CN105420206B

CN105420206B - A kind of glutamine transaminage that thermal stability improves

Info

Publication number: CN105420206B
Application number: CN201511028185.8A
Authority: CN
Inventors: 刘松; 童理明; 陈坚; 堵国成
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2015-12-31
Filing date: 2015-12-31
Publication date: 2019-05-10
Anticipated expiration: 2035-12-31
Also published as: CN109897838A; CN109897838B; CN109897839B; CN105420206A; CN109971733B; CN109897839A; CN109971733A

Abstract

A kind of glutamine transaminage, the glutamine transaminage that especially a kind of thermal stability improves.The raising of enzyme heat stability is realized by the short skin of the amalgamation and expression parents of the N-terminal in maturase.

Description

A kind of glutamine transaminage that thermal stability improves

Technical field

The present invention relates to a kind of glutamine transaminage, especially a kind of glutamine transaminage of thermal stability raising.

Background technique

Glutamine transaminage (Transglutaminase, EC 2.3.2.13, TGase), is that amide can occur for one kind Group-transfer reaction, eventually forms the albumen of ε-(γ-glutamyl) lysine covalent bond.Based on above-mentioned catalysis reaction presence, TGase can promote between various protein molecules, the hydrolysis of intramolecular crosslinking and glutamine residue, to improve protein Various functional properties, such as emulsibility, dissolubility etc.；Meanwhile TGase can be by such as relying ammonia for some small-molecule substances Acid etc. introduces protein, the nutritive value of Lai Zengjia protein.Therefore, TGase is widely applied in the market as having characteristic Food additives are in the working process of the food such as Flour product, dairy products, a word used in place name baked goods, meat products and aquatic products, market demand It is extremely huge.TGase special catalytic capability makes it have extensive use in the industrial productions such as food, weaving, but it is catalyzed Activity is lower, thermal stability is poor, so that TGase is severely limited as the application of excellent catalyst in the industry. Therefore, the hot spot of current research largely all concentrates on the thermal stability for how improving TGase.Therefore based on having obtained Expression platform in Escherichia coli is inserted into small peptide by the N-terminal in maturase, to molecular modification is carried out, is desirably to obtain zymology Matter is more suitable for the TGase of industrial application.

Self assembly parents small peptide (SAPs) is alternately distributed by hydrophobic hydrophilic amino acid, is spontaneously assemble into special small peptide, shape At hydrogel the macromoleculars such as albumen can be immobilized, in molectronics, cell culture, nanometer biotechnology and life Object medicine etc. has huge application potential.SAPs and albumen terminal fusion, can improve catalytic efficiency and the thermostabilization of enzyme Property.

Summary of the invention

The glutamine transaminage improved the technical problem to be solved by the present invention is to obtain a kind of thermal stability, by The short skin of the amalgamation and expression parents of the N-terminal of ripe enzyme realizes the raising of enzyme heat stability, and sequence is as shown in SEQ ID NO.1 or in SEQ The amino acid sequence that glutamine transaminage enzymatic activity remains unchanged after being lacked, being mutated on the basis of ID NO.1.

The amino acid sequence of the glutamine transaminage can also be as shown in SEQ ID NO.2, shown in SEQ ID NO.3 Or shown in SEQ ID NO.4.Above-mentioned glutamine transaminage has merged parents' short peptide sequence in the N-terminal of maturase.

Technical problem in order to solve the above problem, the present invention use following example:

1, the acquisition of the short skin gene of parents designs corresponding DNA sequence according to the amino acid sequence of the short skin of parents on primer Column.

2, with S.hygroscopicus pro-TGase expression plasmid pET-22b (+)/pro-TG (Liu S, Zhang D, Wang M,Cui W,Chen K,Du G,Chen J,Zhou Z.The order of expression is a key factor in the production of active transglutaminase in Escherichia coli by Co-expression with its pro-peptide.Microb Cell Fact, 2011,10 (112): 1-7) it is template, Carry out full plasmid PCR.

3, pET-22b (+)/pro-SAP-TG connected is rotated into JM109, rotates into E.coli BL21 after sequencing is correct (DE3)。

Culture medium:

Seed culture medium (LB): yeast powder 5g/L, tryptone 10g/L, NaCl 10g/L, (pH 7.0).

Fermentation medium (TB): yeast powder 24g/L, tryptone 12g/L, glycerol 5g/L, K₂HPO₄72mmol/L, KH₂PO₄17mmol/L, (pH 7.0).

Cultural method:

Seed culture condition: LB culture medium, with 250mL shaking flask culture, liquid amount 10%, cultivation temperature is 37 DEG C, is turned Speed is 220rpm, incubation time 10h.

Conditions of flask fermentation: TB culture medium is cultivated using 250mL shaking flask, liquid amount 10%, inoculum concentration 3%, Cultivation temperature is 37 DEG C, revolving speed 220rpm, and when OD600 reaches 2.0, the IPTG of final concentration of 0.4mmol/mL is induced, 20 DEG C Fiber differentiation 48h.

The heat-staple detection method of purpose enzyme:

Purpose enzyme is applied into the separation means such as affinity chromatography respectively, obtains electrophoretically pure purpose enzyme.By purpose enzyme certain At a temperature of keep the temperature, measurement enzyme activity compared to the first beginning and end keep the temperature when lose required for the time.

Enzyme activity determination method:

Colorimetric method for determining enzyme activity.For Pidolidone-γ-mono- Hydroxylamine HCL as standard curve, α-N-CBZ-GLN-GLY is bottom Object.The TGase enzyme activity of 1 unit is defined as: under conditions of 37 DEG C, be catalyzed the L- paddy that above-mentioned substrate synthesizes 1 μm of ol per minute Enzyme amount (U/mL) used in propylhomoserin-γ-mono- Hydroxylamine HCL.Enzyme activity determination condition: 10min is reacted under the conditions of 37 DEG C.

The present invention is short to the N-terminal insertion parents in STG maturase using high efficient expression of the STG in Escherichia coli as platform Peptide has obtained the mutant strain of thermostabilization raising, and thermostabilization improves 70%, and improved enzyme is more suitable for industrial application, can reduce Production cost improves production efficiency.

Specific embodiment

Next by the following examples the present invention is furture elucidated, and the experiment side of actual conditions is not specified in the following example Method is substantially all and is operated according to condition described in common molecular cloning handbook.

The acquisition of 1 parents' small peptide of embodiment

The amino acid sequence of the short skin of parents obtains AEAEAKAKAEAEAKAK, DNA sequence corresponding to the sequence by amino acid Column design is on primer:

Upstream primer M-F:GCAGAAGCAGAAGCGAAAGCCAAAGCGGAGGCGGAAGCTAAGGCTAAACGGG CCCC CGACGCTGC

Downstream primer M-R:GAAGAGCGCACTGACGCTCGGC

Building of the embodiment 2 in the recombinant bacterial strain of maturase N-terminal insertion parents' small peptide

Using S.hygroscopicus pro-TGase expression plasmid pET-22b (+)/pro-TG as template, with above-mentioned implementation Primer carries out full plasmid PCR in example 1.

3 recombinant bacterial strain fermenting and producing TGase of embodiment

Correct plasmid will be sequenced, be named as N, Transformed E .coli BL 21 selects transformant and is inoculated into LB Liquid Culture In base, 37 DEG C, 12h is cultivated, is transferred in TB culture medium, inoculum concentration 3% works as OD₆₀₀It is final concentration of when reaching 2.0 The IPTG of 0.4mmol/mL is induced, 20 DEG C of Fiber differentiation 48h.

Embodiment 4 compares the thermostabilization of recombinant bacterial strain Yu wild TGase

Fermentation supernatant is collected, fermentation supernatant enzyme activity is detected, and His- ni-sepharose purification is carried out to sample, to after purification The K of TGase_mValue and t_1/2It is measured, the results are shown in Table 2, compares in N-terminal insertion its thermostabilization of parents' small peptide of maturase Wild TGase improves 71% (table 1).

1 glutamine transaminase zymologic property of table compares

Embodiment 5 does rite-directed mutagenesis to the site P132 on the basis of maturase N-terminal is inserted into parents' small peptide

Using site-directed mutagenesis kit, to the site P132 on the basis of maturase N-terminal is inserted into parents' small peptide, S150 Point, the site the Y100 site P305 do rite-directed mutagenesis, sport N-P132I, N-S150G, N-Y100M, N-P305Q (SEQ respectively ID NO.2-5) transformant is by the raw work sequencing in Shanghai.Correct plasmid will be sequenced, purified according to fermentation described previously, and survey its heat Stability (table 2).

2 glutamine transaminase mutant zymetology Nature comparison of table

Claims

1. the glutamine transaminage that a kind of thermal stability improves, which is characterized in that amino acid sequence such as SEQ ID NO.2 institute Show.

2. the method for preparing glutamine transaminage described in claim 1, which is characterized in that by parents' short peptide fusion expression to paddy The N-terminal of glutamine transaminase maturase.