CN105385770A - Dual-ring hairpin probe mediate label-free strand displacement amplification method for detecting bleomycin - Google Patents
Dual-ring hairpin probe mediate label-free strand displacement amplification method for detecting bleomycin Download PDFInfo
- Publication number
- CN105385770A CN105385770A CN201510961410.7A CN201510961410A CN105385770A CN 105385770 A CN105385770 A CN 105385770A CN 201510961410 A CN201510961410 A CN 201510961410A CN 105385770 A CN105385770 A CN 105385770A
- Authority
- CN
- China
- Prior art keywords
- probe
- dual
- bleomycin
- ring
- ring hairpin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a dual-ring hairpin probe mediate label-free strand displacement amplification method for detecting bleomycin. The method includes the steps that when bleomycin exists, a dual-ring hairpin probe fractures at a recognition site, and a triggering sequence is released; the triggering sequence and a ring part of a signal probe are combined and subjected to a strand displacement amplification reaction under the effect of a polymerase and a nicking enzyme, and finally a great number of G-four-chain sequences are generated. At the same time, a primer chain extends to open the signal probe, and therefore the G-four-chain sequences packaged in the neck of the signal probe can be exposed. Finally, NMM molecules are bound to the G-four-chain sequences to generate fluorescence signals, and bleomycin is quantified through the detected fluorescence signals. As the triggering sequence is designed at the neck of the dual-ring hairpin probe, background signals of a detection system are reduced; by combining bleomycin cutting and the strand displacement amplification reaction, bleomycin can be detected sensitively, and the detection limit is 0.34 nm. The method has the advantages of being easy to operate, free of labeling and good in specificity.
Description
Technical field
The present invention relates to a kind of detection method of bleomycin, particularly relate to a kind of Dual-ring hairpin probe mediation detecting bleomycin and exempt from mark strand displacement amplification method.
Background technology
Bleomycin takes turns branch bacillus by Streptomycin sulphate to secrete the class glycopeptide antibiotics produced.Clinically, bleomycin is a kind of important cancer therapy drug, is mainly used in treating various diseases (R.H.Blum, S.K.CarterandK.Agre, Cancer, 1973,31,903 such as squamous cell carcinoma and scavenger cell knurl; M.Froudarakis, E.Hatzimichael, L.Kyriazopoulou, K.Lagos, P.Pappas, A.G.Tzakos, V.Karavasilis, D.Daliani, C.PapandreouandE.Briasoulis, CriticalReviewsinOncology/Hematology, 2013,87,90; Y.Akiyama, Q.Ma, E.Edgar, A.LaikhterandS.Hecht, JournaloftheAmericanChemicalSociety, 2008,130,9650; R.A.GirouxandS.M.Hecht, JournaloftheAmericanChemicalSociety, 2010,132,16987; Z.Yu, R.Schmaltz, T.Bozeman, R.Paul, M.Rishel, K.TsosieandS.Hecht, JournaloftheAmericanChemicalSociety, 2013,135,2883.).But application bleomycin treatment kinds cancer, usually supervenes dose-limiting toxicity, such as renal toxicity, (S.Sleijfer, Chest, 2001,120,617 such as pulmonary toxicity and pulmonary fibrosis; J.Hay, S.ShahzeidiandG.Laurent, ArchivesofToxicology, 1991,65,81.).Therefore, in order to monitor bleomycin concentration, reducing toxicity, obtaining best result for the treatment of, how to build the main contents that a kind of bleomycin detection method becomes analytical work person's research.At present, investigators establish the quantitative analysis of multiple detection method for bleomycin, such as high performance liquid chromatography (R.P.Klett, J.P.ChovanaandI.H.Danse, JournalofChromatography:BiomedicalSciencesandApplication, 1984,310,361; G.K.ShiuandT.J.Goehl, JournalofChromatographyB:BiomedicalSciencesandApplicatio ns, 1980,181,127.), enzyme immunoassay (K.Fujiwara, M.YasunoandT.Kitagawa, CancerResearch, 1981,41,4121), radio immunoassay (J.Teale, J.CloughandV.Marks, BritishJournalofCancer, 1977,35,822; A.BroughtonandJ.E.Strong, CancerResearch, 1976,36,1418.) and microbiological analysis (T.Ohnuma, J.F.Holland, H.Masuda, J.A.WaligundaandG.A.Goldberg, Cancer, 33,1230.) etc.But these methods have time-consuming usually, effort, the shortcoming such as be detrimental to health and cost is higher.Therefore, need to set up a kind of newly, sensitive, special detection method, for clinical bleomycin concentration monitor provides a kind of more simple and convenient analytical plan.
It is reported, when oxygen and the metal ion with redox active exist, bleomycin can by the method cutting DNA chain of oxidation deoxynucleotide, and its primary recognition site is 5 '-GT-3 ' and 5 '-GC-3 ' (Q.Ma, Y.Akiyama, Z.D.Xu, K.KonishiandS.M.Hecht, JournaloftheAmericanChemicalSociety, 2009,131,2013; J.Chen, M.K.Ghorai, G.KenneyandJ.Stubbe, NucleicAcidResearch, 2008,36,3781.).Based on this character of bleomycin cutting DNA chain, investigators devise the DNA molecular probe of various identification bleomycin, to build a kind of bleomycin detection method of simple and sensitive.At present, these DNA molecular probes are mainly divided into two classes.The first kind is strand or hair clip DNA (B.C.Yin, D.WuandB.C.Ye, AnalyticalChemistry, 2010,82,8272 of signaling molecule combination or mark; Y.Li, C.C.Huang, J.B.Zheng, H.L.Qi, W.CaoandY.M.Wei, BiosensorsandBioeletronics, 2013,44,177; Y.F.Qin, Y.F.Ma, X.Jin, L.L.Zhang, G.J.YeandS.L.Zhao, AnalyticaChimicaActa, 2015,866,84; F.Li, Y.Feng, C.Zhao, P.LiandB.Tang, ChemicalCommunications, 2012,48,127.).After this kind of probe and bleomycin effect, can releasor molecule, and produce corresponding signal response.Equations of The Second Kind is the function neck-circular DNA structure (F.L.Gao, J.P.LeiandH.X.Ju, ChemicalCommunications, 2013,49,7561.) with triggers sequencer.After this kind of probe and bleomycin effect, can discharge triggers sequencer and triggering signal amplified reaction, be that repeated signal produces event by a cracking event representation.Therefore, this kind of DNA molecular probe is more conducive to the strength of signal and the sensitivity that improve detection method.The people such as Gao devise a neck with two 5 '-GC-3 ' recognition sites, and ring portion is the function hairpin probe of one section of triggers sequencer, for the highly sensitive detection (F.L.Gao of bleomycin, J.P.LeiandH.X.Ju, ChemicalCommunications, 2013,49,7561.).But because triggers sequencer is positioned at the ring portion of probe, the non-specific hybridization between not cut DNA molecular probe and subsequent reactions chain, can cause relatively high background signal and false positive signal, this limits the application of this probe to a certain extent.
Summary of the invention
Object of the present invention is exactly to solve the problem, and provides a kind of Dual-ring hairpin probe mediation detecting bleomycin to exempt from mark strand displacement amplification method.
To achieve these goals, the present invention adopts following technical scheme:
A kind of Dual-ring hairpin probe identifying and detect bleomycin, described Dual-ring hairpin probe comprises: two ring portions, recognition site and triggering sites, described two ring portions are: have the end-rings of a DNA arm and have the neck bulge loop of two DNA arms, described recognition site is positioned at the neck of Dual-ring hairpin, described triggers sequencer is used for triggering following amplification iodine, and the base in described triggers sequencer participates in the DNA arm and the neck bulge loop that form Dual-ring hairpin probe.
A mark strand displacement amplification method is exempted from the Dual-ring hairpin probe mediation detecting bleomycin, and when target compound bleomycin exists, Dual-ring hairpin probe ruptures at recognition site place, and discharges triggers sequencer; Then, triggers sequencer combines with the ring portion of signal probe, and under the effect of polysaccharase and nicking enzyme, strand displacement amplification reaction occurs, produce a large amount of fluorescence dye binding sequences, meanwhile, primer strand extends to be opened signal probe, and the fluorescence dye binding sequence that signal probe neck is sealed up for safekeeping is exposed, finally, fluorescence dye binding sequence binding fluorescence molecule, produces fluorescent signal, carries out quantitatively by the fluorescent signal detected to bleomycin; Described Dual-ring hairpin probe as described in the appended claim 1.
Preferred: the fluorescence dye binding sequence of described signal probe neck is G-tetra-serobila sequence, and described fluorescence molecule is NMM.
Preferred: described recognition site is 5 '-GTGC-3 '.
Preferred: described triggers sequencer is 5 '-GAGGAAGAAGAGAGGGAAGGA-3 ' (as shown in SEQIDNo:1).
Preferred: the sequence of described Dual-ring hairpin probe is TCCTTCCCTCTCAAAACCTCGCACCAAAAGGTGC
gAGGAAGAAGAGAGGGAAGGA(as shown in SEQIDNo:2).
The sequence of fluorescent probe is CCCAACCCGCCCTACCCTTTTT
gATCCtTCCCTCTCTTCTTCCTCCCTCAAAAAGGGTAGGGCGGGTTGGG (as shown in SEQIDNo:3).
Preferred: the concrete steps of strand displacement amplification reaction are: get 1 μ L2mMdNTPs, 1UKF polysaccharase, 4UNt.AlwI, 3 μ L0.75 μMs of SPand2 μ L10 × NEBbuffer2 (10mMTris-HCl, 10mMMgCl
2, 50mMNaCl, 1.0mMdithiothreitol, pH7.9) and add above-mentioned reaction system, react 40 minutes at 37 DEG C.
Preferred: in described amplification method, Dual-ring hairpin probe is 100nM, and signal probe is 75nM, and archaeal dna polymerase is 1U, and nicking restriction endonuclease is 4U, NMM concentration is 6 μMs.
Detect a test kit for bleomycin, comprise Dual-ring hairpin probe and signal probe, described Dual-ring hairpin probe as described in the appended claim 1; Described signal probe is hairpin structure, and the neck of described signal probe has fluorescence dye binding sequence; The triggers sequencer of described Dual-ring hairpin probe and the ring portion sequence of signal probe are matched, fluorescence molecule, archaeal dna polymerase, nicking restriction endonuclease, 10 × NEBbuffer2 (10mMTris-HCl, 10mMMgCl
2, 50mMNaCl, 1.0mMdithiothreitol, pH7.9).
Beneficial effect of the present invention:
The present invention constructs a kind of Dual-ring hairpin probe, for identification and the detection of bleomycin.Dual-ring hairpin probe mainly comprises two regions: bleomycin 5 '-GTGC-3 ' recognition site and triggers sequencer.In addition, Dual-ring hairpin probe has two ring portions, and the ring wherein with two DNA arms is called neck bulge loop.Different from function hairpin probe of the prior art, the triggers sequencer of Dual-ring hairpin probe seals the neck at probe up for safekeeping with semi-enclosed pattern, effectively prevent non-specific hybridization.Semiclosed pattern, namely in triggers sequencer, most of base participates in the DNA arm forming neck bulge loop both sides, and (triggers sequencer of the Dual-ring hairpin probe used in the such as embodiment of the present invention is: 5 '-GAGG only to have sub-fraction base to form neck bulge loop
aAGAAgAGAGGGAAGGA-3 ', only the subparticipation neck bulge loop of underscore, all the other form the DNA arm of both sides).This Design Mode has two outstanding advantages.On the one hand, Dual-ring hairpin probe utilizes the reticent triggers sequencer of the mode of hybridization in molecule, effectively avoids non-specific hybridization.On the other hand, after Dual-ring hairpin probe generation cleavage reaction, generate the double-spiral structure of a centre with neck bulge loop; Because neck bulge loop reduces double-stranded stability, triggers sequencer complementary strand incomplete with it untwists, and then generates stable duplex with abundant base number and subsequent reactions chain, the obvious positive signal of final generation.Based on this Dual-ring hairpin probe, and in conjunction with strand displacement amplification (SDA) reaction, the present invention constructs a novel fluorescence sensing platform and detects for bleomycin.The method produces a large amount of DNA single chain and G-tetra-serobilas/NMM mixture emitting fluorescence by strand displacement amplification reaction, and the bleomycin achieved first based on amplification technique exempts from marker detection.Produce by single-stranded DNA product and the signal probe binding NMM dye molecule opened the fluorescent signal strengthened, the method shows superior sensitivity.The detection of method is limited to 0.34nM, and the method has simple to operate, exempts from the advantage marked and specificity is good.In addition, the experiment of the human serum rate of recovery has been carried out in experiment, and result shows that this detection method has larger clinical application potential.
Accompanying drawing explanation
Fig. 1 is the BLM detection system experimental principle figure built based on dicyclo identification probe and strand displacement amplification reaction, A. bleomycin cutting Dual-ring hairpin probe, release triggers sequencer, and under the effect of polysaccharase, signal probe is opened, expose one section of G-tetra-serobila sequence, B., after triggers sequencer is combined with signal probe, strand displacement amplification reaction under the effect of repolymerization enzyme and nicking enzyme, is triggered;
Fig. 2 (A) is polyacrylamide gel electrophoresis checking bleomycin cracking and strand displacement amplification iodine; M:DNAladder; (1) BHP; (2) SP; (3) BHP+BLM; (4) BHP+BLM+SP; (5) BHP+BLM+SP+KFpolymerase; (6) BHP+BLM+SP+KFpolymerase+Nt.AlwI; (7) BHP+SP+KFpolymerase+Nt.AlwI; (B) detection system fluorescence emission spectrum: Curvea, BHP+SP+KFpolymerase+Nt.AlwI+NMM; Curveb, BHP+BLM+SP+KFpolymerase+Nt.AlwI+NMM;
Fluorescence spectrum under the different bleomycin concentration of Fig. 3 (A): curve a → h is followed successively by 0nM, 2nM, 5nM, 20nM, 100nM, 150nM, 200nM, 220nM; (B) linear relationship between fluorescence response and bleomycin concentration;
Fig. 4 is the impact of different target thing on detection system fluorescence response.
Embodiment
Below in conjunction with accompanying drawing and embodiment, the invention will be further described.
Material and instrument Dual-ring hairpin probe (BHP) and signal probe (SP) oligonucleotide sequence are by SangonBiotechnologyCo., Ltd. (Shanghai, China) synthesis and purifying.Pingyangmycin, mitomycin and daunorubicin are purchased from National Institute for Food and Drugs Control.Dactinomycin is purchased from MelonePharmaceuticalCo., Ltd. (Dalian, China).Iron protochloride (FeCl
2 ●h
2o) purchased from Tianjin recovery fine chemistry industry institute.Klenowfragment (3 '-5 ' exo-) polysaccharase and Nt.AlwI are purchased from NewEnglandBiolabsLtd. (Beijing, China).DNTPs is purchased from ThermoFisherScientificLtd. (China).NMM is purchased from FrontierScientificInc. (Utah, USA).Affiliated hospital of Shandong University taken from by clinical serum sample.Every other chemical reagent is analytical pure.In experiment, the aqueous solution used is all with ultrapure water configuration (resistivity >18.25M Ω
●cm).
15mM phosphate buffered saline buffer: 13.4mMNa
2hPO
4, 1.6mMNaH
2pO
4with 50mMNaCl (pH=8.0).
Fluorescence spectrum utilizes luminoscope HitachiF-2500 (Japan) to scan acquisition at ambient temperature.Excitation wavelength 399nM, sweep limit 550nM-680nM.Excite and launch slit width and be 10nM.Real-time voltage 700V.
Bleomycin activation and the reaction of Dual-ring hairpin probe cleavage: first, Dual-ring hairpin probe and signal probe, respectively at 95 DEG C of annealing 5 minutes, progressively cool to room temperature, for subsequent use; Then, bleomycin mixes with iron protochloride isoconcentration and hatches 30 minutes at ambient temperature, obtains the bleomycin activated; Finally, above-mentioned bleomycin and Dual-ring hairpin probe are fully mixed, at 37 DEG C, hatches 30 minutes, make bleomycin abundant cracking Dual-ring hairpin probe.
Strand displacement amplification reacts: after treating that scission reaction completes, get 1 μ L2mMdNTPs, 1UKF polysaccharase, 4UNt.AlwI, 3 μ L0.75 μMs of SPand2 μ L10 × NEBbuffer2 (10mMTris-HCl, 10mMMgCl
2, 50mMNaCl, 1.0mMdithiothreitol, pH7.9) and add above-mentioned reaction system, react 40 minutes at 37 DEG C.
Fluorescence measurement: after treating that strand displacement amplification has reacted, get 1.2 μ L150 μM NMM, 4.8 μ L1MKCl add reaction system, hatch 30 minutes at 37 DEG C.Get end reaction gained solution 30 μ L and be placed in fluorescence pond, carry out spectral scan according to sweep parameter described in material and instrument portion.
Gel electrophoresis: the 10% probe cleavage reaction of polyacrylamide gel electrophoresis checking Dual-ring hairpin and strand displacement amplification reaction.In order to clearly observe DNA band, we adopt the bleomycin of high density, and Dual-ring hairpin probe and signal probe are tested.Get the solution 10 μ L that end reaction obtains, fully mix with 6 × loadingbuffer2 μ L, loading, run glue.Finally, the DNA gel ethidium bromide (EB) obtained is dyeed 5 minutes, after clear water rinses, be placed in imaging under ultraviolet imagery system.
Result and discussion
Experimental principle
As shown in Figure 1, first, bleomycin, at recognition site place cracking Dual-ring hairpin probe, produces a new short hairpin and the centre duplex with neck bulge loop.Because neck bulge loop reduces double-stranded stability, duplex untwists and discharges section of DNA sequence, and this sequence designations is cutting primer strand (Cut-primer is called for short CP).Then, cutting primer strand is combined with the ring portion of signal probe, and under the effect of KF polysaccharase, is that template strand extends, forms a double-spiral structure with nicking enzyme Nt.AlwI recognition site with signal probe.Then, nicking enzyme produces a new polymerase binding site point in the nicking of recognition site place.So polymerase extension, copies chain release and the circulation of nicking enzyme nicking process is carried out, and finally creates a large amount of strand G-tetra-serobila sequence; Meanwhile, primer strand extends opening signal probe, exposes the G-tetra-serobila sequence of sealing up for safekeeping at signal probe neck.Finally, G-tetra-serobila sequence binding NMM, produces detectable fluorescent signal.
Feasibility is verified
In order to verify whether Dual-ring hairpin probe can play a role according to above-mentioned design process and the feasibility of analytical plan, We conducted 10% polyacrylamide gel electrophoresis experiment.As shown in Figure 2 A, comparing with swimming lane 1, to have there is darker DNA band in swimming lane 3 in identical position, and occurs a new DNA band in the position near 20bp.This illustrates that Dual-ring hairpin probe there occurs scission reaction.Added by signal probe in bleomycin and the complete solution of Dual-ring hairpin probe reaction, swimming lane 4 has occurred that a travelling speed is considerably slower than the new DNA band of signal probe.This new DNA is with explanation, and after scission reaction occurs, CP chain is released, and hybridizes double-spiral structure with the ring portion of SP in conjunction with formation one.Add KF polysaccharase, having there is a bright DNA band in swimming lane 5, CP chain is described with SP chain for template, under the effect of polysaccharase, chain extension reaction occurs in the position of 60bp, generates a more stable DNA double spiral.When KF polysaccharase and nicking enzyme add reaction system simultaneously, swimming lane 6 occurs that a travelling speed is with faster than the DNA of 20bp, illustrates that SDA reaction creates a large amount of single strand dnas.Swimming lane 7 only has the DNA of Dual-ring hairpin probe and signal probe to be with, and illustrates that Dual-ring hairpin probe duplexes structure has enough stability, and SDA reaction does not occur system.In order to prove the feasibility of Dual-ring hairpin probe design and analytical plan further, We conducted corresponding fluorescence spectrum scanning experiment.As Fig. 2 B, when target compound does not exist, detection system shows low background signal (Curvea).When this illustrates and does not have scission reaction to occur, the CP sequence in Dual-ring hairpin probe can not be used to strand displacement amplification reaction and produce signal.When target compound bleomycin adds reaction system, detection system shows the response signal (Curveb) significantly improved.After this illustrates that scission reaction occurs, CP sequence is released and produces for the reaction of follow-up strand displacement amplification the fluorescent signal strengthened.Above result all shows, this detection scheme is feasible, and Dual-ring hairpin probe successfully reticently can trigger chain, thus the background signal that attenuating or elimination non-specific hybridization bring in homogeneous analysis.
Experimental condition optimization
In order to obtain best sensing usefulness, experiment is respectively to Dual-ring hairpin concentration and probe concentration, and signal probe concentration, the parameters such as enzyme concn and NMM concentration are optimized.Final selection Dual-ring hairpin probe is 100nM, and signal probe is 75nM, KF polysaccharase be 1U, Nt.AlwI be 4U, NMM concentration is 6 μMs.
Linear and scope
Under optimum experiment condition, we have investigated sensitivity and the linearity range of detection system.As shown in Figure 3, when bleomycin concentration increases gradually from 0nM to 220nM, fluorescence response intensity is also along with increase.Fluorescence intensity and bleomycin concentration linear within the scope of 0nM-220nM (R=0.998).Detectability 0.34nM.
Specificity
In order to the specificity investigating method, experiment is chosen bleomycin, mitomycin, daunorubicin and dactinomycin and is investigated respectively as target compound.As shown in Figure 4, under identical experiment condition, detection system only shows stronger response signal to bleomycin to result, shows that this detection method has good specificity.
The rate of recovery is investigated
In order to investigate the actual application ability of present method, We conducted the experiment of the human serum rate of recovery.Experimental result, between 95%-100%, illustrates that the method has potential clinical application ability.
Sum up
Based on the strand displacement amplification reaction of Dual-ring hairpin probe mediation, this work constructs the Sensitive Detection of a kind of fluorescence strategy of exempting to mark for bleomycin.As far as we know, the bleomycin that the method achieves first based on DNA cloning technology exempts from marker detection.Detection is limited to 0.34nM.The human serum rate of recovery is investigated and is met the requirements, and illustrates that the method has potential actual application ability in pharmaceutical analysis and clinical application.
By reference to the accompanying drawings the specific embodiment of the present invention is described although above-mentioned; but not limiting the scope of the invention; one of ordinary skill in the art should be understood that; on the basis of technical scheme of the present invention, those skilled in the art do not need to pay various amendment or distortion that creative work can make still within protection scope of the present invention.
Claims (10)
1. the Dual-ring hairpin probe identifying and detect bleomycin, it is characterized in that: described Dual-ring hairpin probe comprises: two ring portions, recognition site and triggering sites, described two ring portions are: have the end-rings of a DNA arm and have the neck bulge loop of two DNA arms, described recognition site is positioned at the neck of Dual-ring hairpin, and the base in described triggers sequencer participates in the neck and the neck bulge loop that form Dual-ring hairpin probe.
2. a mark strand displacement amplification method is exempted from the Dual-ring hairpin probe mediation detecting bleomycin, it is characterized in that: when target compound bleomycin exists, Dual-ring hairpin probe ruptures at recognition site place, and discharges triggers sequencer; Then, triggers sequencer combines with the ring portion of signal probe, and under the effect of polysaccharase and nicking enzyme, strand displacement amplification reaction occurs, produce a large amount of fluorescence dye binding sequences, meanwhile, primer strand extends to be opened signal probe, and the fluorescence dye binding sequence that signal probe neck is sealed up for safekeeping is exposed, finally, fluorescence dye binding sequence binding fluorescence molecule, produces fluorescent signal, carries out quantitatively by the fluorescent signal detected to bleomycin; Described Dual-ring hairpin probe as described in the appended claim 1.
3. method as claimed in claim 2, is characterized in that: the fluorescence binding sequence of described signal probe neck is G-tetra-serobila sequence, and described fluorescence molecule is NMM.
4. method as claimed in claim 2, is characterized in that: described recognition site is 5 '-GTGC-3 '.
5. method as claimed in claim 2, is characterized in that: described triggers sequencer is as shown in SEQIDNo:1.
6. method as claimed in claim 2, is characterized in that: the sequence of described Dual-ring hairpin probe is as shown in SEQIDNo:2.
7. method as claimed in claim 2, is characterized in that: the sequence of fluorescent probe is as shown in SEQIDNo:3.
8. method as claimed in claim 2, is characterized in that: the concrete steps of strand displacement amplification reaction are: get 1 μ L2mMdNTPs, 1UKF polysaccharase, 4UNt.AlwI, 3 μ L0.75 μMs of SPand2 μ L10 × NEBbuffer2 (10mMTris-HCl, 10mMMgCl
2, 50mMNaCl, 1.0mMdithiothreitol, pH7.9) and add above-mentioned reaction system, react 40 minutes at 37 DEG C.
9. the method for claim 1, is characterized in that: in described amplification method, and Dual-ring hairpin probe is 100nM, and signal probe is 75nM, and archaeal dna polymerase is 1U, and nicking restriction endonuclease is 4U, NMM concentration is 6 μMs.
10. detect a test kit for bleomycin, it is characterized in that: comprise Dual-ring hairpin probe and signal probe, described Dual-ring hairpin probe as described in the appended claim 1; Described signal probe is hairpin structure, and the neck of described signal probe has fluorescence dye binding sequence; The triggers sequencer of described Dual-ring hairpin probe and the ring portion sequence of signal probe are matched, fluorescence molecule, archaeal dna polymerase, nicking restriction endonuclease, 10 × NEBbuffer2 (10mMTris-HCl, 10mMMgCl
2, 50mMNaCl, 1.0mMdithiothreitol, pH7.9).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510961410.7A CN105385770B (en) | 2015-12-18 | 2015-12-18 | The Dual-ring hairpin probe for detecting bleomycin mediates label-free strand displacement amplification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510961410.7A CN105385770B (en) | 2015-12-18 | 2015-12-18 | The Dual-ring hairpin probe for detecting bleomycin mediates label-free strand displacement amplification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105385770A true CN105385770A (en) | 2016-03-09 |
| CN105385770B CN105385770B (en) | 2018-09-28 |
Family
ID=55418545
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510961410.7A Active CN105385770B (en) | 2015-12-18 | 2015-12-18 | The Dual-ring hairpin probe for detecting bleomycin mediates label-free strand displacement amplification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105385770B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950755A (en) * | 2016-06-17 | 2016-09-21 | 山东大学 | Method for detecting microRNA based on split-type recognition mode and cascade signal amplification strategy |
| CN105950757A (en) * | 2016-06-17 | 2016-09-21 | 山东大学 | Method for detecting bleomycin based on double-ring hairpin probe and enzyme-mediated cascade amplification strategy |
| CN106244703A (en) * | 2016-08-26 | 2016-12-21 | 山东大学 | Strand replacement reaction based on sticky end mediation combines the method for polymerization nicking isothermal amplification technique detection UDG activity |
| CN106520764A (en) * | 2016-12-16 | 2017-03-22 | 福州大学 | Nano di-cyclic aptamer probe and application thereof |
| CN107151694A (en) * | 2016-09-30 | 2017-09-12 | 山东大学 | The Cascaded amplification strategy of ring mediation is used for highly sensitive detection dnmt rna activity |
| WO2019153677A1 (en) * | 2018-02-08 | 2019-08-15 | 中国农业大学 | New method for visual quantitative detection of dual heavy metal ions |
| CN117571982A (en) * | 2024-01-09 | 2024-02-20 | 德州学院 | Marker-free fluorescent aptamer sensor for detecting kanamycin with low background and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103439319A (en) * | 2013-09-03 | 2013-12-11 | 青岛科技大学 | Method for measuring bleomycins by utilizing electrochemical luminescence of carbon nanoparticle modified electrode |
-
2015
- 2015-12-18 CN CN201510961410.7A patent/CN105385770B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103439319A (en) * | 2013-09-03 | 2013-12-11 | 青岛科技大学 | Method for measuring bleomycins by utilizing electrochemical luminescence of carbon nanoparticle modified electrode |
Non-Patent Citations (3)
| Title |
|---|
| FENGLEI GAO ET AL.: "Ultrasensitive fluorescence detection of bleomycin via exonuclease III-aided DNA recycling amplification", 《CHEM. COMMUN.》 * |
| HUIJUAN WANG ET AL.: "A bicyclo-hairpin probe mediated strand displacement amplificationstrategy for label-free and sensitive detection of bleomycin", 《SENSORS AND ACTUATORS B: CHEMICAL》 * |
| YONGZHENG XING ET AL.: "A Responsive Hidden Toehold To Enable Controllable DNA Strand Displacement Reactions", 《ANGEW. CHEM. INT. ED.》 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950755A (en) * | 2016-06-17 | 2016-09-21 | 山东大学 | Method for detecting microRNA based on split-type recognition mode and cascade signal amplification strategy |
| CN105950757A (en) * | 2016-06-17 | 2016-09-21 | 山东大学 | Method for detecting bleomycin based on double-ring hairpin probe and enzyme-mediated cascade amplification strategy |
| CN105950757B (en) * | 2016-06-17 | 2019-11-22 | 山东大学 | Method based on the cascade amplification strategy detection bleomycin that Dual-ring hairpin probe and enzyme mediate |
| CN105950755B (en) * | 2016-06-17 | 2020-05-08 | 山东大学 | Method for detecting microRNA based on split recognition mode combined with cascade signal amplification strategy |
| CN106244703A (en) * | 2016-08-26 | 2016-12-21 | 山东大学 | Strand replacement reaction based on sticky end mediation combines the method for polymerization nicking isothermal amplification technique detection UDG activity |
| CN106244703B (en) * | 2016-08-26 | 2019-12-13 | 山东大学 | method for detecting UDG activity based on sticky end-mediated strand displacement reaction combined with polymerization nicking isothermal amplification technology |
| CN107151694A (en) * | 2016-09-30 | 2017-09-12 | 山东大学 | The Cascaded amplification strategy of ring mediation is used for highly sensitive detection dnmt rna activity |
| CN106520764A (en) * | 2016-12-16 | 2017-03-22 | 福州大学 | Nano di-cyclic aptamer probe and application thereof |
| CN106520764B (en) * | 2016-12-16 | 2019-02-22 | 福州大学 | A kind of nanometer-double-ring aptamers probe and its application |
| WO2019153677A1 (en) * | 2018-02-08 | 2019-08-15 | 中国农业大学 | New method for visual quantitative detection of dual heavy metal ions |
| CN117571982A (en) * | 2024-01-09 | 2024-02-20 | 德州学院 | Marker-free fluorescent aptamer sensor for detecting kanamycin with low background and application thereof |
| CN117571982B (en) * | 2024-01-09 | 2024-04-09 | 德州学院 | Marker-free fluorescent aptamer sensor for detecting kanamycin with low background and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105385770B (en) | 2018-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105385770A (en) | Dual-ring hairpin probe mediate label-free strand displacement amplification method for detecting bleomycin | |
| Zhou et al. | CRISPR/Cas12a based fluorescence-enhanced lateral flow biosensor for detection of Staphylococcus aureus | |
| Wang et al. | A fluorescent biosensor for protein detection based on poly (thymine)-templated copper nanoparticles and terminal protection of small molecule-linked DNA | |
| Low et al. | Sequence-specific binding of echinomycin to DNA: evidence for conformational changes affecting flanking sequences | |
| Ye et al. | Ultrasensitive electrochemical DNA sensor for virulence invA gene of Salmonella using silver nanoclusters as signal probe | |
| Zhang et al. | Aptamer‐based turn‐on detection of thrombin in biological fluids based on efficient phosphorescence energy transfer from Mn‐doped ZnS quantum dots to carbon nanodots | |
| Chen et al. | Enzyme-free detection of DNA based on hybridization chain reaction amplification and fluorescence resonance energy transfer | |
| Chen et al. | Methylation-blocked enzymatic recycling amplification for highly sensitive fluorescence sensing of DNA methyltransferase activity | |
| CN105132524A (en) | Application of dual application reaction of Exo (exonuclease) III-assisted cycle and DNAzyme cycle to Hg<2+> detection | |
| Haque et al. | DNA-associated click chemistry | |
| Liu et al. | Label-free dsDNA-Cu NPs-based fluorescent probe for highly sensitive detection of L-histidine | |
| CN111455026A (en) | Method for detecting thrombin based on fluorescence double-signal enzyme-free amplification strategy of aptamer and application of method | |
| Wang et al. | A metal ion-triggered and DNA-fueled molecular machine for amplified and sensitive fluorescent detection of Hg2+ | |
| Gao et al. | Ultrasensitive fluorescence detection of bleomycin via exonuclease III-aided DNA recycling amplification | |
| Huang et al. | An electrochemical biosensor for the highly sensitive detection of Staphylococcus aureus based on SRCA-CRISPR/Cas12a | |
| Tian et al. | DNAzyme amplification of molecular beacon signal | |
| Jeon et al. | Efficient capture and isolation of tumor-related circulating cell-free DNA from cancer patients using electroactive conducting polymer nanowire platforms | |
| Chen et al. | MnO2 microsphere absorbing Cy5-labeled single strand DNA probe serving as powerful biosensor for effective detection of mycoplasma ovipneumoniae | |
| CN106755284A (en) | It is a kind of based on the cascade DNA amplification machine of label-free molecular beacon and application | |
| CN113684317B (en) | Ultra-sensitive rapid detection and identification system for B type and C type hepatitis B virus based on CRISPR-Cas12B | |
| Ravan et al. | Dual catalytic DNA circuit-induced gold nanoparticle aggregation: An enzyme-free and colorimetric strategy for amplified detection of nucleic acids | |
| Liao et al. | Label-free and highly sensitive fluorescent detection of bleomycin based on CRISPR-Cas12a and G-quadruplex-thioflavin T | |
| Mo et al. | Recent progress in the development of DNA-based biosensors integrated with hybridization chain reaction or catalytic hairpin assembly | |
| JPWO2003100095A1 (en) | Target nucleic acid detection method | |
| Guo et al. | A multiple amplification strategy for nucleic acid detection based on host–guest interaction between the β-cyclodextrin polymer and pyrene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |