CN105368798A - Recombination baculovirus surface display system and method for recycling soluble protein - Google Patents
Recombination baculovirus surface display system and method for recycling soluble protein Download PDFInfo
- Publication number
- CN105368798A CN105368798A CN201510957313.0A CN201510957313A CN105368798A CN 105368798 A CN105368798 A CN 105368798A CN 201510957313 A CN201510957313 A CN 201510957313A CN 105368798 A CN105368798 A CN 105368798A
- Authority
- CN
- China
- Prior art keywords
- recombinant baculovirus
- cell
- display system
- particle
- surface display
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/866—Baculoviral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14041—Use of virus, viral particle or viral elements as a vector
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Virology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a recombination baculovirus surface display system and a method for recycling soluble protein. The display system comprises an expression vector and further comprises a specific gene segment. The specific gene segment comprises GP64 signal peptide, target soluble protein cDNA of lost signal peptide, a protein label, a restriction enzyme cutting site and a termination codon. The method for recycling the target soluble protein includes the steps of constructing the expression vector, converting escherichia coli, verifying the expression vector, preparing recombination baculovirus particle clones for expressing the target soluble protein, transfecting insect cells, collecting recombination baculovirus particles, amplifying the recombination baculovirus particles, expressing the target soluble protein, and recycling the target protein. By means of the recombination baculovirus surface display system and the method, the activity, the yield and other aspects of the obtained protein are greatly improved and perfected, the recycling efficiency of the soluble protein is improved, and the recombination baculovirus surface display system and the method are suitable for large-scale industrial application.
Description
Technical field
The invention belongs to biological technical field, be specifically related to utilize Baculovirus Surface Display System to show soluble proteins and reclaim the method for soluble proteins from baculovirus surface.
Background technology
Baculovirus is the obligatory parasitism virus of Arthropoda, be developed to expression vector from the eighties in 20th century to rely on, due to advantages such as its eukaryotic expression environment, receive and pay attention to widely and study, short less than in the time of 30 years, the construction of recombinant vector technology of baculovirus expression system, triage techniques obtain and improve significantly and simplify, and become one of four large expression vector systems mutually arranged side by side with intestinal bacteria, yeast, Mammals.Important achievement is achieved in surface display, viruslike particle expression, mammalian genes transfer, RNA interference etc.
Baculovirus Gene group is about 130kb, therefore can hold larger exogenous dna fragment.In viral genome, polyhedron gene is the gene of virus infection high expression in late period, is but the nonessential region of virus replication propagation, is therefore applicable to the multiple copied inserting foreign gene.This gene regulates and controls by strong promoter, higher level can express foreign protein.Foreign DNA inserts in polyhedron gene, and this gene function is lost, can not resynthesis polyhedrin.In addition, the processing that Baculovirus Surface Display System can complete posttranslational protein matter is modified, and makes foreign product have higher biological activity.
Baculovirus Surface Display System is after constantly research with improvement, show very wide application prospect, this system belongs to higher eucaryote display systems, the deficiency of protokaryon display systems can be made up, and keep the advantage of surface display system, high-affinity antibody and polypeptide drugs screening, proteantigen epitope analysis, build in polypeptide libraries and antibody library, new generation vaccine development, gene therapy etc. and have broad application prospects.
Although at present Baculovirus Surface Display System after deliberation very ripe, the expressing quantity of current business-like baculovirus-insect expression system is lower, and the albumen of expressing is difficult to separation and purification.
Summary of the invention
An object of the present invention provides a kind of soluble proteins Baculovirus Surface Display System to overcome above technological deficiency.
Two of object of the present invention is to provide a kind of method reclaimed the soluble proteins of above-mentioned baculovirus surface display.
For achieving the above object, the technical solution used in the present invention is:
A kind of recombinant baculovirus surface display system, described display systems is except containing except expression vector, it is characterized in that, also comprise specific gene fragment, described specific gene fragment comprises: the object soluble proteins cDNA of GP64 signal peptide, deleted signal peptide, protein tag, restriction enzyme site and terminator codon.
Further, the object soluble proteins cDNA gene fragment of described deleted signal peptide is between GP64 signal peptide and protein tag.
Further, described expression vector is pFastBac1vector.
Further, described protein tag is MyC, His, GST or HA, is preferably His label.
Further, described terminator codon is TGA, TAA or TAG, is preferably TAG.
Above-mentioned recombinant baculovirus surface display system is utilized to reclaim the method for soluble proteins,
1) construction of expression vector and transformation of E. coli: first obtain the gene fragment containing object soluble proteins nucleotide sequence by gene amplification method, the gene fragment obtained is inserted in expression vector, then transformation of E. coli, restriction enzyme site selects the cleavage site of zymoplasm; The step that gene fragment inserts expression vector comprises: first carry out digestion process to expression vector, then under the effect of ligase enzyme, expression vector is connected with nucleotide sequence, form complete cyclic plasmid, finally cyclic plasmid is transformed in bacillus coli DH 5 alpha;
2) expression vector checking: after obtaining intestinal bacteria Amp resistant transformants, the strain of picking Partial Conversion, incubated overnight in the LB liquid nutrient medium containing Amp concentration being 80-120 μ g/mL, extracting plasmid, uses digestions process plasmid DNA; Analyze recombinant plasmid by agarose gel electrophoresis and whether insert correct site, by PCR method, positive transformants is analyzed simultaneously, finally, the positive recombinant found is checked order, the exactness of checking transform plastids;
3) express the preparation that object soluble proteins clone with recombinant baculovirus particle: the plasmid DNA of extraction positive recombinant, and transformed and enter intestinal bacteria DH10BacTMEcoli, change rod granule into; Utilize indigo plant/hickie method filter out containing restructuring rod granule clone, in LB substratum cultivate containing restructuring rod granule intestinal bacteria, extracting restructuring rod granule, freeze-drying preserve, for subsequent use;
4) transfection of insect cell and the collection of recombinant baculovirus particle: 1. sf9 cell counting, gets 12.5cm
2new Tissue Culture Flask, every bottle adds 9 × 10
5individual cell, and entirely to cultivate 12-24h, make cell attachment; 2. dissolve 2 μ g steps 3) the purification of Recombinant baculovirus plasmid that obtains in 100 μ L without in Grace ' the s substratum of added ingredients; 3. after transfection reagent fully being shaken up, get 10 μ L and add 100 μ L without in Grace ' the s substratum of added ingredients, mixing; 4. incite somebody to action 2. and 3. gained solution mixing, incubated at room 30min, washs cell to be transformed with 2mL containing Grace ' the s substratum of 10%FBS and discards washings simultaneously; 5. get 0.8mL and add 4. without Grace ' the s substratum of added ingredients that gained plasmid is in the mixed solution of transfection agents, mix gently, cumulative volume is about 1mL, adds in the cell to be transformed that 4. step has been washed, and 27 DEG C are continued to cultivate 5h; 6. remove plasmid, transfection reagent mixtures, add Grace ' the s substratum of 2mL containing 10%FBS, hatch for 27 DEG C, until pathology phenomenon produces; 7., after 5 days, the recombinant baculovirus particle in 1000rpm centrifugal 10min collecting cell nutrient solution, transfer supernatant is in freeze-drying pipe, labelled, is placed in 4 DEG C of refrigerators and keeps in Dark Place.
5) amplification of recombinant baculovirus particle and the expression of object soluble proteins: the recombinant baculovirus particle stoste of 1. getting proper volume joins in the fresh sf9 cell gone down to posterity of convergence degree 90%, in 27 DEG C of constant incubators, leave standstill 1h, rock gently once every 15min; 2. remove the nutrient solution in culturing bottle, add fresh Grace ' the s substratum containing 10%FBS, constant temperature culture in 27 DEG C of constant incubators; 3. after 3 days, the virus particle in 1000rpm centrifugal 10min collecting cell nutrient solution, transfer supernatant liquor is in freeze-drying pipe, labelled, is placed in 4 DEG C of refrigerator lucifuges and deposits; 4. the recombinant virus particle obtained repeats 1. above-mentioned-3. step, to obtain the virus particle of higher titre; 5. the recombinant baculovirus particle adding high titre reaches in the fresh sf9 cell gone down to posterity of 95% to convergence degree, in 27 DEG C of constant incubators, leaves standstill 1h, rocks gently once every 15min; 6. remove the nutrient solution in culturing bottle, add fresh Grace ' the s substratum containing 10%FBS, constant temperature culture in 27 DEG C of constant incubators; 7. after 40-44h, use up cell conditioned medium nutrient solution gently, add the cell pyrolysis liquid of precooling, leave standstill 30min on ice; 8. collecting cell lysate, adds isopyknic 2 × sds gel sample loading buffer sample-loading buffer, mixing, and 100 DEG C keep 10min; 9. SDS-PAGE detects protein expression situation;
6) recovery of target protein: after object soluble proteins has been shown, by above-mentioned steps 5) the recombinant baculovirus particle solution that obtains is in 18000-22000rpm, 4 DEG C centrifugal 15 minutes, collecting precipitation, both the recombinant baculovirus particle that surface display has object soluble proteins had been obtained, recombinant baculovirus particle solution is obtained afterwards with the resuspended recombinant baculovirus particle of a small amount of pure water, it is the soluble proteins on the zymoplasm cutting recombinant baculovirus particle surface of 500-1000 unit/L with final concentration, object soluble proteins with specific label is separated with baculovirus, then carry out recovery with the separator column with specific label to target protein to purify, finally obtain highly purified target protein.
The method of a kind of recombinant baculovirus surface display system provided by the invention and recovery soluble proteins, this display systems can show the soluble proteins of different genera, N is utilized to hold display technique that solubility target protein is illustrated in baculovirus surface, then utilize and to reclaim and purifying baculovirus, enzyme are cut and target protein and baculovirus are separated, recycled specific label and reclaim target protein, obtain all respects such as the activity of albumen, output and have great Improvement and perfection, be applicable to the exploitation of diagnostic antigen and activated protein.Meanwhile, the present invention utilizes specific albumen sepn, purification process, and reclaim the target protein of solubility from baculovirus surface, this recovery method can improve the organic efficiency of soluble proteins, is applicable to large-scale industrial application.
Accompanying drawing explanation
The specific gene fragment comprising object soluble proteins gene order that Fig. 1 provides for the embodiment of the present invention 1, this specific gene fragment includes: object soluble proteins cDNA, 9His label of ATG, GP64 signal peptide, deleted signal peptide, thrombin cleavage site, TM (cross-film district), CT (in born of the same parents part), terminator codon.
The cyclic plasmid structural representation containing object soluble proteins that the structure that Fig. 2 provides for the embodiment of the present invention 1 completes.
The comparison of the method that Fig. 3 provides for the embodiment of the present invention 1 and empty plasmid experimental result, in figure, the band of 1 correspondence is the result that empty plasmid is tested equally, and in figure, the band of 2 correspondences is the PCV-2ORF2 protein band experimental results adopting method of the present invention to prepare.
Embodiment
Below in conjunction with drawings and embodiments, the present invention will be further described in detail.
Embodiment 1 is recombinated PCV-2ORF2 albumen baculovirus surface display and recovery process again
1, construction of expression vector and transformation of E. coli.
First, with following primer amplification SEQ ID NO.1, wherein SEQIDNO.1 is the complete genome sequence of PCV-2ORF2 albumen, and sequence length is 702bp.
P1:5’-TCA
GGATCCATGACGTATTCCAAGGAGGCG-3’
P2：5’-GCT
CTCGAGTAAGTGGGGGGTCTTTAAG-3’
Above primer is synthesized voluntarily by Wuhan Jin Kairui biotechnology company limited, is dissolved in appropriate sterilizing ultrapure water according to explanation, by 20 μ L/ pipe packing, is stored in-20 DEG C of refrigerators for subsequent use.
After nucleotide sequence amplification in SEQIDNO.1 sequence table completes, the nucleotides sequence correct through sequence verification is classified as template, with following primer amplification template, obtain lacking the ORF2 gene that N holds 41 amino acid whose nuclear localization signals, the length of this amplified fragments is 579bp.
P3:5 '-GCT
cTCGAGaTGAATGGCATCTTC-3 ' (underscore is XhoI restriction enzyme site)
P4:5 '-GGG
cTGCAGaAGTGGGGGGTCTTTAAG-3 ' (underscore is PstI restriction enzyme site).
After gene amplification completes, reclaim according to PCR primer that the specification sheets of test kit reclaims specific target fragment sequence, purifying.
The sequence of specific fragment reclaims, the condition that the restriction endonuclease reaction of vector plasmid and goal gene all provides with reference to supplier is carried out (purchased from Ying Jun company) after completing by purifying.During preparation endonuclease reaction system according to distilled water, corresponding enzyme cut Buffer, PCR primer fragment, restriction enzyme (XhoI, PstI) order add, the condition of endonuclease reaction is 37 DEG C of 3.5h.Carry out agarose electrophoresis recovery according to method after enzyme cuts into, then carry out ligation.The reaction system of ligation is as follows: in the reaction system of 20 μ L, add 1/10 cumulative volume 10 × connect Buffer, then add a certain amount of exogenous sequences and carrier DNA, then after the ligase enzyme adding 1 μ L, polishing cumulative volume to the 20 μ L that adds water mixes, and mixing is placed in 16 DEG C of connections and spends the night.
Be the Bacillus coli cells DH5 α of transformed competence colibacillus after plasmid has been connected with target gene fragment.
2, expression vector checking.
After obtaining Amp resistant transformants, picking 10 transformants, incubated overnight in the LB substratum containing 100 μ g/mLAmp, extracting plasmid, uses BamHI and SalI digestion process plasmid DNA.Analyze recombinant plasmid by agarose gel electrophoresis and whether insert correct site, by PCR method, positive transformants is analyzed simultaneously, finally, the positive recombinant found is checked order, the exactness of checking transform plastids.
3, the preparation that PCV-2ORF2 albumen is cloned with baculovirus particle is expressed.
Extract the plasmid DNA of positive recombinant, and transformed and enter DH10BacTMEcoli, change rod granule into.Indigo plant/hickie method is utilized to filter out the clone containing restructuring rod granule.In LB substratum, cultivate the intestinal bacteria containing restructuring rod granule, extracting restructuring rod granule, and freeze-drying is preserved, for subsequent use.
4, the transfection of insect cell and the collection of baculovirus particle.
1. sf9 cell counting, gets 12.5cm
2new Tissue Culture Flask, every bottle adds 9 × 10
5individual cell, and entirely to cultivate 12-24h, make cell attachment; 2. 2 μ g purification of Recombinant baculovirus recombinant plasmids are dissolved in 100 μ L without in Grace ' the s substratum of added ingredients; 3. after transfection reagent fully being shaken up, get 10 μ L and add 100 μ L without in Grace ' the s substratum of added ingredients, mixing; 4. incite somebody to action 2. and 3. gained solution mixing, incubated at room 30min, washs cell to be transformed with 2mL containing Grace ' the s substratum of 10%FBS and discards washings simultaneously; 5. get 0.8mL and add 4. without Grace ' the s substratum of added ingredients that gained plasmid is in the mixed solution of transfection agents, mix gently, cumulative volume is about 1mL, adds in the cell to be transformed that 4. step has been washed, and 27 DEG C are continued to cultivate 5h; 6. remove plasmid, transfection reagent mixtures, add Grace ' the s substratum of 2mL containing 10%FBS, hatch for 27 DEG C, until pathology phenomenon produces; 7., after 5 days, the virus particle in 1000rpm centrifugal 10min collecting cell nutrient solution, transfer supernatant is in freeze-drying pipe, labelled, is placed in 4 DEG C of refrigerators and keeps in Dark Place.Because insect cell expression system has outstanding advantage: expression level is high, be easy to amplify, the albumen produced with suitable posttranslational modification, and the advantage such as cell growth conditions is simple.Its protein characteristic of restructuring PCV-2ORF2 albumen that the present invention finds to adopt Baculovirus Surface Display System to show by research and native protein closer to, and protein expression output is higher.
5, the amplification of baculovirus particle and the expression of PCV-2ORF2 albumen.
The baculovirus particle stoste of 1. getting proper volume joins in the fresh sf9 cell gone down to posterity of convergence degree 90%, in 27 DEG C of constant incubators, leaves standstill 1h, rocks gently once every 15min; 2. remove the nutrient solution in culturing bottle, add fresh Grace ' the s substratum containing 10%FBS, constant temperature culture in 27 DEG C of constant incubators; 3. after 3 days, the virus particle in 1000rpm centrifugal 10min collecting cell nutrient solution, transfer supernatant liquor is in freeze-drying pipe, labelled, is placed in 4 DEG C of refrigerator lucifuges and deposits; 4. the virus particle obtained can repeat 1. above-mentioned-3. step, to obtain the virus particle of higher titre; 5. the baculovirus virus particle adding high titre reaches in the fresh sf9 cell gone down to posterity of 95% to convergence degree, in 27 DEG C of constant incubators, leaves standstill 1h, rocks gently once every 15min; 6. remove the nutrient solution in culturing bottle, add fresh Grace ' the s substratum containing 10%FBS, constant temperature culture in 27 DEG C of constant incubators; 7. after 40-44h, use up cell conditioned medium nutrient solution gently, add the cell pyrolysis liquid of precooling, leave standstill 30min on ice; 8. collecting cell lysate, adds isopyknic 2 × sds gel sample loading buffer sample-loading buffer, mixing, and 100 DEG C keep 10min; 9. SDS-PAGE detects protein expression situation.
6, the recovery of PCV-2ORF2 albumen.
Albumen sepn: after target soluble proteins has been shown, the baculovirus particle solution 5 steps obtained is in 18000-22000rpm, 4 DEG C centrifugal 15 minutes, collecting precipitation, both the baculovirus particle that surface display has PCV-2ORF2 albumen had been obtained, the resuspended baculovirus particle of the pure water of original volume 1/10th is used to obtain baculovirus particle solution afterwards, the PCV-2ORF2 albumen of shaft-like virus surface is cut with the zymoplasm that final concentration is 500-1000 unit/L, after having cut by solution in 18000-22000rpm, 4 DEG C centrifugal 15 minutes, collect supernatant, and supernatant is crossed 0.22 μm of millipore filtration.
Protein purification: 1. get Ni post and drain off, after wash 3-5 column volume with water, then wash 3 column volumes with the EDTA solution of 0.1M, wash 3-5 column volume afterwards again with water, and then wash 3 column volumes with the NTA-O damping fluid of pH8.0, use 0.1MNiSO more afterwards
4solution is washed 5 column volumes and is drained off; 2. wash 3 column volumes with the 0.2M sodium acetate injection of pH4.2, wash pillar with the NTA-O damping fluid of pH8.0 more afterwards, until when effluent liquid is consistent with the pH of elutriant, stop wash-out; 3. use the flow velocity of 1mL/min by pillar on the protein soln of extraction; 4. pillar is washed to the constant basket of G250 with the NTA-O damping fluid of pH8.0 after completion of the sample; 5. use the imidazole solution wash-out pillar of 20mM, 60mM, 200mM and 500mM afterwards respectively, till the constant basket of detection G250, in elution process, collect the liquid of outflow respectively, and PCV-2ORF2 protein dry powder that liquid assay concentration postlyophilization both must have been recombinated.
Detect by SDS-PAGE and Westernblot method after separation and purification of protein, first protein solution is prepared, then detect, first antibody Porcine circovirus desease positive serum in testing process, the anti-pig IgG of rabbit of second antibody HRP mark, to demarcate the pig circular ring virus envelope protein ORF2 of expression.
Contrast experiment:
Adopt empty plasmid to carry out in contrast experiment, all the other steps are consistent with above-mentioned steps.
As can be seen from Figure 3 adopt method of the present invention, utilize Baculovirus Surface Display System of the present invention and protein salvage method can effectively expressing PCV-2ORF2 albumen, and can realize reclaiming fast and separation and purification to this target protein.
It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to example to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not departing from the spirit and scope of technical solution of the present invention, it all should be encompassed in the middle of right of the present invention.
SEQUENCELISTING
<110> Wuhan Jin Kairui biotechnology company limited
The method of <120> recombinant baculovirus surface display system and recovery soluble proteins
<160>1
<170>PatentInversion3.3
<210>1
<211>702
<212>DNA
<213>PCV-2ORF2
<400>1
atgacgtacccaaggaggccttacctgcgagacgagacaccgcccctcgcagccatctta60
ggccagatcctccgccgccgcccctggctcgtccacccccgccaccgttaccgctggaga120
aggaaaaatggcatcttcaacacccgcctctcccgcaccttcggatatactatcaagcga180
accacagtcaaaacgccctcctgggcggtggacatgatgagattcaatattaatgacttt240
cttcccccaggagggggctcaaacccccgctctgtgccctttgaatactacagaataaga300
aaggttaaggttgaattctggccctgctccccgatcacccagggtgacaggggagtgggc360
tccagtgctgttattctagatgataactttgtaacaaaggccacagccctcacctatgac420
ccctatgtaaactactcctcccgccataccataacccagtccttctcctaccactcccgc480
tactttacccccaaacctgcagattccactattgattacttccaaccaaacaacaaaaga540
aatcagctgtggctgagactacaaactgctggaaatgtagaccacgtaggcctcggcact600
gcattcgaaaacagtatatacgaccaggaatacaatatccgtgtaaccatgtatgtacaa660
ttcagagaatttaatcttaaagaccccccacttaaaccataa702
Claims (6)
1. a recombinant baculovirus surface display system, described display systems is except containing except expression vector, it is characterized in that, also comprise specific gene fragment, described specific gene fragment comprises: the object soluble proteins cDNA of GP64 signal peptide, deleted signal peptide, protein tag, restriction enzyme site and terminator codon.
2. recombinant baculovirus surface display system according to claim 1, is characterized in that: the object soluble proteins cDNA gene fragment of described deleted signal peptide is between GP64 signal peptide and protein tag.
3. recombinant baculovirus surface display system according to claim 1, is characterized in that: described expression vector is pFastBac1vector.
4. recombinant baculovirus surface display system according to claim 1, is characterized in that: described protein tag is MyC, His, GST or HA, is preferably His label.
5. recombinant baculovirus surface display system according to claim 1, is characterized in that: described terminator codon is TGA, TAA or TAG, is preferably TAG.
6. utilize recombinant baculovirus surface display system described in any one of claim 1-5 to reclaim the method for soluble proteins, it is characterized in that:
1) construction of expression vector and transformation of E. coli: first obtain the gene fragment containing object soluble proteins nucleotide sequence by gene amplification method, the gene fragment obtained is inserted in expression vector, then transformation of E. coli, restriction enzyme site selects the cleavage site of zymoplasm; The step that gene fragment inserts expression vector comprises: first carry out digestion process to expression vector, then under the effect of ligase enzyme, expression vector is connected with nucleotide sequence, form complete cyclic plasmid, finally cyclic plasmid is transformed in bacillus coli DH 5 alpha;
2) expression vector checking: after obtaining intestinal bacteria Amp resistant transformants, the strain of picking Partial Conversion, incubated overnight in the LB liquid nutrient medium containing Amp concentration being 80-120 μ g/mL, extracting plasmid, uses digestions process plasmid DNA; Analyze recombinant plasmid by agarose gel electrophoresis and whether insert correct site, by PCR method, positive transformants is analyzed simultaneously, finally, the positive recombinant found is checked order, the exactness of checking transform plastids;
3) express the preparation that object soluble proteins clone with recombinant baculovirus particle: the plasmid DNA of extraction positive recombinant, and transformed and enter intestinal bacteria DH10BacTMEcoli, change rod granule into; Utilize indigo plant/hickie method filter out containing restructuring rod granule clone, in LB substratum cultivate containing restructuring rod granule intestinal bacteria, extracting restructuring rod granule, freeze-drying preserve, for subsequent use;
4) transfection of insect cell and the collection of recombinant baculovirus particle: 1. sf9 cell counting, gets 12.5cm
2new Tissue Culture Flask, every bottle adds 9 × 10
5individual cell, and entirely to cultivate 12-24h, make cell attachment; 2. dissolve 2 μ g steps 3) the purification of Recombinant baculovirus plasmid that obtains in 100 μ L without in Grace ' the s substratum of added ingredients; 3. after transfection reagent fully being shaken up, get 10 μ L and add 100 μ L without in Grace ' the s substratum of added ingredients, mixing; 4. incite somebody to action 2. and 3. gained solution mixing, incubated at room 30min, washs cell to be transformed with 2mL containing Grace ' the s substratum of 10%FBS and discards washings simultaneously; 5. get 0.8mL and add 4. without Grace ' the s substratum of added ingredients that gained plasmid is in the mixed solution of transfection agents, mix gently, cumulative volume is about 1mL, adds in the cell to be transformed that 4. step has been washed, and 27 DEG C are continued to cultivate 5h; 6. remove plasmid, transfection reagent mixtures, add Grace ' the s substratum of 2mL containing 10%FBS, hatch for 27 DEG C, until pathology phenomenon produces; 7., after 5 days, the recombinant baculovirus particle in 1000rpm centrifugal 10min collecting cell nutrient solution, transfer supernatant is in freeze-drying pipe, labelled, is placed in 4 DEG C of refrigerators and keeps in Dark Place.
5) amplification of recombinant baculovirus particle and the expression of object soluble proteins: the recombinant baculovirus particle stoste of 1. getting proper volume joins in the fresh sf9 cell gone down to posterity of convergence degree 90%, in 27 DEG C of constant incubators, leave standstill 1h, rock gently once every 15min; 2. remove the nutrient solution in culturing bottle, add fresh Grace ' the s substratum containing 10%FBS, constant temperature culture in 27 DEG C of constant incubators; 3. after 3 days, the virus particle in 1000rpm centrifugal 10min collecting cell nutrient solution, transfer supernatant liquor is in freeze-drying pipe, labelled, is placed in 4 DEG C of refrigerator lucifuges and deposits; 4. the recombinant virus particle obtained repeats 1. above-mentioned-3. step, to obtain the virus particle of higher titre; 5. the recombinant baculovirus particle adding high titre reaches in the fresh sf9 cell gone down to posterity of 95% to convergence degree, in 27 DEG C of constant incubators, leaves standstill 1h, rocks gently once every 15min; 6. remove the nutrient solution in culturing bottle, add fresh Grace ' the s substratum containing 10%FBS, constant temperature culture in 27 DEG C of constant incubators; 7. after 40-44h, use up cell conditioned medium nutrient solution gently, add the cell pyrolysis liquid of precooling, leave standstill 30min on ice; 8. collecting cell lysate, adds isopyknic 2 × sds gel sample loading buffer sample-loading buffer, mixing, and 100 DEG C keep 10min; 9. SDS-PAGE detects protein expression situation;
6) recovery of target protein: after object soluble proteins has been shown, by above-mentioned steps 5) the recombinant baculovirus particle solution that obtains is in 18000-22000rpm, 4 DEG C centrifugal 15 minutes, collecting precipitation, both the recombinant baculovirus particle that surface display has object soluble proteins had been obtained, recombinant baculovirus particle solution is obtained afterwards with the resuspended recombinant baculovirus particle of a small amount of pure water, it is the soluble proteins on the zymoplasm cutting recombinant baculovirus particle surface of 500-1000 unit/L with final concentration, object soluble proteins with specific label is separated with baculovirus, then carry out recovery with the separator column with specific label to target protein to purify, finally obtain highly purified target protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510957313.0A CN105368798A (en) | 2015-12-17 | 2015-12-17 | Recombination baculovirus surface display system and method for recycling soluble protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510957313.0A CN105368798A (en) | 2015-12-17 | 2015-12-17 | Recombination baculovirus surface display system and method for recycling soluble protein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105368798A true CN105368798A (en) | 2016-03-02 |
Family
ID=55371431
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510957313.0A Pending CN105368798A (en) | 2015-12-17 | 2015-12-17 | Recombination baculovirus surface display system and method for recycling soluble protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105368798A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111440243A (en) * | 2020-04-01 | 2020-07-24 | 黄善青 | Simple protein purification method for positioning recombinant protein on cell surface |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101440359A (en) * | 2008-12-24 | 2009-05-27 | 北京大学 | Avian influenza viral vaccine and preparation thereof |
| CN103087200A (en) * | 2013-01-28 | 2013-05-08 | 江苏众红生物工程创药研究院有限公司 | Pig IFN (interferon) gamma-Fc fusion protein as well as coding gene and expression method of pig IFN (interferon) gamma-Fc fusion protein |
| CN104725497A (en) * | 2013-12-19 | 2015-06-24 | 天津耀宇生物技术有限公司 | Bombyx mori main assistant transport protein BmMFS, fusion expression and purification method thereof |
-
2015
- 2015-12-17 CN CN201510957313.0A patent/CN105368798A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101440359A (en) * | 2008-12-24 | 2009-05-27 | 北京大学 | Avian influenza viral vaccine and preparation thereof |
| CN103087200A (en) * | 2013-01-28 | 2013-05-08 | 江苏众红生物工程创药研究院有限公司 | Pig IFN (interferon) gamma-Fc fusion protein as well as coding gene and expression method of pig IFN (interferon) gamma-Fc fusion protein |
| CN104725497A (en) * | 2013-12-19 | 2015-06-24 | 天津耀宇生物技术有限公司 | Bombyx mori main assistant transport protein BmMFS, fusion expression and purification method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 程晓亮 等: "表面展示猪圆环病毒2型衣壳蛋白的重组杆状病毒的构建", 《华南农业大学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111440243A (en) * | 2020-04-01 | 2020-07-24 | 黄善青 | Simple protein purification method for positioning recombinant protein on cell surface |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111499765A (en) | Coronavirus fusion protein and preparation method and application thereof | |
| CN103525773B (en) | A kind of method and application thereof improving PRRS virus target cell infection titre | |
| CN103923887A (en) | Pseudoviral particle containing hepatitis e virus RNA (Ribose Nucleic Acid) fragment and preparation method thereof | |
| CN106755089B (en) | Cell line for expressing goat lymphocyte activating molecules and construction method and application thereof | |
| CN107164409A (en) | CDV sensitive cell line SLAM MDCK and its construction method and application | |
| CN111518174B (en) | Optimized African swine fever CD2v protein and high-efficiency expression method and application thereof | |
| CN105349562B (en) | Express recombinant vector, recombinant bacterium and its application of PPV VP 2 protein | |
| CN111500586A (en) | Aptamer specifically binding to cap region of rabies virus L protein and application thereof | |
| CN109212230B (en) | Sensitized polystyrene nano-microsphere for detecting canine parvovirus structural protein VP2 antibody and preparation method and application thereof | |
| CN106754981B (en) | Method for preparing gosling plague virus-like particles by using escherichia coli system | |
| CN104178514B (en) | A kind of method of foreign protein content inside raising AcMNPV polyhedral bodies | |
| CN106701793A (en) | Application of porcine circovirus type 2 double-copy infectious clone to indirect ELISA detection method | |
| CN109959789B (en) | Rabies virus antibody detection paper and preparation method and detection method thereof | |
| CN108070609A (en) | By the use of trichoderma reesei as the method for host expresses recombinant protein | |
| CN105368798A (en) | Recombination baculovirus surface display system and method for recycling soluble protein | |
| CN106929487A (en) | A kind of foot and mouth disease virus Hybrid virus like particles and preparation method thereof | |
| CN111378017B (en) | Subunit F protein of peste des petits ruminants virus and preparation method and application thereof | |
| CN114410593B (en) | Large-scale production process of recombinant novel coronavirus vaccine using measles virus as vector | |
| CN102899293A (en) | Mesenchymal stem cells genetically modified with angiopoietin 1 gene and construction method and application thereof | |
| Li et al. | Construction of stable infectious full-length and eGFP-tagged cDNA clones of Mirabilis crinkle mosaic virus via In-Fusion cloning | |
| CN113248577B (en) | Coronavirus vaccine using adenovirus as carrier and its preparing method | |
| CN113416713A (en) | Construction and application of recombinant adenovirus | |
| CN111378016B (en) | Subunit H protein of peste des petits ruminants virus, preparation method and application thereof | |
| CN103087933B (en) | Recombinant polymorphic hansenula polymorpha and preparation method thereof | |
| CN102453729B (en) | A kind of platform of fast high-flux Restruction albumen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160302 |