CN101440359A - Avian influenza viral vaccine and preparation thereof - Google Patents
Avian influenza viral vaccine and preparation thereof Download PDFInfo
- Publication number
- CN101440359A CN101440359A CNA2008102410043A CN200810241004A CN101440359A CN 101440359 A CN101440359 A CN 101440359A CN A2008102410043 A CNA2008102410043 A CN A2008102410043A CN 200810241004 A CN200810241004 A CN 200810241004A CN 101440359 A CN101440359 A CN 101440359A
- Authority
- CN
- China
- Prior art keywords
- sequence
- baculovirus
- avian influenza
- virus
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses an avian influenza virus vaccine and a preparation method thereof. The avian influenza virus vaccine is a recombinant baculovirus which takes a baculovirus as a vector and is displayed with an extracellular zone of HA protein of an H5N1 avian influenza virus on the surface. The vaccine has the advantages: 1) the vaccine has high safety; 2) the vaccine has good immune protection effect; and 3) the vaccine has a simple preparation method and easy mass production. The vaccine has higher actual application value in the field of prevention and control of avian influenza.
Description
Technical field
The present invention relates to avian influenza virus vaccine and preparation method thereof.
Background technology
Influenza is caused by influenza virus, a kind of transmissible disease of serious threat human health.Eighties of last century once had the great outburst of three influenzas among the crowd, several ten million people die from influenza virus.To 1997, have only the influenza infection mankind (Palese and Garcia-Sastre 2002) of three HA hypotypes.A kind of new H5N1 type avian influenza mankind's case occurred in Hong Kong since 1997, up to the present existing 387 people infect, and 245 people die from H5N1 type bird flu (WHO.Sep10,2008).Pre-anti-virus, vaccine are the most general and effective meanss at present, utilize the albumen of virus to stimulate animal to produce the infection that neutralizing antibody can effectively prevent virus.
H5N1 type avian influenza virus belongs to the A of orthomyxovirus section type influenza virus, has three kinds of envelope proteins, HA, NA and M2 on its cyst membrane surface.HA albumen quantitatively is maximum, and plays an important role in the process of influenza virus particles intrusion cell.Can produce neutralizing antibody (Wiley, Wilson et al.1981) with the HA protein immune animal at isostructural influenza virus.
Baculovirus expression system has been widely used in the protein expression (Kost and Condreay 1999) and the antigenic preparation (Saitoh of various uses, Ohtomo et al.2007), its expressed proteins has the posttranslational modification the same with other eukaryotic cell expression albumen, and good immunogenicity is arranged; And because baculovirus both can infect cultured cell in vitro, but infected insect larva again makes a large amount of amplifications and the proteic preparation of virus very convenient.Baculovirus particle can enter mammalian cell, but can not duplicate therein, also can not cause cytopathy, is used for foreign gene is transduceed into mammalian cell (Ge, Huang et al.2007) at present more.Therefore, be safe as antigen to Mammals with baculovirus particle.
Autographa californica nuclear polyhedrosis virus (Autographa californica multicapsid nuclearpolyhedrosis virus, AcMNPV) be to use maximum baculoviruss at present, the AcMNPV particle that has proved reorganization can be used as vaccine carrier (Kaba, Hemmes et al.2003).In the baculovirus infection cell processes, AcMNPV can produce two kinds of viral phenotypes, the inclusion body virus and the virus of sprouting.Foreign protein can by self stride the film district or merge AcMNPV envelope protein GP64 stride the film district, or form fusion rotein with GP64 and be illustrated in budding pattern baculovirus particle surface (Boublik, Di Bonito et al.1995; Grabherr, Ernst et al.1997; Mottershead, van der Linden et al.1997).Other studies show that, if with the G of VSV virus proteic stride film district and intracellular region substitute GP64 stride the film district and intracellular region can better be illustrated in foreign protein viral surface (the Chapple and Jones 2002 that sprouts; Feng, Liu et al.2006; Zhou andBlissard 2008).Be illustrated in the direct titre that influence the neutralizing antibody that can produce in the immunized animal body of target protein amount meeting on the cyst membrane.
Have the result show hr3 (the homology iteron 3) sequence of silkworm baculovirus (BmNPV) can be used as cis element strengthen some viral promotors in early days transcribe and the promotor of some non-viral sources transcribe (Lu, Farrell et al.1997), and gp64 gene promoter transcribing late also there is reinforced effects (Zhou, Yiet al.2003).
Summary of the invention
The purpose of this invention is to provide avian influenza virus vaccine and preparation method thereof.
The invention provides a kind of surface display has the recombinant baculovirus of H5N1 type avian influenza virus HA protein extracellular.
Avian influenza virus vaccine provided by the invention, its activeconstituents are above-mentioned recombinant baculovirus.
The present invention also provides a kind of H5N1 type avian influenza virus HA protein extracellular expression cassette, and it comprises following assembly successively to the downstream from the upstream: the encoding sequence of the signal peptide of the envelope protein GP64 of polyhedrin promotor, baculovirus self, H5N1 type avian influenza virus HA protein extracellular and following a) or b) described sequence:
A) encoding sequence of striding film district and intracellular region of the G albumen (VSV-G) of vesicular stomatitis virus;
B) encoding sequence of striding film district and intracellular region of the envelope protein GP64 of baculovirus self.
Described expression cassette a) or b) described sequence downstream also has hr3 (the homology iteron 3) sequence of silkworm baculovirus (BmNPV).
The signal peptide of the envelope protein GP64 of described baculovirus self specifically can be SEQ ID № in the sequence table: 1 amino acid residue sequence; The envelope protein GP64 of described baculovirus self stride the film district and intracellular region specifically can be SEQ ID № in the sequence table: 2 amino acid residue sequence; The G of described vesicular stomatitis virus is proteic to stride the film district and intracellular region specifically can be SEQ ID № in the sequence table: 3 amino acid residue sequence; Described polyhedrin promotor specifically can be SEQ ID № in the sequence table: 4 nucleotide sequence; Described hr3 sequence specifically can be SEQ ID № in the sequence table: 5 nucleotide sequence.
The baculovirus surface display carrier that contains described expression cassette also belongs to protection scope of the present invention.
The carrier that sets out of described surface display carrier is for can be pFastBac DUAL, pFastBacl etc., preferred pFastBacl.
The present invention also protects a kind of genomic recombinant plasmid of recombinant baculovirus that contains, and described recombinant plasmid is to transform the competent cell that contains baculovirus geneome plasmid Bacmid with described surface display carrier, obtains after the homologous recombination.
Described competent cell specifically can be E.coli DH10Bac.
The present invention also provides a kind of method for preparing described recombinant baculovirus, is with described recombinant plasmid transfection insect cell, cultivates this insect cell and obtains recombinant baculovirus.
Described insect zooblast can be Sf9 cell or Sf21 etc., is preferably the Sf9 cell.
The invention provides avian influenza virus vaccine and preparation method thereof.This avian influenza virus vaccine be with baculovirus (Baculovirus) as carrier, what utilize baculovirus surface display technique construction is antigenic recombinant baculovirus with H5N1 type avian influenza virus HA protein extracellular.Specifically, the structure principle of vaccine of the present invention is, the N end of H5N1 type avian influenza virus HA protein extracellular is merged the signal peptide of the envelope protein GP64 of baculovirus self, the C end merges GP64 (or the G albumen of vesicular stomatitis virus, VSV-G) stride film district and intracellular region, this recombinant protein is being sorted into behind the insect cell inner expression on the cytolemma, is packaged in the cyst membrane surface of the baculovirus of budding pattern at last, thereby reaches the purpose of surface display.Vaccine of the present invention has the following advantages: 1) safe, baculovirus this as a kind of insect viruses, in mammalian cell, can't duplicate, to Mammals without any toxicity and do not possess potential danger; 2) immune protective effect is good, because the immunological characteristic of baculovirus itself, this live vector vaccine can cause the immunity system and the cell immune system of body simultaneously, immunity system can produce the albumen that is reconstituted in the baculovirus surface is produced specific neutralizing antibody, the neutralizing antibody that produces can not only with the virus particle combination in the blood, thereby can also blocking virus and the combination blocking virus of acceptor enter cell, cell immune system then can be eliminated by the cell of virus infection, in addition, utilize baculovirus surface display technology can with foreign protein complete be showed in the recombinant baculovirus surface, and can keep the native conformation of foreign protein dramatically, thereby make foreign protein have good immunogenicity, effectively cause immune response, experimental results show that, behind recombinant baculovirus immune mouse of the present invention, can in mice serum, detect generation at the proteic neutralizing antibody of HA, virus infection is had suppress effect preferably; 3) preparation method is simple, is easy to scale operation.Based on above-mentioned advantage, the present invention is in medical science, and particularly the prevention and control field of avian influenza virus has higher actual application value.
The invention will be further described below in conjunction with specific embodiment.
Description of drawings
Fig. 1 is the structural representation of six kinds of carriers of embodiment 1.
Fig. 2 is that the expression and the bandwagon effect of different promoters and enhanser combination compares.
Fig. 3 A is the structural representation of pPph-HA-VSVG-hr3, and Fig. 3 B is the proteic evaluation of recombinant virus surface HA.
Fig. 4 A is that the reading of OD490 is with the variation diagram of serum dilution in the ELISA experiment, and Fig. 4 B is that neutralization test is measured each test serum NAT.
Embodiment
Method therefor is ordinary method if no special instructions among the following embodiment, and described percentage concentration is mass percentage concentration.
The preparation method of used element is as follows in following examples:
One, the preparation of GP64 SP
GP64 SP is the encoding sequence of the signal peptide (GP64 albumen is from aminoterminal 1-34 amino acids residue, the sequence 1 in the sequence table) of the envelope protein GP64 of baculovirus self.
From the external transposon system of the Bac-to-Bac of Invitrogen company (article No.: 10359-016, extract in E.coliDH10Bac bacterial classification 10608-016) and contain the big plasmid Bacmid of AcMNPV baculovirus genomic dna as template, use Pfu high-fidelity DNA polymerase (TAKARA) amplification GP64 signal peptide, primer is as follows:
5’-ggg?aga?tct?atg?gta?agc?gct?at-3’；
5’-ggc?gga?tcc?ctt?gta?cgg?acc?cg-3’。
The PCR product checks order, and the result shows and obtained correct GP64SP sequence.
Two, the preparation of VSV-G TM+CTD
VSV-G TM+CTD is the encoding sequence of striding film district and intracellular region (VSV-G albumen is from aminoterminal 441-511 amino acids residue, the sequence 3 in the sequence table) of the G albumen (VSV-G) of vesicular stomatitis virus.
With plasmid pVSV-G (Clontech) is template, uses the proteic film district of striding of Pfu high-fidelity DNA polymerase (TAKARA) amplification VSV-G.Primer is as follows:
5’-ggg?ttc?gaa?ttt?ggt?gat?act?ggg?cta?tc-3’；
5’-ggg?aag?ctt?tta?ctt?tcc?aag?tcg?gtt?ca-3’。
The PCR product checks order, and the result shows and obtained correct VSV-G TM+CTD sequence.
Three, the preparation of GP64TM+CTD
GP64 TM+CTD is the encoding sequence of striding film district and intracellular region (GP64 albumen is from aminoterminal 471-512 amino acids residue, the sequence 2 in the sequence table) of the envelope protein GP64 of baculovirus self.
From the external transposon system of the Bac-to-Bac of Invitrogen company (article No.: 10359-016, the big plasmid Bacmid that extraction contains AcMNPV baculovirus genomic dna in E.coli DHi0Bac bacterial classification 10608-016) uses Pfu high-fidelity DNA polymerase (TAKARA) amplification GP64TM+CTD as template.Primer is as follows:
5’-gag?ctc?ggtacc?atg?gct?gaa?g-3’；
5’-ggc?gcc?aagctt?tta?ata?ttg?t-3’。
The PCR product checks order, and the result shows and obtained correct GP64 TM+CTD sequence.
The selection of embodiment 1, regulatory factor
In order effectively the HA of influenza virus to be shown to the cyst membrane surface of baculovirus, make up the baculovirus recombinant plasmid, its basic framework is to connect the proteic signal peptide+multiple clone site of GP64 (inserting for HA) in polyhedrin promotor back, after connect proteic film district and the intracellular region of striding of GP64.For the different promoters analyzed and the relation of bandwagon effect, select other two kinds of late promoters, the promotor of gp64 gene (Pgp64) (436bp) and the promotor (Pvp39) of vp39 gene (500bp) substitute polyhedrin protein promotor (Pph) commonly used, make the expression time of target protein advance to consistent with the time of the virus generation of sprouting, wherein-54 of the gp64 gene promoter ATG are successfully sported ATT, three kinds of display carrier that has different promoters: pPph-GP64, pPgp64-GP64 and pPvp39-GP64 have been obtained.The influence of hr3 sequence to showing in order to detect BmNPV made up three kinds of display carrier pPph-GP64-hr3 in addition again, and pPgp64-GP64-hr3 and pPvp39-GP64-hr3 plant carrier by first three respectively and added enhanser cis element hr3.The structural representation of six kinds of carriers is seen Fig. 1.For the quantitative Analysis expression efficiency, design is substituted the recombinant baculovirus of HA by the reporter gene luciferase.
One, the structure of the baculovirus surface display carrier of different elements
(article No.: 10359-016,10608-016) the donor plasmid pFastBacl in forms for the initial carrier transformation baculovirus surface display carrier with the external transposon system of the Bac-to-Bac of Invitrogen company.
(1) structure of pPph-GP64
1, at first, after the encoding sequence GP64SP of the signal peptide of the envelope protein GP64 of baculovirus self cut with restriction enzyme Bgl II and BamH I enzyme, be connected with the carrier pFastbacl that cuts through BamH I enzyme, and make it in the right direction;
2, then, after the encoding sequence GP64TM/CTD that strides film district and intracellular region of the envelope protein GP64 of baculovirus self cut with restriction enzyme Kpn I and Hind III enzyme, the carrier that obtains with the step 1) of cutting through same enzyme was connected.
Obtain pPph-GP64.
(2) structure of pPgp64-GP64
1, the clone of gp64 promoter sequence
From the external transposon system of the Bac-to-Bac of Invitrogen company (article No.: 10359-016, extract in E.coli DH10Bac bacterial classification 10608-016) and contain the big plasmid Bacmid of AcMNPV baculovirus genomic dna as template, use Pfu high-fidelity DNA polymerase (TAKARA) amplification gp64 gene promoter, primer is as follows:
Upstream primer: 5 '-GC
TACGTATATTTAAATAAACCAAACAC-3 ';
Downstream primer: 5 '-GC
GGATCCCTTGCTTGTGTGTTCCT-3 '.
Wherein, the scribe area of upstream primer is the SnaBI restriction enzyme site, and the scribe area of downstream primer is the BamHI restriction enzyme site.The PCR product checks order, and the result shows and obtained correct gp64 promoter sequence.
2, utilize the G-T of synthetic primer rite-directed mutagenesis gp64 gene promoter-52, destroy-54 ATG
The primer is as follows:
Fatt：5’-GATGCCTCAA?TtCTACTAGT?AAATCAGTCA-3’；
Ratt：5’-TT?ACTAGTAGaA?TTGAGGCATC?TTATATAC-3’。
Wherein small letter is the site of sudden change.Obtain containing preceding half section of gp64 promotor of sudden change with upstream primer and Ratt primer PCR, utilize downstream primer and Fatt primer PCR to obtain containing the second half section of the gp64 promotor of sudden change, carry out overlap PCR with preceding half section and second half section then, contained the gp64 promotor of-52 sudden changes.Sequencing result shows, has obtained target sequence.
3, the PCR fragment that obtains of step 2 with restriction enzyme SnaBI and BamHI enzyme cut the back, electrophoresis reclaims the back and inserts the pFastBacl carrier of cutting with restriction enzyme SnaB I and BamH I enzyme.PFastBacl after enzyme is cut has lacked the polyhedrin protein promotor between SnaB I and BamH I, replaces the polyhedrin protein promotor to be inserted on the carrier by the gp64 promotor of suddenling change.
4, the encoding sequence GP64SP of the signal peptide of the envelope protein GP64 of baculovirus self is cut with restriction enzyme Bgl II and BamH I enzyme after, the carrier that obtains with the step 4 of cutting through BamH I enzyme is connected, and makes it in the right direction.
5, the encoding sequence GP64 TM+CTD that strides film district and intracellular region of the envelope protein GP64 of baculovirus self is cut with restriction enzyme Kpn I and Hind III enzyme after, the carrier that obtains with the step 4 of cutting through same enzyme is connected.Obtain pPgp64-GP64.
(3) structure of pPvp39-GP64
1, the clone of vp39 promoter sequence
From the external transposon system of the Bac-to-Bac of Invitrogen company (article No.: 10359-016, extract in E.coli DH10Bac bacterial classification 10608-016) and contain the big plasmid Bacmid of AcMNPV baculovirus genomic dna as template, use Pfu high-fidelity DNA polymerase (TAKARA) amplification vp39 gene promoter, primer is as follows:
Upstream primer: 5 '-GC
TACGTAGAAGCGTCCCCATTTTCCAA-3 ';
Downstream primer: 5 '-GC
GGATCCATTGTTGCCGTTATAAATAT-3 '.
Wherein, the scribe area of upstream primer is a SnaB I restriction enzyme site, and the scribe area of downstream primer is a BamH I restriction enzyme site.The PCR product checks order, and the result shows and obtained correct vp39 promoter sequence.
2, the PCR fragment that obtains of step 2 with restriction enzyme SnaB I and BamH I enzyme cut the back, electrophoresis reclaims the back and inserts the pFastBacl carrier of cutting with restriction enzyme SnaB I and BamH I enzyme.PFastBacl after enzyme is cut has lacked the polyhedrin protein promotor between SnaB I and BamH I, replaces the polyhedrin protein promotor to be inserted on the carrier by the gp64 promotor of suddenling change.
3, the encoding sequence gp64 SP of the signal peptide of the envelope protein GP64 of baculovirus self is cut with restriction enzyme Bgl II and BamH I enzyme after, the carrier that obtains with the step 3 of cutting through BamH I enzyme is connected, and makes it in the right direction;
4, the encoding sequence GP64TM+CTD that strides film district and intracellular region of the envelope protein GP64 of baculovirus self is cut with restriction enzyme KpnI and Hind III enzyme after, the carrier that obtains with the step 5 of cutting through same enzyme is connected.
Obtain pPvp39-GP64.
(4) pPph-GP64-hr3
1, the clone of the hr3 sequence of BmNPV
With the wild-type bombyx mori nuclear polyhedrosis virus genome is template, uses Pfu high-fidelity DNA polymerase (TAKARA) pcr amplification hr3 sequence (enhanser), and used primer is to as follows:
Upstream primer: 5 '-GGC
CCTAGGAGACAACAAAGATTTATTTTATTCATGCCACTACTCGGTTCGT-3 ';
Downstream primer: 5 '-GGC
CCTAGGACGTTCGTGCCAGAAATTAATTTCTCCGCGTCGTATTATACGAT-3 '.
Wherein, the scribe area of primer is the AvrII restriction enzyme site.The PCR product is through order-checking and BmNPV (GenBank
TMNo.L33180) the hr3 sequence conforms to, and is SEQ ID № in the sequence table: 5 nucleotide sequence.
2, BmNPV hr3 sequence is cut the back with restriction enzyme A vr II enzyme and be connected, obtain pPph-GP64-hr3 with the pPph-GP64 carrier of cutting through same enzyme.
(5) pPgp64-GP64-hr3
1,1 of same step (four).
2, BmNPV hr3 sequence is cut the back with restriction enzyme A vr II enzyme and be connected, obtain pPgp64-GP64-hr3 with the pPgp64-GP64 carrier of cutting through same enzyme.
(6) pPvp39-GP64-hr3
1,1 of same step (four).
2, BmNPV hr3 sequence is cut the back with restriction enzyme A vr II enzyme and be connected, obtain pPvp39-GP64-hr3 with the pPvp39-GP64 carrier of cutting through same enzyme.
Two, the recombinant baculovirus cyst membrane is showed efficiency analysis
Utilize BamH I/Kpn I site that luciferase gene is inserted six kinds of carriers of embodiment 1 preparation respectively, obtain following six kinds of recombinant plasmid: Pph-luc-GP64, Pgp64-luc-GP64, pPvp39-luc-GP64, Pph-luc-GP64-hr3, Pgp64-luc-GP64-hr3, pPvp39-luc-GP64-hr3.With the Bacmid that six kinds of recombinant plasmids obtain recombinating through the DH10BacE.coli swivel base, confirm that back transfection Sr9 cell obtains recombinant baculovirus.
Adopt TCID
50Method is measured the titre of baculovirus.Detailed process is as follows, each hole inoculation 10 in 96 orifice plates
4Individual Sf9 cell; Every kind of baculovirus does 10 times of dilutions of successive, from 10
-2To 10
-9Totally 8 extent of dilution, each extent of dilution are got 100ul and are added in the hole of one 96 orifice plate, and each extent of dilution is done 12 holes; Cultivate after ten days, microscopically observation of cell pathology situation utilizes the Reed-Muench method to calculate the TCID of various viruses
50
With 3 * 10
7TCID
50Virus infection 5 * 10
6The Sf9 cell infects the cell of collecting nutrient solution and infective virus in 24 and 48 hours in the back and supplies to detect usefulness, obtains the virus particle of purifying through ultracentrifugation.The fluorescence reading of luciferase is a benchmark value with the Pgp64-luc-GP64-hr3 viral sample of reading minimum in displaying cell and the viral sample, represent with multiple, show the amount of transcribing of each carrier with the luciferase scale of expressing in the cell, show the displaying amount of different carriers packaging virus with the luciferase scale that is contained in the virus.
In the time of 48 hours, Pph-luc-GP64, Pgp64-luc-GP64, pPvp39-luc-GP64, the Pph-luc-GP64-hr3 luciferase amount in cell is seen Fig. 2 (A), and the luciferase amount on virus envelope is seen Fig. 2 (B).In the time of 24 hours, Pph-luc-GP64, Pgp64-luc-GP64, pPvp39-luc-GP64, the Pph-luc-GP64-hr3 luciferase amount in cell is seen Fig. 2 (C), and the luciferase amount on virus envelope is seen Fig. 2 (D).In the combination of various different promoters and enhanser, be illustrated in the luciferase amount on the virus envelope, be proportionate with the amount of luciferase in the cells infected.In the time of 48 hours, three kinds of different promotors, with the transcribing and show most effectively of Pph, other two kinds of late promoter Pgp64 and Pvp39 do not have marked difference.In the combination of inserting the hr3 sequence, hr3 has only played the enhanced effect to transcribing with the displaying of luciferase of polyhedrin protein promotor, to the not obviously effect of other two kinds of late promoters.Though having hr3 to exist under the situation, Pph starts the raising that the expressed proteins total amount does not have highly significant, only 1.3 times, the amount of the luciferase of packaging is 4.2 times of Pph-luc-GP64 on the Pph-luc-GP64-hr3 virus particle.24 hours result is different from 48 o'clock.The virus that contains Pgp64 transcribes efficient or bandwagon effect all will be higher than other two kinds of promotors, finds early stage in the virus packing, and Pgp64 is most effective promotor.But under the effect of hr3 sequence, even in the time of 24 hours, transcribing with bandwagon effect of Pph is also better than Pgp64, but other two kinds of promotors but do not have considerable change.Illustrate that the hr3 sequence can strengthen the bandwagon effect of transcribing efficient and target protein of Pph, the Pph-GP64-hr3 carrier is that effect is best in six kinds of display carriers.
The preparation of embodiment 2, H5N1 avian influenza virus vaccine
The external transposon system of Bac-to-Bac of employing Invitrogen company (article No.: 10359-016 10608-016) also makes up H5N1 avian influenza virus vaccine of the present invention to specifications, and concrete grammar may further comprise the steps:
One, the clone of H5N1 avian influenza virus HA protein extracellular cDNA
The H5N1 avian influenza virus HA protein extracellular full-length cDNA that has the restriction enzyme site of restriction enzyme BamH I and Csp45 I according to the synthetic two ends of cDNA full length sequence design of H5N1 avian influenza virus HA protein gene respectively.
Two, the clone of the hr3 sequence of BmNPV
With wild Bombyx mori nuclear polyhydrosis virus genome is template, uses Pfu high-fidelity DNA polymerase (TAKARA) pcr amplification hr3 sequence (enhanser), and used primer is to as follows:
Upstream primer: 5 '-GGC
CCTAGGAGACAACAAAGATTTATTTTATTCATGCCACTACTCGGTTCGT-3 ';
Downstream primer: 5 '-GGC
CCTAGGACGTTCGTGCCAGAAATTAATTTCTCCGCGTCGTATTATACGAT-3 '.
Wherein, the scribe area of primer is the AvrII restriction enzyme site.
Pcr amplification product reclaims stand-by behind the agarose electrophoresis purifying.Through order-checking and BmNPV (GenBank
TMNo.L33180) the hr3 sequence conforms to, and is SEQ ID № in the sequence table: 5 nucleotide sequence.
Three, make up the baculovirus surface display carrier of H5N1 avian influenza virus HA protein extracellular
1, the structure of pPph-HA-VSVG
Be the carrier that sets out with the donor plasmid pFastBacl in the external transposon system of Bac-to-Bac, make up the baculovirus surface display carrier of H5N1 avian influenza virus HA protein extracellular.Concrete grammar is:
1) at first, after the encoding sequence GP64 SP of the signal peptide of the envelope protein GP64 of baculovirus self cut with restriction enzyme Bgl II and BamH I enzyme, is connected with the carrier pFastbacl that cuts through BamH I enzyme, and makes it in the right direction.
2) then, after the encoding sequence VSV-GTM+CTD that strides film district and intracellular region of the G albumen (VSV-G) of vesicular stomatitis virus cut with restriction enzyme Csp45 I and Hind III enzyme, the carrier that obtains with the step 1) of cutting through same enzyme was connected.
3) last, the full-length cDNA fragment of HA protein extracellular is cut back and the step 2 of cutting through enzyme equally with restriction enzyme BamH I and Csp45 I enzyme) carrier of acquisition is connected.
Obtain the baculovirus surface display carrier pPph-HA-VSVG of H5N1 avian influenza virus HA protein extracellular.
2, the structure of pPph-HA-VSVG-hr3
Be the carrier that sets out with the donor plasmid pFastBacl in the external transposon system of Bac-to-Bac, make up the baculovirus surface display carrier of H5N1 avian influenza virus HA protein extracellular.Concrete grammar is:
1) at first, after the encoding sequence GP64SP of the signal peptide of the envelope protein GP64 of baculovirus self cut with restriction enzyme Bgl II and BamH I enzyme, is connected with the carrier pFastbacl that cuts through BamH I enzyme, and makes it in the right direction.
2) then, after the encoding sequence VSV-GTM+CTD that strides film district and intracellular region of the G albumen (VSV-G) of vesicular stomatitis virus cut with restriction enzyme Csp45 I and Hind III enzyme, the carrier that obtains with the step 1) of cutting through same enzyme was connected.
3) step 2 that BmNPV hr3 sequence is cut the back and cut through same enzyme with restriction enzyme A vrII enzyme then) carrier of acquisition is connected.
4) last, the full-length cDNA fragment of HA protein extracellular is cut the back with restriction enzyme BamH I with Csp45 I enzyme be connected with the carrier that the step 3) of cutting through same enzyme obtains.
Obtain the baculovirus surface display carrier pPph-HA-VSVG-hr3 of H5N1 avian influenza virus HA protein extracellular, see Fig. 3 A.
3, the structure of pPph-HA-GP64
Be the carrier that sets out with the donor plasmid pFastBacl in the external transposon system of Bac-to-Bac, make up the baculovirus surface display carrier of H5N1 avian influenza virus HA protein extracellular.Concrete grammar is:
1) at first, with the encoding sequence GP64SP of the signal peptide of the envelope protein GP64 of baculovirus self) cut with restriction enzyme Bgl II and BamH I enzyme after, be connected with the carrier pFastbacl that cuts through BamH I enzyme, and make it in the right direction.
2) then, after the encoding sequence GP64TM+CTD that strides film district and intracellular region of the envelope protein GP64 of baculovirus self cut with restriction enzyme Csp45 I and Hind III enzyme, the carrier that obtains with the step 1) of cutting through same enzyme was connected.
3) last, the full-length cDNA fragment of HA protein extracellular is cut back and the step 2 of cutting through enzyme equally with restriction enzyme BamH I and Csp45 I enzyme) carrier of acquisition is connected.
Obtain the baculovirus surface display carrier pPph-HA-GP64 of H5N1 avian influenza virus HA protein extracellular.
Four, the acquisition of avian influenza vaccine
1, the acquisition of avian influenza vaccine I
The donor plasmid pPph-HA-VSVG that step 3 is made up changes E.coli DH10Bac competent cell (Invitrogen) over to the heat shock method, cultivate through 4 hours concussions, homologous recombination takes place in donor plasmid and bacmid, blue white screening recombinant bacterial strain, the big plasmid of extraction recombinant bacterial strain.To contain the genomic plasmid called after of recombinant baculovirus plasmid I.Plasmid I by liposome mediated-method transfection Sf9 cell, is collected the culture supernatant of transfectional cell after 5 days, promptly contain the recombinant baculovirus of the H5N1 avian influenza virus HA protein extracellular of budding pattern in the supernatant.Virus is connect a malicious generation again with the ratio of 0.1M.O.I, make titre be higher than 10
7Pfu/ml, the collecting cell culture supernatant places 4 ℃ to keep in Dark Place, as viral liquid storage.
Utilize viral liquid storage to inoculate a large amount of Sf9 cells, collecting cell culture supernatant after 48 hours.With supernatant 5000g, low-speed centrifugal 10 minutes is removed cell debris (precipitation) earlier; Carry out 100 again, 000g ultracentrifugation 90 minutes, precipitation virus.With the PBS of the 1/100 centrifugal front volume sedimentary virus that suspends, carry out sucrose density gradient centrifugation with 25% and 56% sucrose solution then, take out the viral band that is between the two-layer sucrose solution, the back 4 ℃ of preservations of dialysing.Obtain avian influenza vaccine I.
2, the acquisition of avian influenza vaccine II
The donor plasmid pPph-HA-VSVG-hr3 that step 3 is made up changes E.coli DH10Bac competent cell (Invitrogen) over to the heat shock method, cultivate through 4 hours concussions, homologous recombination takes place in donor plasmid and bacmid, blue white screening recombinant bacterial strain, the big plasmid of extraction recombinant bacterial strain.To contain the genomic plasmid called after of recombinant baculovirus plasmid II.Plasmid II by liposome mediated-method transfection Sf9 cell, is collected the culture supernatant of transfectional cell after 5 days, promptly contain the recombinant baculovirus of the H5N1 avian influenza virus HA protein extracellular of budding pattern in the supernatant.Virus is connect a malicious generation again with the ratio of 0.1M.O.I, make titre be higher than 10
7Pfu/ml, the collecting cell culture supernatant places 4 ℃ to keep in Dark Place, as viral liquid storage.
Utilize viral liquid storage to inoculate a large amount of Sf9 cells, collecting cell culture supernatant after 48 hours.With supernatant 5000g, low-speed centrifugal 10 minutes is removed cell debris (precipitation) earlier; Carry out 100 again, 000g ultracentrifugation 90 minutes, precipitation virus.With the PBS of the 1/100 centrifugal front volume sedimentary virus that suspends, carry out sucrose density gradient centrifugation with 25% and 56% sucrose solution then, take out the viral band that is between the two-layer sucrose solution, the back 4 ℃ of preservations of dialysing.Obtain avian influenza vaccine II.
3, the acquisition of avian influenza vaccine III
The donor plasmid pPph-HA-GP64 that step 3 is made up changes E.coli DH10Bac competent cell (Invitrogen) over to the heat shock method, cultivate through 4 hours concussions, homologous recombination takes place in donor plasmid and bacmid, blue white screening recombinant bacterial strain, the big plasmid of extraction recombinant bacterial strain.To contain the genomic plasmid called after of recombinant baculovirus plasmid III.Plasmid III by liposome mediated-method transfection Sf9 cell, is collected the culture supernatant of transfectional cell after 5 days, promptly contain the recombinant baculovirus of the H5N1 avian influenza virus HA protein extracellular of budding pattern in the supernatant.Virus is connect a malicious generation again with the ratio of 0.1M.O.I, make titre be higher than 10
7Pfu/ml, the collecting cell culture supernatant places 4 ℃ to keep in Dark Place, as viral liquid storage.
Utilize viral liquid storage to inoculate a large amount of Sf9 cells, collecting cell culture supernatant after 48 hours.With supernatant 5000g, low-speed centrifugal 10 minutes is removed cell debris (precipitation) earlier; Carry out 100 again, 000g ultracentrifugation 90 minutes, precipitation virus.With the PBS of the 1/100 centrifugal front volume sedimentary virus that suspends, carry out sucrose density gradient centrifugation with 25% and 56% sucrose solution then, take out the viral band that is between the two-layer sucrose solution, the back 4 ℃ of preservations of dialysing.Obtain avian influenza vaccine III.
The acquisition of 4, contrast virus
Extract the big plasmid in the E.coli DHi0Bac competent cell (Invitrogen),, collect the culture supernatant of transfectional cell after 5 days, promptly contain baculovirus in the supernatant by liposome mediated-method transfection Sf9 cell.Virus is connect a malicious generation again with the ratio of 0.1M.O.I, make titre be higher than 10
7Pfu/ml, the collecting cell culture supernatant places 4 ℃ to keep in Dark Place, as viral liquid storage.
Utilize viral liquid storage to inoculate a large amount of Sf9 cells, collecting cell culture supernatant after 48 hours.With supernatant 5000g, low-speed centrifugal 10 minutes is removed cell debris (precipitation) earlier; Carry out 100 again, 000g ultracentrifugation 90 minutes, precipitation virus.With the PBS of the 1/100 centrifugal front volume sedimentary virus that suspends, carry out sucrose density gradient centrifugation with 25% and 56% sucrose solution then, take out the viral band that is between the two-layer sucrose solution, the back 4 ℃ of preservations of dialysing.
Embodiment 3, the proteic evaluation of recombinant virus surface HA
Three kinds of recombinant viruses of the purifying that embodiment 2 is obtained carry out Western blot detection with contrast virus respectively.
Sample is transferred on the nitrocellulose filter after through 10% SDS-PAGE electrophoretic separation.The nitrocellulose filter that will have sample sealed 30 minutes at 37 ℃ with the TTBS that contains 5% skim-milk.Then, in the diluent (1:200 is diluted in the confining liquid) of the antibody (Abcam) of the anti-H5 type of rabbit avian influenza virus HA, 37 ℃ of effects 1 hour, TTBS gives a baby a bath on the third day after its birth time, each 10 minutes.Then the goat-anti rabbit two of AP mark anti-(company of middle China fir Golden Bridge, China) in the 1:200 diluent, 37 ℃ of effects 40 minutes, TTBS gives a baby a bath on the third day after its birth time, each 10 minutes.(Promega, Madison WI) are the substrate color development at room temperature with BCIP/NBT.
The results are shown in Figure 3B, HA albumen all detects in three kinds of recombinant baculovirus.The band present position is about 80KDa, and greater than calculated value 60KDa, this may be owing to express HA in the baculovirus expression system glycosylation modified reason to take place.Also have a band to be present near the 45KDa in viral I and viral II, showing that HA albumen is sheared becomes HA1 (47KDa) and two subunits of HA2.When the amount of capsid protein VP39 equated, the virus that different display carriers obtain was different to the bandwagon effect of HA, and viral II will be more than viral I more more than viral III, and did not detect the expression of HA in contrast virus.
The mouse immune of embodiment 4, recombinant virus and in and active testing
The used antigen of immune mouse is the avian influenza vaccine II and the contrast virus of embodiment 2 preparations.Every immunity 7 * 10 of the female mouse of 6 week Balb/c in age (dimension tonneau China company)
8The pfu purified virus.Booster immunization once is total to twice of booster immunization after 10 days.Last immunity back was collected the mice serum sample on the 7th day, and ELISA and neutralization experiment detect antibody titer.
(1) ELISA detects
With the BamHI/NotI site full-length cDNA fragment of HA protein extracellular is inserted prokaryotic expression carrier pET-28a, with recombinant plasmid transformed in E.coli BL21 competence.37 ℃ of re-activations of single bacterium colony are to OD value 0.5～1.0, with final concentration 0.1mM IPTG abduction delivering HA albumen.Centrifugal collection bacterial sediment, PBS washes one time, add the PBS ultrasonication, centrifugal, supernatant adds uses adsorption-buffering liquid (containing the 5mmol/L imidazoles) equilibrated ProBondresin in advance, and 4 ℃ are shaken 2h, rotating speed≤100rpm, wash 5 times with cleaning buffer solution (containing the 25mmol/L imidazoles),, collect elutriant with 1ml elution buffer (containing the 500mmol/L imidazoles) wash-out 5 times.SDS-PAGE detects each proteic concentration and purity, and purer albumen elutriant to 4 ℃ of dialysis twice of TrisHCl of 20mM pH8.0, is collected protein solution.
HA protein extracellular Na by the escherichia coli expression purifying
2CO
3Solution dilution, bag is spent the night for 4 ℃ by 96 orifice plates.After the PBS washing that contains 0.5% Tween 20 three times, with the PBS37 ℃ of sealing that contains 5% skim-milk 30 minutes.Each serum sample from 1/20 to 1/20480 is made 2 times of serial dilutions in confining liquid, and 37 ℃ act on 1 hour.In the mechanism, the concentration of envelope antigen is 20ug/ml.TPBS washes 3 times, each 10 minutes.The sheep anti mouse two of HRP mark is anti-, and (company of middle China fir Golden Bridge, China) 1:5000 is diluted in the confining liquid, 37 ℃ of effects 1 hour.TPBS washes 3 times, each 10 minutes.Face phenylenediamine and hydrogen peroxide colour developing, 2M sulfuric acid termination reaction with chromogenic substrate.With microplate reader (Tecan, Mannedorf, Switzerland) parameter OD492 reading of data.
The result is shown in Fig. 4 A.The OD490 reading is defined as the positive greater than 0.2.In three mice serums with vaccine II immunity, the final extent of dilution that the reaction of HA antibody ELISA is positive is 5120,2560 and 1280; And in three mice serums with the Bac virus immunity, the final extent of dilution that the reaction of H5 antibody ELISA is positive is 0,0 and 20.
(2) neutralization experiment
The neutralization experiment is carried out according to the plaque subtractive method (PRNT) of standard, and step is as follows:
1, be ready to be paved with the 35mm plate of individual layer mdck cell, serum to be checked is at 56 ℃ of heat inactivation 30min.
2, press 2 times of gradient dilution serum to be checked (1/2 to 1/256) with the DMEM substratum of serum-free; Prepare viral dilution liquid, make the H5N1 type avian influenza virus that contains 100pfu in the 50ul substratum; Viral dilution liquid and serum dilute sample equal-volume are mixed, and 37 ℃ act on 1 hour.
3, the plate of having cultivated the MDCK monolayer cell is given a baby a bath on the third day after its birth time with the substratum of serum-free, is that 1/4 to 1/512 serum to be checked and viral liquid mixture add Tissue Culture Dish with final extent of dilution, 37 ℃ of effects 1.5 hours.
4, remove mixture, in plate, add the DMEM substratum 3ml that contains 1% low melting-point agarose and 2mg/ml BSA, at 37 ℃ of 5% CO
2Cultivated 3 days under the condition.
5, treat that plaque forms the every plate in back and adds 2 * 10
-3Mg/ml neutral red solution 100ul removed substratum after 4 hours, and painted monolayer cell is air-dry, plaque counting.
Reaching 50% protection ratio with the serum dilute sample is serum terminal point titre, result such as Fig. 4 B.In three mice serums with vaccine II immunity, the extent of dilution of neutralization experiment 50% protection ratio is respectively 186,77 and 210.Do not detect the neutralizing antibody activity in the mice serum of contrast virus immunity.
Sequence table
＜110〉Peking University
＜120〉avian influenza virus vaccine and preparation method thereof
<130>CGGNARY82095
<160>5
<210>1
<211>34
<212>PRT
＜213〉artificial sequence
<220>
<223>
<400>1
<210>2
<211>42
<212>PRT
＜213〉artificial sequence
<220>
<223>
<400>2
<210>3
<211>71
<212>PRT
＜213〉artificial sequence
<220>
<223>
<400>3
<210>4
<211>129
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>4
<210>5
<211>1697
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>5
Claims (10)
1, surface display has the recombinant baculovirus of H5N1 type avian influenza virus HA protein extracellular.
2, H5N1 type avian influenza virus HA protein extracellular expression cassette, it comprises following assembly successively to the downstream from the upstream: the signal coding sequence of the envelope protein GP64 of polyhedrin protein promotor, baculovirus self, H5N1 type avian influenza virus HA protein extracellular, following a) or b) described sequence:
A) the proteic encoding sequence of striding film district and intracellular region of the G of vesicular stomatitis virus;
B) encoding sequence of striding film district and intracellular region of the envelope protein GP64 of baculovirus self.
3, expression cassette as claimed in claim 2 is characterized in that: described expression cassette a) or b) described sequence downstream has the hr3 sequence of silkworm baculovirus.
4, expression cassette as claimed in claim 3 is characterized in that: the signal peptide of the envelope protein GP64 of described baculovirus self has SEQ ID № in the sequence table: 1 amino acid residue sequence; The envelope protein gp64 of described baculovirus self stride the film district and intracellular region has SEQ ID № in the sequence table: 2 amino acid residue sequence; The G of described vesicular stomatitis virus is proteic to stride the film district and intracellular region has SEQ ID № in the sequence table: 3 amino acid residue sequence; Described polyhedron promotor has SEQ ID № in the sequence table: 4 nucleotide sequence; Described hr3 sequence has SEQ ID № in the sequence table: 5 nucleotide sequence.
5, the baculovirus surface display carrier that contains arbitrary described expression cassette in the claim 2 to 4.
6, surface display carrier as claimed in claim 5 is characterized in that: the carrier that sets out that is used to make up described display carrier is pFastBac DUAL or pFastBacl, preferred pFastBacl.
7, containing the genomic recombinant plasmid of recombinant baculovirus, is to transform the competent cell that contains baculovirus geneome plasmid Bacmid with claim 5 or 6 described display carriers, obtains after the homologous recombination.
8, recombinant plasmid as claimed in claim 7 is characterized in that: described competent cell is E.coliDH10Bac.
9, a kind of method for preparing the described recombinant baculovirus of claim 1 is with claim 7 or 8 described recombinant plasmid transfection insect cells, cultivates this insect cell and obtains recombinant baculovirus.
10, an avian influenza virus vaccine, its activeconstituents are the described recombinant baculovirus of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102410043A CN101440359B (en) | 2008-12-24 | 2008-12-24 | Avian influenza viral vaccine and preparation thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102410043A CN101440359B (en) | 2008-12-24 | 2008-12-24 | Avian influenza viral vaccine and preparation thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101440359A true CN101440359A (en) | 2009-05-27 |
| CN101440359B CN101440359B (en) | 2010-12-08 |
Family
ID=40724971
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008102410043A Expired - Fee Related CN101440359B (en) | 2008-12-24 | 2008-12-24 | Avian influenza viral vaccine and preparation thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101440359B (en) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102492691A (en) * | 2011-12-16 | 2012-06-13 | 西南大学 | Application of enhancer Hr3 for promoting Hycu-EP32 protein increment expression |
| CN103665150A (en) * | 2012-12-24 | 2014-03-26 | 江苏众红生物工程创药研究院有限公司 | Porcine beta2 epinephrine receptor fusion protein as well as encoding gene thereof and expression method |
| CN103789272A (en) * | 2012-10-31 | 2014-05-14 | 普莱柯生物工程股份有限公司 | H9 subtype avian influenza virus isolate and vaccine composition prepared thereby |
| CN104711278A (en) * | 2013-12-16 | 2015-06-17 | 特菲(天津)生物医药科技有限公司 | Recombinant sequence containing H7N9 virus HA gene, recombinant baculovirus and application of virus in vaccine preparation |
| CN105148264A (en) * | 2015-09-25 | 2015-12-16 | 厦门大学 | Universal influenza vaccine and preparation method thereof |
| CN105368798A (en) * | 2015-12-17 | 2016-03-02 | 武汉金开瑞生物工程有限公司 | Recombination baculovirus surface display system and method for recycling soluble protein |
| CN107988239A (en) * | 2017-11-29 | 2018-05-04 | 南方医科大学 | A kind of recombination of zika virus and its preparation method and application |
| CN109280675A (en) * | 2017-07-21 | 2019-01-29 | 百卫生物科技股份有限公司 | For enhancing expression cassette, carrier, virus and the vaccine of protein expression |
| CN110184284A (en) * | 2019-05-22 | 2019-08-30 | 华南农业大学 | The recombinant fowl influenza virus for carrying NanoLuc gene and its application in living imaging mouse model |
| CN116407624A (en) * | 2023-04-14 | 2023-07-11 | 吉林省农业科学院 | Preparation method and application of bacterial sample particle vaccine for infectious bronchitis |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102492692B (en) * | 2011-12-16 | 2013-07-10 | 西南大学 | Enhancer Hr3 |
-
2008
- 2008-12-24 CN CN2008102410043A patent/CN101440359B/en not_active Expired - Fee Related
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102492691B (en) * | 2011-12-16 | 2013-05-15 | 西南大学 | Application of enhancer Hr3 for promoting Hycu-EP32 protein increment expression |
| CN102492691A (en) * | 2011-12-16 | 2012-06-13 | 西南大学 | Application of enhancer Hr3 for promoting Hycu-EP32 protein increment expression |
| CN103789272B (en) * | 2012-10-31 | 2016-12-28 | 普莱柯生物工程股份有限公司 | H9 subtype avian influenza virus separation strain and the vaccine combination prepared by it |
| CN103789272A (en) * | 2012-10-31 | 2014-05-14 | 普莱柯生物工程股份有限公司 | H9 subtype avian influenza virus isolate and vaccine composition prepared thereby |
| CN103665150A (en) * | 2012-12-24 | 2014-03-26 | 江苏众红生物工程创药研究院有限公司 | Porcine beta2 epinephrine receptor fusion protein as well as encoding gene thereof and expression method |
| CN103665150B (en) * | 2012-12-24 | 2015-08-19 | 江苏众红生物工程创药研究院有限公司 | Pig β 2adrenoceptor fusion rotein and encoding gene thereof and expression method |
| CN104711278A (en) * | 2013-12-16 | 2015-06-17 | 特菲(天津)生物医药科技有限公司 | Recombinant sequence containing H7N9 virus HA gene, recombinant baculovirus and application of virus in vaccine preparation |
| CN105148264A (en) * | 2015-09-25 | 2015-12-16 | 厦门大学 | Universal influenza vaccine and preparation method thereof |
| CN105148264B (en) * | 2015-09-25 | 2018-01-02 | 厦门大学 | A kind of influenza vaccines of universality and preparation method thereof |
| CN105368798A (en) * | 2015-12-17 | 2016-03-02 | 武汉金开瑞生物工程有限公司 | Recombination baculovirus surface display system and method for recycling soluble protein |
| CN109280675A (en) * | 2017-07-21 | 2019-01-29 | 百卫生物科技股份有限公司 | For enhancing expression cassette, carrier, virus and the vaccine of protein expression |
| CN107988239A (en) * | 2017-11-29 | 2018-05-04 | 南方医科大学 | A kind of recombination of zika virus and its preparation method and application |
| CN110184284A (en) * | 2019-05-22 | 2019-08-30 | 华南农业大学 | The recombinant fowl influenza virus for carrying NanoLuc gene and its application in living imaging mouse model |
| CN110184284B (en) * | 2019-05-22 | 2021-02-19 | 华南农业大学 | Recombinant avian influenza virus carrying NanoLuc gene and application thereof in vivo imaging mouse model |
| CN116407624A (en) * | 2023-04-14 | 2023-07-11 | 吉林省农业科学院 | Preparation method and application of bacterial sample particle vaccine for infectious bronchitis |
| CN116407624B (en) * | 2023-04-14 | 2024-04-09 | 吉林省农业科学院(中国农业科技东北创新中心) | Preparation method and application of bacterial sample particle vaccine for infectious bronchitis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101440359B (en) | 2010-12-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101440359B (en) | Avian influenza viral vaccine and preparation thereof | |
| Huang et al. | The hemagglutinin-neuraminidase protein of Newcastle disease virus determines tropism and virulence | |
| CN100390289C (en) | Method for producing influenza hemagglutinin multivalent vaccines | |
| Harrison et al. | Autographa californica multiple nucleopolyhedrovirus ODV-E56 envelope protein is required for oral infectivity and can be substituted functionally by Rachiplusia ou multiple nucleopolyhedrovirus ODV-E56 | |
| CN104480143B (en) | A kind of preparation method of the carrier and poliovirus sample particle for expressing poliovirus sample granule protein | |
| CN101270155B (en) | Method for assembling foot and mouth disease virus hollow capsid in insect with acidproof improvement | |
| CN1437655A (en) | Assembly of wild-type and chimeric influenza virus-like particles (VLPS) | |
| CN109641041A (en) | Influenza virus haemagglutinin albumen and application thereof | |
| Tretyakova et al. | Preparation of quadri-subtype influenza virus-like particles using bovine immunodeficiency virus gag protein | |
| US20230160892A1 (en) | Recombinant viruses, insect cells and their uses in viral detection and vaccination | |
| Liu et al. | Formation of peste des petits ruminants spikeless virus-like particles by co-expression of M and N proteins in insect cells | |
| CN108715866A (en) | A kind of recombinant viral vector, vaccine and the preparation method and application thereof | |
| CN109073639B (en) | Compositions of influenza hemagglutinin with heterologous epitopes and/or altered mature cleavage sites | |
| RU2757723C2 (en) | Recombinant virus-like particles (vlp) using a protein of the bovine immunodeficiency virus group antigen (gag) | |
| Dalton et al. | Chimeric VLPs bearing VP60 from two serotypes of rabbit haemorrhagic disease virus are protective against both viruses | |
| CN104711278A (en) | Recombinant sequence containing H7N9 virus HA gene, recombinant baculovirus and application of virus in vaccine preparation | |
| Takemoto et al. | The N-terminal region of an entomopoxvirus fusolin is essential for the enhancement of peroral infection, whereas the C-terminal region is eliminated in digestive juice | |
| Rodríguez-Hernández et al. | Baculovirus display of peptides and proteins for medical applications | |
| Barros et al. | Yellow fever virus envelope protein expressed in insect cells is capable of syncytium formation in lepidopteran cells and could be used for immunodetection of YFV in human sera | |
| Kim et al. | Role of the cytoplasmic tail amino acid sequences of Newcastle disease virus hemagglutinin-neuraminidase protein in virion incorporation, cell fusion, and pathogenicity | |
| CN102370976B (en) | Mixed virus-like particles of swine influenza virus and foot and mouth disease virus, preparation method and application thereof | |
| Marriott et al. | Reverse genetics system for Chandipura virus: tagging the viral matrix protein with green fluorescent protein | |
| Kawarabata et al. | Functional differences between occluded and nonoccluded viruses of a nuclear polyhedrosis of the silkworm, Bombyx mori | |
| Ayora-Talavera et al. | Hemagglutinin variants of influenza A (H1N1) pdm09 virus with reduced affinity for sialic acid receptors | |
| Yu et al. | Critical residues and contacts within domain IV of Autographa californica multiple nucleopolyhedrovirus GP64 contribute to its refolding during membrane fusion |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101208 Termination date: 20131224 |