and Mao,C.Z.(2011).Identification of a novel mitochondrial protein,short postembryonic roots 1(SPR1),involved in root development and Iron homeostasis in Oryza sativa.New Phytologist 189,843-855 (root long albumen after short embryo (SPR1), a new mitochondrial protein participates in rice root development and iron balance new plant scholars .189:843-855).

Invention content

The technical problem to be solved in the present invention is to provide the applications of rice adventitious root control gene C RLR1.

In order to solve the above technical problem, the present invention provides the purposes of rice adventitious root control gene C RLR1：Adjusting and controlling rice Adventitious root generating ability (number of adventitious root).To adjust the root structure of rice, the final yield for improving crops.

The rice adventitious root control gene C RLR1 nucleotide sequences such as SEQ ID NO of the present invention：Described in 1 (its protein Amino acid sequence such as SEQ ID NO：It is described shown in 2) or be addition wherein, substitution, insertion and the one or more cores of missing The allele and derivative that thuja acid generates.

The present invention goes back while providing a kind of transgenic plant cells：Including said gene and adding in its nucleotide sequence Add, replace, be inserted into and lack allele and derivative that one or more nucleotide generate.

The method for carrying out adventitious root generating ability transformation (number for adjusting adventitious root) to rice plant of the present invention is：Packet It includes with above-mentioned genetic transformation rice cell, the rice cell of conversion is cultivated into plant.

The object of the present invention is to provide a kind of new gene CRLR1 cloned from rice, such as SEQ ID NO：Shown in 1 DNA sequence dna also includes and SEQ ID NO：The gene order of at least 70% homology of DNA sequence dna shown in 1.In the present invention SEQ ID NO：Protein shown in 2 belongs to agc kinase gene family, wherein carrying out one or several replacements, is inserted into or lacks The functional analogue obtained.In addition, being also included within SEQ ID NO：Addition, substitution, insertion or deletion one or more core in 1 Thuja acid and mutant, allele or the derivative generated, sequence with the same function can also reach the purpose of the present invention.

It is a further object to provide a kind of methods carrying out root system improvement with CRLR1 genes, specifically, this Invention is provided with SEQ ID NO：The gene of sequence shown in 1 or the carrier of Gene Partial segment, the carrier can express Above-mentioned nucleotide sequence coded polypeptide or its homologs, and provide and convert plant cell using the plant expression vector Influence the method for rice adventitious root generating ability.

The candidate downstream genes CRLR1 that inventor passes through candidate differential gene expression screening to ARL1.CRLR1 belongs to AGC Kinase gene family, agc kinase family gene participates in growth, metabolism, cell division, proliferation and apoptosis in animal (Pearce et al.,2010).AGC family members participate in cotyledon development, phototropism, geotropism and disease resistance etc. in plant (Briggs and Christie,2002；et al.,2003；Rentel et al.,2004；Matsui et al., 2010；Hirt et al.,2011).The gene function most homologous with CRLR1 is still not clear in quasi- south, but tetraploid rice is high Gene has PHOT1,2 to participate in Phototropism and stomatal opening (Briggs and Christie, 2002).

Present invention firstly discovers that AGC family genes CRLR1 has the function of controlling rice adventitious root development, and CRLR1 is The downstream gene of ARL1.Since the normal genesis and development of adventitious root is to maintenance fibrous root system plants growth and development and stable high yield It is essential, therefore there are larger application potentials in molecular breeding.

Description of the drawings

Below in conjunction with the accompanying drawings to understanding that the present invention is described in further detail, but not invention is construed as limiting.

Fig. 1 is the tissue expression pattern figure of RT-PCR identifications CRLR1.

Utilize expression patterns of the RT-PCR analyses CRLR1 in root, basal part of stem and blade.

Fig. 2 is to express the parts CRLR1 in arl1 mutant to restore indefinite root growth figure；

A, 20 days Rooted Cuttings rhizome engaging portion figures, Bar=1cm；

B, wild type, arl1 mutant and CRLR1 transgenic seedling basal part of stem sectional views；

C, dCAPS labels confirmation transgenic seedling is arl1 backgrounds；

D, the expression of CRLR1 is detected using RT-PCR technology, ACTIN1 is as internal reference；

E, the expression of quantitative RT-PCR technology detection transgenic seedling CRLR1 is utilized；

F, different water planting time wild types, arl1 mutant, CRLR1 transgenic seedlings (arl1 backgrounds) indefinite radical system Meter.

Fig. 3 is expression quantity (RNAi) the reduction adventitious root number figure for reducing CRLR1；

A, RNAi transgenic lines seedling (Ri) the rhizome engaging portion of 25 days wild types and CRLR1；

B, in RNAi seedlings CRLR1 expression；

C, 20,30 days indefinite radical statistical results of seedling of water planting show that there are pole significance differences between wild type and RNAi strains Different P<0.01 (T-test, N=15).

Fig. 4 is the structural schematic diagram that overexpression and RNAi conversion carriers pCAMBIA1300 change.

Specific implementation mode

Realize that steps are as follows for particular technique of the invention：

One, the clone of CRLR1, identification：

Being screened by RT-PCR has the candidate of differential expression in wild type, arl1 mutant, ARL1 Enhanced expressing storerooms Gene, obtain one in ARL1 Enhanced expressing materials up-regulated expression and the gene of downward is expressed in mutant.It is quantitative RT-PCR is analysis shows the gene in basal part of stem expression quantity highest, and expresses weaker (Fig. 1) in leaf.

Two, the phenotype of Enhanced expressing CRLR1 genes energy partial recovery arl1 mutant adventitious roots missing：

Enhanced expressing carrier is constructed, Enhanced expressing CRLR1 genes, discovery turn base in arl1 mutant by transgenosis Because of the phenotype (Fig. 2A, 2F) of seedling energy partial recovery adventitious root missing, slice analysis shows to have turned the transgenic seedling adventitious root of CRLR1 Former base is restored (Fig. 2 B).DCAPS analytical proofs transgenic seedling is arl1 mutant backgrounds, and quantitative RT-PCR And semi-quantitative RT-PCR analysis shows that CRLR1 obtains Enhanced expressing (Fig. 2 D, 2E) in transgenic line.Show that CRLR1 is participated in not Determine the generation of root.

Three, the expression of CRLR1 genes in rice is inhibited to reduce adventitious root number：

RNAi carrier is constructed, a series of RNAi transgenic seedlings, quantitative RT-PCR knot are obtained by converting wild rice Fruit shows that the expression of CRLR1 genes in RNAi transgenic seedlings obtains a degree of inhibition.And to the indefinite radical of these RNAi Mesh statistical result shows that adventitious root number reduces about 30% (Fig. 3), shows that present invention obtains reduced number of turn of adventitious roots Trans-genetic hybrid rice, adventitious root number are related to the expression quantity of CRLR1 genes, it was demonstrated that it is indefinite that reduction CRLR1 gene expressions can be adjusted The number (Fig. 3) of root.

The above results show that rice CRLR1 genes that the present invention clones have certain application value, can be by using The gene pairs crop root structure carries out transgenosis transformation.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than the limitation scope of the invention.

Embodiment 1, CRLR1 gene clonings, identification

Using gene microarray analysis wild type (WT, the ferocious cogongrass of stone are purchased from the seed bank of China Paddy Rice Inst), The gene expression difference of arl1 mutant (by this laboratory screening) and ARL1 Enhanced expressings material (ARL1OV) is found wherein This gene of CRLR1 in ARL1 Enhanced expressing materials up-regulated expression and lowered in mutant, utilize quantitative RT-PCR (qRT- PCR this result) is also demonstrated.The Real Time PCR special agents of qRT-PCR experimental applications Roche companies480 SYBR Green I Master, PCR reactions exist480 (Roche, USA) quantitative PCRs It is carried out on instrument.The present invention has cloned the gene by PCR method, and sequencing analysis shows the coding sequence such as SEQ ID NO：1 show 1272bp (including terminator codon), encodes an albumen such as SEQ ID NO for including 423 amino acid：2.

Remarks explanation：Wild type (WT) is the ferocious cogongrass of stone, and mutant arl1 (adventitious rootless 1) is stone The mutant of the ARL1 gene mutations screened under ferocious cogongrass background；ARL1 Enhanced expressings material (ARL1OV) is ARL1 genes The transgenic line (Liu et., 2005) of Enhanced expressing.

Embodiment 2, Transgenic Rice

The method that the rice transformation system that Agrobacterium (EHA105) mediates mainly applies Hiei et al. (1994) report On the basis of optimize.Detailed process is as follows：

The preparation of Mature Embryos of Rice callus：

After the shelling of rice (the ferocious cogongrass of stone, SSBM) mature seed, the seed for selecting full bright and clean no bacterial plaque is put into beaker, With 70% (volume by volume concentration) alcohol disinfecting 2min；

Alcohol is removed, 25% (v/v) NaClO solution disinfections 30min is added；

NaClO solution is removed, with sterile water wash 5 times, 30min is impregnated in sterile water last 1 time；

Sterile water is removed, seed is placed on aseptic filter paper and is blotted, seed is lain against in long-grained nonglutinous rice mature embryo inducing culture, 28 DEG C of light cultures 10 days；

Culture dish is opened on superclean bench, and bud and endosperm are removed with tweezers, it is (yellowish to leave embryo callus It is color, fine and close irregular), it moves into long-grained nonglutinous rice subculture medium, 28 DEG C of light cultures 5-10 days.

The culture of Agrobacterium：

Picking Agrobacterium monoclonal or draw protected 100 μ l of Agrobacterium bacterium solution in 5ml YEP (Kan containing 50mg/L with 50mg/L Str) in culture solution, 28 DEG C, 250rpm shaken cultivations 12-36h to bacterium solution OD600 saturations；

500 μ l are drawn from the bacterium solution of above-mentioned saturation in 30ml YEP (Kan containing 50mg/L and 50mg/L Str) culture solution In, 28 DEG C, 250rpm shaken cultivations 12-16h to bacterium solution OD600=0.8-1.5.

Co-cultivation and the screening of kanamycin-resistant callus tissue：

It takes cultured bacterium solution 15ml in 50ml centrifuge tubes, 4 DEG C, 4000rmp, centrifuges 10min, remove supernatant；

Suspension is made with the 30ml AAM senses bacterium solution containing 200 μm of ol/L As, makes the final concentration of 0.4- of bacterium solution OD600 0.7；

The Rice Callus for growing to a certain size (about 1-2mm) is chosen, cutting granulates, and is put into Agrobacterium suspension Liquid, shaken cultivation 30min；

Callus is taken out, is placed on sterile filter paper and drains 30min；

Then callus is placed on the co-cultivation base for being placed with one layer of filter paper；

25 DEG C of light cultures took out callus after 2.5 days, with sterile water wash 5-6 times, needed ceaselessly to vibrate therebetween；

Again with the sterile water wash of the carbapen containing 250mg/L 1-2 times；

It is finally placed on aseptic filter paper and drains 2 hours；

The callus dried is transferred on the Selective agar medium of carbapen containing 250mg/L and 50mg/L hygromycin and is carried out First round selection, 28 DEG C, light culture 14 days；

The initial callus grown up is gone into carbapen containing 250mg/L and 50mg/L Hygromycin selection medias are enterprising The wheel selection of row second, 28 DEG C, light culture 14 days, resistant calli is grown at this time.

The differentiation of kanamycin-resistant callus tissue and seedling：

Kanamycin-resistant callus tissue 2-3 that picking comes from same callus is placed on differential medium, 25 DEG C of illumination cultivation (16h/8h light Period, light intensity 2000lx)；

Differentiation 30 days or so callus of culture can differentiate seedling, when seedling is grown to 3-5cm or so, be transferred to culture of rootage In base, 25 DEG C of illumination cultivations (16h/8h photoperiods, light intensity 2000lx).

The exercise and transplanting of transgenic seedling：

After taking root 14 days, the test tube that seedling root and cauline leaf break up more intact is chosen, opens sealed membrane, appropriate steam is added Distilled water or sterile water, in culturing room's hardening 2-3 days；

Agar is washed away, is transferred in rice nutrition liquid and cultivates 2 weeks, gained seedling is T₀For transgenic seedling, by the transgenosis of acquisition Positive seedling moves into crop field or potting, sowing.

The identification of transgenic positive seedling

T₀For the screening of positive transgenic seedling

T₀For transgenic seedling (temperature under normal operation：30 DEG C of daytime, 22 DEG C at night；Humidity>60%；Illuminance 30,000 LUX, are respectively 12 hours the time in the evening on daytime) hydroponics are after one week, and it takes the blade of 1cm long to extract genomic DNA, utilizes Resistance screening marker gene identifies transgenic seedling, screens successful transformation plant.

The extraction (TPS methods) of genomic DNA：

1. 2cm blades is taken to be placed in 2ml centrifuge tubes, 200 μ l TPS extracts (100mM Tris-HCl (pH are added 8.0), 10mMEDTA (pH 8.0), 1M KCl), one piece of steel ball is added, centrifuge tube lid is covered tightly, in tissue mashing instrument TissueLyser II (QIAGEN, U.S.A) shakes 1.5min.

2. the tissue smashed to pieces homogenate is transferred in new 1.5ml centrifuge tubes, 70 DEG C of warm bath 30min.

3.12000rpm centrifuges 10min, takes supernatant in another new 1.5ml centrifuge tubes.

4. adding isometric isopropanol, after the mixing that turns upside down, 12000rpm centrifuges 10min, abandons supernatant.

5. 900 μ l, 70% ethyl alcohol washing precipitation, 12000rpm is added to centrifuge 5min.

6. discarding ethyl alcohol, DNA is dried, later with 30 μ l ddH₂O dissolves.

Hygromycin gene detects：

Hygromycin gene primer sequence is：

Sense primer：5’TTTCTTTGCCCTCGGACGAGTGCT 3’

Downstream primer：5’ATGAAAAAGCCTGAACTCACCGCGAC 3’；

PCR system is：DNA 100ng, 0.2 μM of sense primer, 0.2 μM of downstream primer, 1 μ l of 10X PCR buffer, DNTP 0.2mM, TAQ archaeal dna polymerases 1U (Bao Sheng companies) plus ddH₂O to 10 μ l.

PCR conditions are 94 DEG C of denaturation 5min, subsequently into circular response：94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min, cycle Number is 28, finally extends 5min and terminates.2 μ l PCR products electrophoresis detection on 0.8% Ago-Gel is taken, Gel is then used Doc^TMXR+ (BIO-RAD, USA) imaging system records experimental result.

When testing result is to have amplified production, the T is assert₀It is hygromycin positive transgenic seedling for transgenic seedling, on the contrary It is then hygromycin feminine gender seedling.

Embodiment 3, in arl1 mutant Enhanced expressing CRLR1 genes

Enhanced expressing carrier P_35S::The structure of CRLR1：

CRLR1 full length cDNA sequences (SEQ ID NO have been cloned by PCR amplification method：Shown in 1), primer sequence is as follows, Upstream and downstream primer end adds the recognition site (underscore label) of SmaI and BamHI respectively.

Sense primer：5′aaaaCCCGGGCATGGACATCGACCTCGACCG 3′

Downstream primer:5′aaaaGGATCCCAGAGGCAGCAGCCACGTTAG 3′

It is template used in PCR reactions to be：The cDNA of 7 days seedling age SSBM wild types, polymerase used are PrimeSTAR HS DNA Polymerase (Bao Sheng companies).

PCR system is：DNA 100ng, 0.2 μM of sense primer, 0.2 μM of downstream primer, 2 μ l of 10X PCR buffer, DNTP 0.2mM, TAQ archaeal dna polymerases 1U (Bao Sheng companies) plus ddH₂O to 20 μ l.

PCR response procedures are：98 DEG C of denaturation 30sec；98 DEG C of 10sec, 60 DEG C of 7sec, 72 DEG C of 90sec, 30cycles；72 DEG C extend 10min terminate.PCR product is detached by 1.0% agarose gel electrophoresis, is tapped and recovered purpose band, is connected PEASY-Blunt Simple Cloning Vector (Bao Sheng companies) sequencing vector.After extracting plasmid enzyme restriction identification, to sun CRLR gene regions on property grain are sequenced, and the plasmid of no mutation is named as CRLRCDS-T.With the bis- enzymes of SmaI/BamHI CRLRCDS-T plasmids are cut, target fragment is separated by electrophoresis and is tapped and recovered, the pCAMBIA1300 being transformed through laboratory is connected into and changes load (Fig. 4) (Jia et al.2011) in body.It is identified by digestion, obtains positive vector P_35S::CRLR1.Described in embodiment 2 Agrobacterium-mediated transformation by CRLR1 Enhanced expressing carriers P_35S::CRLR1 converts arl1 mutant.A series of transgenic seedlings are obtained, Show that transgenic seedling CRLR1 obtains Enhanced expressing (Fig. 2 D, 2E) by hygromycin gene detection, RT-PCR.

Remarks explanation：The remodeling method that pCAMBIA1300 changes carrier is as follows：For in the EcoRI of pCAMBIA1300 carriers and A 35S promoter is accessed between two restriction enzyme sites of XmaI, and a NOS is accessed between two restriction enzyme sites of PstI and HindIII Terminator is shown in (Jia et al.2011).

The RT-PCR identifications of positive transgenic seedling are as follows：

It chooses 10 hygromycin positive strains and a hygromycin negative control strain extracts RNA, do reverse transcription, use RT- PCR method detects the relative expression quantity of CRLR1.Detailed process is as follows：

RNA extractions extract total serum IgE, 7 steps of experiment point using the plant RNA extraction kit of Tiangeng company：1. mortar is ground Pestle in 180 DEG C baking 2 hours it is spare to remove RNase；2. taking 50-100mg plant samples quick-frozen among liquid nitrogen；3. freezing Sample is fully ground crushing under state；Cell is set fully to crack 4. extracting solution is added；5. being filtered to remove fragment of tissue；6. purifying RNA in chromatographic column (deproteinized goes DNA, desalination)；7.RNase-free H2O elutions obtain RNA.Specific operation process reference Kit additionally book.

The synthesis of cDNA is completed using the SuperScript II RT kits of Invitrogen companies, reverse transcription system The dosage of middle total serum IgE is 3 μ g, and detailed process is with reference to kit additionally book.

Positive transformants strain is identified with quantitative and semi-quantitative RT-PCR method, quantitative RT PCR analysis and embodiment 1 Middle qRT-PCR the methods are completely the same.When Semiquatitative RT-PCR assay is identified, pass through reference gene OsActin1 (rice fleshes first Filamentous actin) the cDNA concentration of each sample is transferred to almost the same, then it is PCR as template to mix up the sample of concentration, expands CRLR One section of size of gene is the sequence of 234bp.PCR product is separated by electrophoresis on the Ago-Gel of 1.2% (m/v), then uses Gel Doc^TMXR+ (BIO-RAD, USA) imaging system records experimental result.Semiquatitative RT-PCR assay identifies the primer such as the following table 1： Wherein OsActin385F and OsActin385R is for reference gene OsAcin1 amplifications, and CRLR-RT-F and CRLR-RT-R are then Amplification for CRLR1.As a result CRLR1 is Enhanced expressing transgenosis compared to the strain of high 2 of arl1 mutant expression quantity or more Strain.

Table 1

The genetic background of Enhanced expressing transgenic line mutant is identified with dCAPS methods.DCAPS methods are divided into PCR, enzyme It cuts, three step of electrophoresis.This experiment devises PCR primer according to the mutational site of arl1 mutant, and sequence is as follows：

Sense primer：5’CAAGTTTCTGCGGCACAAGTGCGTCTGC 3’

Downstream primer：5’AGATGGGGTCGCGGAGGCGGGCCTG 3’

Amplified fragments size is 157bp, and PCR conditions are:95℃5min；95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 30 are followed Ring；72 DEG C of 5min terminate.It takes 1 μ l PCR products to do digestion, is then separated by electrophoresis on the polyacrylamide gel of 12% (m/v) DNA fragmentation (120V, 2 hours).Silver staining 10-15min after electrophoresis develops the color 5-10 minutes, then uses scanner (EPSON 4990 PHOTO of PERFECTION) record experimental result.As a result electrophoretic band and mutant arl1 mono- obtained by Enhanced expressing strain It causes (Fig. 2 C), shows that gained Enhanced expressing transgenic seedling is the transgenosis of arl1 backgrounds.

To Enhanced expressing transgenic seedling carry out adventitious root number statistical the result shows that, the adventitious root of wild type (SSBM) plant Number is constantly increasing, the adventitious root numbers of CRLR1 overexpression plant since the tenth day increase, and mutant arl1 is not Radical mesh is determined without what variation (Fig. 2A, 2F).The adventitious root phenotype of 20 days seedling ages is as shown in Figure 2 A, overexpresses plant adventitious root Number is at 7 or so, and only there are one adventitious roots to occur for only a few mutant, and the adventitious root of WT lines keeps count of on 20 left sides It is right.For the overexpression plant adventitious root number of 40 days seedling ages all at 18 or so, mutant arl1 only has 1-2 adventitious root, wild The adventitious root number of type plant is at 48 or so.

The above result shows that the adventitious root missing phenotype of mutant arl1 mutant has been restored in the overexpression part of CRLR1.

Embodiment 4 inhibits the expression of CRLR1 genes in rice

The structure of RNA interference carrier

The construction step of interference is essentially：

Make the specific regions (with the lower region of other genetic homologies of rice) that CRLR genes are searched by sequence alignment For the target site of interference, target sequence (the sequence SEQ ID NO that one section of size that then design primer clones the region is 190bp： Underscore part in 1).Clone target sequence primer be：

Upstream：CATGCCACCAAGCCCGACC

Downstream：ACGAGAACGACTTCCCCCACGAC

The sequence is cloned by PCR, PCR reaction conditions are 94 DEG C of denaturation 5min, subsequently into circular response：94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, recurring number 30 finally extend 5min and terminate.

The DNA fragmentation forward direction sequence is connect to the reverse sequence for connecing the preceding paragraph DNA sequence dna after the preceding paragraph intron sequences again, Then this whole section of sequence is connected into 35S-1300 overexpression vectors (Jia et al.2011) by SacI, SalI, is obtained RNAi expression vector.

It is as follows：1.PCR expands the DNA fragmentation, and PCR product and pUCm-T carriers (are given birth to the limited public affairs of work in Shanghai Department) it connects, the plasmid connected obtains two segments with Pst I, BamH I and Pst I, Sal I digestions respectively.Two segments are (just To reversely) it is connected into two steps in pBSSK-in carriers.Pst I, BamH I digestion pBSSK-in are first used, after connecting a segment, NsiI again, SalI digestion connect another segment (Pst I and NsiI is isocaudarner).2. use SacI, SalI by two segments and they Between intron cut, be connected into 35S-1300 overexpression vectors (Fig. 4).Vector construction is transferred to Agrobacterium tumefaciems after completing In competent cell.

A series of RNAi transgenic seedlings, transgenic positive are obtained using the method conversion wild rice described in embodiment 2 The identification of seedling is the same as " RT-PCR of positive transgenic seedling is identified " in embodiment 3.

Quantitative RT-PCR result shows that the expression of CRLR1 genes in RNAi transgenic seedlings obtains a degree of inhibition (figure 3B).Show to obtain the repressed RNAi transgenic seedlings of CRLR1 genes, and unites to the adventitious root number of these RNAi transgenic seedlings Meter shows that present invention obtains the reduced number of transgenosis of adventitious root the result shows that adventitious root number reduces about 30% (Fig. 3 A) Rice, adventitious root number are related to the expression quantity of CRLR1 genes, it was demonstrated that adventitious root can be adjusted by reducing CRLR1 gene expressions Number (Fig. 3).

Finally, it should also be noted that it is listed above be only the present invention several specific embodiments.Obviously, this hair Bright to be not limited to above example, acceptable there are many deformations.Those skilled in the art can be from present disclosure All deformations for directly exporting or associating, are considered as protection scope of the present invention.

<110>Zhejiang University

<120>Rice adventitious root controls geneCRLR1Application

<160> 2

<210> 1

<211> 1272

<212> DNA

<213>Rice（Oryza sativa）

<400> 1

atggacatcg acctcgaccg ggcgcgcgcc ctgcgcgtcc tcggccgagg cgccatgggc 60

accgtcttcc tcgtcgaggc ccggtacggc ggcttccgct acgccctcaa ggtgttcgac 120

aagcggtccg ccgcggcgac caggcacgac gccgagcgcc gcgcgcggtg ggagctgtcc 180

gtgctctccc gcctcgcgca cccgcacctc ccgtgcctcc tcggctccgc cgagacgccc 240

ggcctcctcg cgtgggccgt cccctactgc cccggcggcg acctcaacga gctccgctac 300

gcgctccccg accgcgtctt ctccccggcg gcgatacgct tctacgtcgc cgagatcgtg 360

tccgcgctgt gcgagctcca cgcgtcgggc gtggcgtacc gcgacctcaa gcccgagaac 420

gtgctcctcc gcgccgacgg ccatgtcacc ctcaccgact tcgacctctc ccgcctcctc 480

cctcccaaga cggcggcgcc gtcgtccgcg tcgccgccgc cgcgcatgtt ccagggcggc 540

ggccaccgcc cgcgcgtctc ggcgaggagc gagatccctc tcttcagcca tgccaccaag 600

cccgacccct cgccgccggc ggcgaacccg tcggcgaagc agcagctcca gagcctggtc 660

cggttcatca tgaagggcga caggagcgag ctgtccaaga aggccaagtc ggcgcgggtg 720

tcgccggtga gccggaagcc ggcgagcttc gcgtcgtcgt gggggaagtc gttctcgttc 780

gtgggcacgg aggagtacgt ggcgccggag atggtgaggg gcgagggcca cgggctcgcc 840

gtcgactggt gggccgtcgg cgtgctcgcc tacgagatgg cgtacgggcg gacgccgttc 900

aagggcaaga accggaagga gacgttccgg aacgtgctcc tcaaggacgt ggagttcgcc 960

ggcgacagcc gccgccggct gccggagctc accgacctca tctcgcggct gctggagagg 1020

gaccccagga agaggctggg gtaccaaggc ggcgccgacg aggtccgagc tcacccgttc 1080

ttcgccggcg tggcgtggga catgctcgac gtggtgtccc ggccgcccta catcccgccg 1140

ccggctgacg acggcgacga ggtagtcggc gacggagaag acttcagcat aagagaatac 1200

ttcgataagc ttcaccagcc gccgccgccg gagtcggaga gctcctcgtc ggagttctcg 1260

tcggagttct aa 1272

<210> 2

<211> 423

<212> PRT

<213>Rice（Oryza sativa）

<400> 2

Met Asp Ile Asp Leu Asp Arg Ala Arg Ala Leu Arg Val Leu Gly

1 5 10 15

Arg Gly Ala Met Gly Thr Val Phe Leu Val Glu Ala Arg Tyr Gly

20 25 30

Gly Phe Arg Tyr Ala Leu Lys Val Phe Asp Lys Arg Ser Ala Ala

35 40 45

Ala Thr Arg His Asp Ala Glu Arg Arg Ala Arg Trp Glu Leu Ser

50 55 60

Val Leu Ser Arg Leu Ala His Pro His Leu Pro Cys Leu Leu Gly

65 70 75

Ser Ala Glu Thr Pro Gly Leu Leu Ala Trp Ala Val Pro Tyr Cys

80 85 90

Pro Gly Gly Asp Leu Asn Glu Leu Arg Tyr Ala Leu Pro Asp Arg

95 100 105

Val Phe Ser Pro Ala Ala Ile Arg Phe Tyr Val Ala Glu Ile Val

110 115 120

Ser Ala Leu Cys Glu Leu His Ala Ser Gly Val Ala Tyr Arg Asp

125 130 135

Leu Lys Pro Glu Asn Val Leu Leu Arg Ala Asp Gly His Val Thr

140 145 150

Leu Thr Asp Phe Asp Leu Ser Arg Leu Leu Pro Pro Lys Thr Ala

155 160 165

Ala Pro Ser Ser Ala Ser Pro Pro Pro Arg Met Phe Gln Gly Gly

170 175 180

Gly His Arg Pro Arg Val Ser Ala Arg Ser Glu Ile Pro Leu Phe

185 190 195

Ser His Ala Thr Lys Pro Asp Pro Ser Pro Pro Ala Ala Asn Pro

200 205 210

Ser Ala Lys Gln Gln Leu Gln Ser Leu Val Arg Phe Ile Met Lys

215 220 225

Gly Asp Arg Ser Glu Leu Ser Lys Lys Ala Lys Ser Ala Arg Val

230 235 240

Ser Pro Val Ser Arg Lys Pro Ala Ser Phe Ala Ser Ser Trp Gly

245 250 255

Lys Ser Phe Ser Phe Val Gly Thr Glu Glu Tyr Val Ala Pro Glu

260 265 270

Met Val Arg Gly Glu Gly His Gly Leu Ala Val Asp Trp Trp Ala

275 280 285

Val Gly Val Leu Ala Tyr Glu Met Ala Tyr Gly Arg Thr Pro Phe

290 295 300

Lys Gly Lys Asn Arg Lys Glu Thr Phe Arg Asn Val Leu Leu Lys

305 310 315

Asp Val Glu Phe Ala Gly Asp Ser Arg Arg Arg Leu Pro Glu Leu

320 325 330

Thr Asp Leu Ile Ser Arg Leu Leu Glu Arg Asp Pro Arg Lys Arg

335 340 345

Leu Gly Tyr Gln Gly Gly Ala Asp Glu Val Arg Ala His Pro Phe

350 355 360

Phe Ala Gly Val Ala Trp Asp Met Leu Asp Val Val Ser Arg Pro

365 370 375

Pro Tyr Ile Pro Pro Pro Ala Asp Asp Gly Asp Glu Val Val Gly

380 385 390

Asp Gly Glu Asp Phe Ser Ile Arg Glu Tyr Phe Asp Lys Leu His

395 400 405

Gln Pro Pro Pro Pro Glu Ser Glu Ser Ser Ser Ser Glu Phe Ser

410 415 420

Ser Glu Phe

423

Claims

1. rice adventitious root controls the purposes of gene C RLR1, it is characterized in that：Adjusting and controlling rice adventitious root generating ability；Rice is indefinite Root controls gene C RLR1 nucleotide sequences such as SEQ ID NO：1 or coding amino acid sequence such as SEQ ID NO：Shown in 2.

2. the purposes of rice adventitious root control gene C RLR1 according to claim 1, it is characterized in that：Adjust the root of rice Architecture, the final yield for improving crops.