CN111455026A

CN111455026A - Method for detecting thrombin based on fluorescence double-signal enzyme-free amplification strategy of aptamer and application of method

Info

Publication number: CN111455026A
Application number: CN202010257788.XA
Authority: CN
Inventors: 姚娟; 郭永灿; 张章; 李莲; 黄晓玲; 明兰
Original assignee: Affiliated Hospital of Traditional Chinese Medicine TCM of Southwest Medical University
Current assignee: Affiliated Hospital of Traditional Chinese Medicine TCM of Southwest Medical University
Priority date: 2020-04-03
Filing date: 2020-04-03
Publication date: 2020-07-28

Abstract

The invention belongs to the technical field of biomedicine, and particularly discloses a method for detecting thrombin based on a fluorescence double-signal enzyme-free amplification strategy of an aptamer and application thereof.A three-strand DNA reaction substrate is formed by reacting an auxiliary probe, a signal probe and an L inker chain, then a reaction solution is formed by mixing and reacting the three-strand DNA reaction substrate, a fuel chain and the aptamer/catalyst chain to obtain a thrombin fluorescence detection system, and after the thrombin is added, the thrombin can be detected by monitoring the change of fluorescence signals FAM and ROX.

Description

Method for detecting thrombin based on fluorescence double-signal enzyme-free amplification strategy of aptamer and application of method

Technical Field

The invention relates to the technical field of biomedicine, in particular to a method for detecting thrombin based on a fluorescence double-signal enzyme-free amplification strategy of an aptamer and application thereof.

Background

The detection of proteins plays a crucial role in the basic research and diagnosis of diseases. Thrombin, a specific serine protease, plays an important role in many life processes, such as coagulation, revascularization and wound healing. To date, antigen-antibody recognition-based assays, including enzyme immunoassays and chemiluminescence assays, are the most commonly used protein assays. Due to low protein abundance, development of sensitive protein detection techniques and methods has become a bottleneck in the development of proteomics.

The sensitivity and linear range are the main evaluation criteria of the detection method, the lower limit of detection needs to be low enough to ensure sufficient detection sensitivity, while the linear range needs to cover the whole thrombin concentration to be well used for routine monitoring of the disease. Conventional immunoassays for thrombin have some disadvantages, such as lengthy analysis time, need for expensive instruments, and high sample/reagent consumption. In conclusion, the development of a sensitive and rapid thrombin detection method is of great significance for basic research and disease diagnosis.

To improve the sensitivity of protein detection, many researchers have converted the detection of proteins into the detection of nucleic acids, which greatly improves the sensitivity of protein detection. The developed protein detection methods include immune PCR, affinity aptamer PCR, immune T7 RNA polymerase amplification technology, catalytic hairpin self-assembly, rolling circle amplification, hybrid chain reaction and the like.

The aptamer, as a novel receptor, shows a good potential in the analysis of proteins. The aptamer is a single-stranded DNA or RNA nucleic acid molecule with a specific recognition function, has the action essence that the nucleic acid molecule is folded to form a specific three-dimensional structure to be combined with a biological target with high affinity and high specificity, has the affinity and the specificity which are comparable with those of a monoclonal antibody, and simultaneously has the advantages that the antibody cannot be comparable with those of the monoclonal antibody: is not easy to be denatured by environmental factors such as pH, temperature and the like, and has low price; can be screened in vitro; has no immunogenicity and toxicity, and can be prepared, modified and marked by chemical synthesis; good chemical stability, reversible denaturation and renaturation, capability of being amplified by enzyme, shearing and the like. The advantages enable the compound to have wide application prospect in the biomedical field, thereby presenting a rapid development trend in the fields of basic research and application research.

Disclosure of Invention

In view of the above-mentioned shortcomings of the prior art, the present invention aims to provide a method for detecting thrombin based on an aptamer fluorescence dual-signal non-enzymatic amplification strategy and an application thereof, which are used for solving the problems of low sensitivity, narrow linear range, slow detection speed and the like of the thrombin detection method in the prior art.

In order to achieve the above and other related objects, the present invention provides, in a first aspect, a method for detecting thrombin based on an aptamer-based fluorescent dual-signal enzyme-free amplification strategy, comprising the steps of labeling a catalyst strand and a fuel strand with FAM, labeling a signal probe with ROX, reacting an auxiliary probe, a signal probe and L inker strand to form a triple-stranded DNA reaction substrate, reacting a thrombin aptamer and the catalyst strand to form a double-stranded aptamer/catalyst strand, reacting the triple-stranded DNA reaction substrate, the fuel strand and the aptamer/catalyst strand to form a reaction solution, adding thrombin into the reaction solution to construct a thrombin fluorescence detection system, and monitoring changes in fluorescence signals FAM and ROX with a microplate reader to detect thrombin.

Further, the nucleotide sequence of the thrombin aptamer is:

5’-Dabcyl-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3’，

the nucleotide sequence of the catalyst chain is as follows: 5 '-AGTCACCCCAACCTGCCCTACC-FAM-3',

the nucleotide sequence of the fuel chain is:

5’-FAM-CCTACGTCTCCAACTAACTTACGCCCTAGTCACCCAACCTGC-3’，

the nucleotide sequence of the signal probe is as follows: 5 '-ROX-CCTACGTCTCCAACTAACTTACGG-3',

the nucleotide sequence of the auxiliary probe is as follows: 5'-CCCTAGTCACCCCAACCTGC-3' the flow of the air in the air conditioner,

the nucleotide sequence of the L inker chain is 5 '-GGTAGGGCAGGTTGGGGTGACTAGGGCCGTAAGTTATTGGAGACGTAGG-Dabcyl-3'.

Further, the amounts of the three-stranded DNA reaction substrate, the fuel chain and the aptamer/catalyst chain were equal in volume, the concentration of the three-stranded DNA reaction substrate was 500-600nM, and the concentrations of the fuel chain and the aptamer/catalyst chain were 30 nM.

Further, the volume of the amounts of the three-stranded DNA reaction substrate, the fuel strand and the aptamer/catalyst strand was 30. mu. L.

Furthermore, when preparing the three-strand DNA reaction substrate, the molar usage of the auxiliary probe, the signal probe and the L inker strand is equal.

Further, the concentration of the auxiliary probe, the signal probe and the L inker chain is 500-600nM, and the dosage volume is 30 μ L.

Further, the thrombin aptamer, the helper probe, the signaling probe, the L inker chain, the fuel chain and the catalyst chain were all denatured in Tris-HCl (pH 7) at 95 ℃ for 5 minutes, and cooled to 5 ℃ per minute to room temperature to eliminate the secondary structure of the nucleic acid.

The invention provides a thrombin fluorescence detection system prepared by the method.

The third aspect of the invention provides the application of the method for detecting thrombin based on the aptamer fluorescent dual-signal enzyme-free amplification strategy in the detection of thrombin.

In a fourth aspect, the invention provides a fluorescence biosensor or kit for detecting thrombin, comprising the thrombin detection system.

Further, the detection linear range of the fluorescence biosensor or the kit is 1fM-1 nM.

Further, the lowest detection limit of the fluorescent biosensor or kit is 0.45 fM.

As described above, the method for detecting thrombin based on the aptamer fluorescent dual-signal enzyme-free amplification strategy and the application thereof have the following beneficial effects:

the invention discloses a novel fluorescent aptamer double-opening/closing method for detecting thrombin, which combines thrombin-mediated DNA strand displacement reaction and non-enzymatic DNA cyclic amplification reaction to realize specificity and high-sensitivity detection of thrombin. The detection principle of the invention is as follows: firstly, the specific combination of thrombin and aptamer induces the release of catalyst chain; subsequently, the triggering of the catalyst strand by nucleic acid hybridization and branch migration initiates the DNA cycle amplification reaction. In such a detection mode, the DNA cycle amplification reaction achieves recycling of the catalyst strand and dual signal amplification, and the change in fluorescence signal has a good linear relationship with thrombin concentration between 1fM and 1nM, with a lower limit of thrombin detection as low as 0.45fM (S/N ═ 3). Meanwhile, the invention also shows good selectivity for thrombin and is not interfered by other proteins such as PSA, lysozyme and the like. The whole reaction process of the invention does not need any protease, and the whole reaction can be detected in a reaction system by a one-step method. The invention can be used for developing a fluorescence dual-signal thrombin biosensor based on thrombin-mediated strand displacement reaction and catalyst-catalyzed nucleic acid isothermal amplification reaction, and has important significance for developing a sensitive and rapid thrombin detection method, basic research and disease diagnosis.

Drawings

FIG. 1 shows a schematic diagram of the detection of the present invention.

FIG. 2 shows a secondary structural diagram of a predicted thrombin aptamer in an embodiment of the invention.

FIG. 3 is a graph showing the results of verifying the feasibility of the thrombin-mediated strand displacement reaction in the examples of the present invention.

FIG. 4 is a chart showing the results of the feasibility verification of the catalyst-catalyzed isothermal amplification reaction of nucleic acids in the examples of the present invention.

FIG. 5 is a graph showing the fluorescence signal curves and linear relationship under different concentrations of thrombin in the examples of the present invention.

FIG. 6 is a diagram showing the result of a specificity experiment of the fluorescence sensor prepared in the example of the present invention.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

The specific implementation process of the method for detecting thrombin based on the aptamer fluorescent dual-signal enzyme-free amplification strategy is as follows:

1. design of DNA sequences

For the target thrombin-mediated strand displacement reaction, the secondary structure and standard Gibbs energy changes (AG) of thrombin aptamers (aptamers) were analyzed using UNAfold software₀). The rational choice of the catalytic chain (catalyst) is crucial to ensure that the thrombin-mediated chain displacement reaction occurs, and to ensure the selectivity and sensitivity of the detection assay. Non-enzymatic nucleic acid isothermal amplification DNA sequences were analyzed using UNAfold to ensure minimal interference between nucleic acid strands.

2. Construction of thrombin fluorescence detection System

All nucleic acid chains (including aptamers, auxiliary probes, signal probes, L inker chains, fuel chains, catalyst chains) need to be dissolved in Tris-HCl (pH 7) and denatured at 95 ℃ for 5 minutes, and cooled to 5 ℃ per minute to room temperature to eliminate the secondary structure of nucleic acid.

30 mu L equal volumes of 600nM auxiliary probe (AP chain for short), Signal probe (SP chain for short) and L inker chain form three-chain DNA reaction Substrate (Substrate) at room temperature, form stable hybrid double-chain structure (aptamer/catalyst) with catalyst chain and nucleic acid aptamer, then 30nM Fuel chain (Fuelsland chain for short) and aptamer/catalyst each 30 mu L are injected into polystyrene microplate to form reaction mixture (reaction mixture is stored at-20 ℃ before use), then thrombin with different concentrations is added into the reaction solution, and changes of fluorescence signals FAM and ROX are monitored at room temperature by using Perkin Elmer Enspire multifunctional microplate reader.

Aptamer(5’-3’)：Dabcyl-AGTCCGTGGTAGGGCAGGTTGGGGTGACT；

Catalyst-FAM(5’-3’)：AGTCACCCCAACCTGCCCTACC-FAM；

Catalyst(5’-3’)：AGTCACCCCAACCTGCCCTACC；

Fuel strand(5’-3’)：FAM-CCTACGTCTCCAACTAACTTACGCCCTAGTCACCCAACCTGC；

Signal probe(5’-3’)：ROX-CCTACGTCTCCAACTAACTTACGG；

Assistant probe(5’-3’)：CCCTAGTCACCCCAACCTGC；

L inker chain (5 '-3'): GGTAGGGCAGGTTGGGGTGACTAGGGCCGTAAGTTATTGGAGACGTAGG-Dabcyl.

3. Principle of detection

As shown in FIG. 1A, in the absence of the target thrombin, the aptamer and the catalyst strand (catalyst) form a hybrid duplex strongly, whereas in the presence of thrombin, the aptamer binds covalently to thrombin and undergoes a strand displacement reaction resulting in the release of the catalyst strand, the secondary structure of thrombin aptamer is predicted using UNAfold software, as shown in FIG. 2, the catalyst strand then triggers the non-enzymatic DNA molecular machinery cycle amplification effect, the DNA molecular machinery of the present invention includes a Fuel strand and a three-stranded DNA reaction Substrate (Substrate) consisting of L inker, an AP strand and an SP strand, as shown in FIG. 1B, we divide the DNA sequence into domains of different structures, the structures of which mainly determine the form of interaction between the components.

As shown in fig. 1C, the catalyst chain first binds to the Substrate domain d and forms a four-chain structure (intercidate 1, I1) that is unstable and forms the I2 form by branching. Due to the weak binding of domains b and b ×, I2 spontaneously dissociated into AP chains and I3. Newly exposed domain b promotes the binding of the Fuel chain, followed by a rapid release of the SP chain and I5. Finally, I5 spontaneously dissociated to form wale and the catalyst strand was regenerated for the next DNA cycle.

In the process, the release of SP chains increases the ROX fluorescence signal, while the binding of Fuel chains L inker chains decreases the FAM signal.

In conclusion, the recovery of the catalyst chain simultaneously starts the next DNA circulation amplification reaction, thereby leading to the release of a large amount of SP chains and the recombination of Fuel chains, causing the significant change of fluorescence signals, and realizing the high-sensitivity detection of thrombin.

4. Gel imaging analysis and feasibility verification

(1) The feasibility of the thrombin-mediated strand displacement reaction was verified as shown in FIG. 3.

FIG. 3A shows a reaction scheme of thrombin-mediated strand displacement reaction, wherein the catalyst and the aptamer form a stable double-chain structure, and the thrombin and the aptamer are covalently bound in the presence of thrombin, so that the fluorophore and the quencher are separated to generate a fluorescence signal.

As shown in FIG. 3B (curve a: 1. mu.M catalst chain; curve B: 500nM catalst/aptamer duplex; curve c: 500nM aptamer/catalst with 500nM thrombin; curve d: 500nM aptamer/catalst with blank control), curve a indicates that the catalst chain labeled with FAM fluorophore exhibits a strong fluorescence signal; curve b shows that the catalyst/aptamer forms a stable double-chain structure, so that FAM fluorescence signals are quenched; curve c shows the recovery of the fluorescence signal after 500nM thrombin was added to the system; curve d shows that there was no significant change in signal with the addition of buffer.

FIG. 3C (curve a: 500nM aptamer/catalyst and 500nM thrombin; curve b: negative control) illustrates the thrombin-mediated strand displacement reaction kinetically, further illustrating this reaction. After 10min the thrombin chain displacement reaction appeared to reach equilibrium (curve a), whereas the signal was not apparent when hybridization buffer was added as a negative control (curve b); the binding between the aptamer and thrombin was further verified by PAGE electrophoresis.

The progress of the strand displacement reaction was characterized by native PAGE by electrophoresis on a 12% native polyacrylamide gel at 90V constant for 90min in 0.5 × TBE buffer at room temperature followed by imaging analysis after staining for 30min with gelred, as shown in FIG. 3D, where 25bp marker (lane 1), 500nM aptamer/catalyst (lane 2), 200nM thrombin in 500nM aptamer/catalyst (lane 3), 500nM aptamer/catalyst +500nM thrombin (lane 4), as seen in FIG. 3D, the aptamer/catalyst duplex showed a clear band (L ane 2), the catalyst strand was released after addition of a small amount of thrombin, showing a relatively clear band (lane 3), and a relatively bright band was observed by increasing the thrombin concentration (lane 4).

(2) The feasibility verification of the catalysis chain catalyzed nucleic acid isothermal amplification reaction is shown in FIG. 4.

FIG. 4A is an emission spectrum. For the signal enhancement mode (FIG. 4A), ROX did not have a significant signal response when there was both substrate and Fuel chains in the system, probably because the SP and AP chains block the active region and the Fuel chain cannot hybridize instead of them to the linker chain (curve c). After addition of the catalyst strand, a non-enzymatic nucleic acid isothermal amplification cycle was triggered and a significant increase in fluorescence intensity was observed (curve d). Similar results were observed for the signal reduction mode (curves a and b), which is in good agreement with the signal enhancement mode. This also further demonstrates that the ROX-labeled SP serves as a probe for the signal enhancing mode and the FAM-labeled Fuel chain as a signal reducing probe. Similar kinetic results were also confirmed (see fig. 4B), further illustrating the successful construction of this dual signal detection strategy detection system.

The isothermal amplification reaction was characterized by native PAGE electrophoresis using 12% native polyacrylamide gel electrophoresis at 90V constant for 90min at room temperature in 0.5 × TBE buffer followed by gelred staining for 30min and imaging analysis as shown in FIG. 4C, where 25bp marker (lane 1), 500nM Substrate (lane 2), 500nM Fuel (lane 3), 500nM catalyst (lane 4), 500nM Substrate and 500nM Fuel (lane 5), 500nM Substrate and 500nM catalyst (lane 6), 500nM Substrate, 500nM Fuel and 500nM catalyst (lane 7), as shown in FIG. 4C, the Substrate, Fuel and catalyst chains show two independent bands (lanes 2 to 6), the isothermal amplification after the reaction system chain occurs, release of new isothermal AP and catalytic chains (lane 7), and the results of isothermal amplification reaction using the above mentioned catalytic probes, as shown in FIG. 4C, the results of isothermal amplification reaction are shown on the basis of the results of the isothermal amplification reaction system, the results of isothermal amplification, the isothermal amplification reaction chain and catalytic displacement (lane 7), and the results of the isothermal amplification reaction are shown in FIG. 4C, the results of the isothermal amplification reaction system show the results using the aforementioned PAC/secondary amplification reaction system, the results of the isothermal amplification reaction system, and the results of the secondary amplification reaction system, show that the secondary amplification reaction system, and the results of the secondary amplification reaction system, and the secondary amplification reaction system.

5. Detection of thrombin

As shown in FIG. 5A, when thrombin was added to the reaction mixture at different concentrations (curve 1 to curve 8 thrombin concentrations: 0, 1fM, 10fM, 100fM, 1pM, 10pM, 100pM and 1nM), the fluorescence intensity of the detected FAM gradually decreased and the fluorescence intensity of ROX gradually increased. Because as the catalyst-catalyzed pair of nucleic acid isothermal amplification reactions occurs, more and more SP strands are released to increase the ROX signal, and more Fuel strands are bound to the linker strand to decrease the FAM fluorescence signal. In the concentration range of 1fM to 1nM thrombin concentration,. DELTA.FROX +. DELTA.FFAM. shows a good linear relationship with the log of thrombin concentration. The corresponding linear equation for Δ FROX + | Δ FFAM | ═ 1723.7 × log C (fM) +1836.3 has a linear correlation coefficient of 0.997 (fig. 5B). The lowest detection limit was estimated to be 0.45fM for signal values corresponding to a blank signal plus three times the standard deviation.

The improvement in sensitivity of the method can be attributed to the following factors: the nucleic acid isothermal amplification technology catalyzed by the catalyst chain amplifies the thrombin target pair, so that the detection signal is greatly enhanced; the data processing strategy adopting double signals improves the detection lower limit.

6. Specificity analysis

To investigate the substrate selectivity of the constructed fluorescent biosensors, we performed specific experiments with AFP, CEA, PSA and lzsozyme as potential interferences; to study the specificity of the sensors for sequences, we set the aptamer sequence and aptamer control sequence for specificity experiments. Wherein, the aptamer control sequence is shown as follows:

Aptamer control(5’-3’)：AGTCCGTGCTAGGCCAGGTTGAGGTGACT。

FIG. 6A shows a graph of the signal response results of the fluorescence biosensor prepared in accordance with the present invention for 10fM thrombin and 100fM AFP, CEA, PSA and lysozyme. As shown in fig. 6A, a significant change in fluorescence signal was observed in the experimental group to which thrombin was added; whereas addition of 10-fold concentrations of AFP, CEA, PSA and lzsozyme did not give a significant signal response. These results indicate that the fluorescence biosensor constructed by us has good selectivity for thrombin.

FIG. 6B is a graph showing the results of signal response of the fluorescence biosensor prepared according to the present invention to aptamer control sequence. FIG. 6B shows that the biosensor constructed according to the present invention has very good sequence selectivity for thrombin selection, and the good selectivity is due to the specificity of covalent binding between aptamer and thrombin.

In conclusion, the invention utilizes the energy-driven thrombin-induced DNA strand displacement reaction and the non-enzyme catalyst circulating DNA mechanism to amplify signals, and constructs the double-signal fluorescent aptamer biosensor for detecting thrombin, which has high sensitivity and a relatively wide linear range. The fluorescent biosensor adopts a double-signal amplification technology, has a simple signal transduction mode, and has the advantages of strong analysis capability, simplicity in manufacturing, convenience in operation and the like. The lowest detection limit of the sensor designed by the invention reaches 0.45fM, and the linear range is 1fM to 1 nM. The invention has good selectivity and acceptable stability for detecting thrombin, and can be used for detecting complex samples.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

SEQUENCE LISTING

<110> subsidiary traditional Chinese medical hospital of southwest medical university

<120> method for detecting thrombin based on aptamer fluorescence dual-signal enzyme-free amplification strategy and application thereof

<130>PCQYK203340

<160>7

<170>PatentIn version 3.5

<210>1

<211>29

<212>DNA

<213>Artificial

<220>

<223>Aptamer

<400>1

agtccgtggt agggcaggtt ggggtgact 29

<210>2

<211>22

<212>DNA

<213>Artificial

<220>

<223>Catalyst

<400>2

agtcacccca acctgcccta cc 22

<210>3

<211>42

<212>DNA

<213>Artificial

<220>

<223>Fuel strand

<400>3

cctacgtctc caactaactt acgccctagt cacccaacct gc 42

<210>4

<211>24

<212>DNA

<213>Artificial

<220>

<223>Signal probe

<400>4

cctacgtctc caactaactt acgg 24

<210>5

<211>20

<212>DNA

<213>Artificial

<220>

<223>Assistant probe

<400>5

ccctagtcac cccaacctgc 20

<210>6

<211>49

<212>DNA

<213>Artificial

<220>

<223>Linker

<400>6

ggtagggcag gttggggtga ctagggccgt aagttattgg agacgtagg 49

<210>7

<211>29

<212>DNA

<213>Artificial

<220>

<223>Aptamer control

<400>7

agtccgtgct aggccaggtt gaggtgact 29

Claims

1. A method for detecting thrombin based on a fluorescence double-signal enzyme-free amplification strategy of an aptamer is characterized by comprising the following steps of labeling a catalyst chain and a fuel chain by FAM, labeling a signal probe by ROX, reacting an auxiliary probe, the signal probe and an L inker chain to form a three-chain DNA reaction substrate, reacting a thrombin aptamer and the catalyst chain to form a double-chain aptamer/catalyst chain, mixing the three-chain DNA reaction substrate, the fuel chain and the aptamer/catalyst chain to react to form a reaction solution, adding thrombin into the reaction solution to construct a thrombin fluorescence detection system, and monitoring changes of fluorescence signals FAM and ROX by a microplate reader to detect thrombin.

2. The method of claim 1, wherein: the nucleotide sequence of the thrombin aptamer is as follows:

5’-Dabcyl-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3’，

the nucleotide sequence of the fuel chain is:

5’-FAM-CCTACGTCTCCAACTAACTTACGCCCTAGTCACCCAACCTGC-3’，

the nucleotide sequence of the L inker chain is 5' -GGTAGGGCAGGTTGGGGTGACTAGGGCCG

TAAGTTATTGGAGACGTAGG-Dabcyl-3’。

3. The method of claim 1, wherein: the amounts of the three-stranded DNA reaction substrate, the fuel chain and the aptamer/catalyst chain were equal in volume, the concentration of the three-stranded DNA reaction substrate was 500-600nM, and the concentration of the fuel chain and the aptamer/catalyst chain was 30 nM.

4. The method according to claim 3, wherein the volume of the three-stranded DNA reaction substrate, the fuel strand and the aptamer/catalyst strand is 30 μ L.

5. The method of claim 1, wherein the auxiliary probe, the signal probe and the L inker strand are used in the same molar amount when preparing the triple-stranded DNA reaction substrate.

6. The method of claim 5, wherein the concentration of the auxiliary probe, the signal probe and the L inker chain is 500-600nM and the volume of the auxiliary probe, the signal probe and the L inker chain is 30 μ L.

7. The method of claim 1, wherein the thrombin aptamer, the helper probe, the signaling probe, the L inker chain, the fuel chain and the catalyst chain are denatured in Tris-HCl (pH 7) at 95 ℃ for 5 minutes and cooled to 5 ℃ per minute to room temperature to eliminate secondary structures of the nucleic acids.

8. A thrombin fluorescence detection system prepared by the method of any one of claims 1 to 7.

9. Use of the aptamer-based fluorescence dual-signal enzyme-free amplification strategy according to any one of claims 1 to 7 for the detection of thrombin.

10. A fluorescent biosensor or kit for detecting thrombin, comprising: comprising the thrombin detection system of claim 8.