CN105368797A

CN105368797A - Recombinant porcine pseudorabies virus strain expressing porcine parvovirus VP2 gene

Info

Publication number: CN105368797A
Application number: CN201510568539.1A
Authority: CN
Inventors: 陈红英; 魏战勇; 付朋飞; 杨明凡; 乔涵; 杨兴武; 张宇
Original assignee: Henan Agricultural University
Current assignee: Henan Agricultural University
Priority date: 2015-09-09
Filing date: 2015-09-09
Publication date: 2016-03-02

Abstract

The invention discloses a recombinant porcine pseudorabies virus strain expressing a porcine parvovirus VP2 gene. The recombinant porcine pseudorabies virus strain is characterized in that the recombinant porcine pseudorabies virus (Herpesviridae) strain is numbered as CCTCC NO.V201346. The recombinant porcine pseudorabies virus strain uses porcine parvovirus (PPV) 7909 standard strain DNA as a template, a VP2 protein gene segment with the 1635 bp length is amplified by using a PCR method, and BamH I enzyme digestion sites are introduced in upstream and downstream primers. A PCR product (a PPV VP2 target fragment) is purified and recovered and then is connected to a pMD18-T carrier, and a recombinant plasmid pMD-VP2 is successfully established. The recombinant plasmid is transferred to an escherichia coli competent cell, the VP2 gene undergoes mass propagation, then the recombinant plasmid pMD-VP2 is extracted and undergoes BamH I enzyme digestion, and then the recovered VP2 segment is connected with a pG plasmid.

Description

A kind of recombinant porcine pseudorabies strain of expressing pig parvoviral VP2 gene

Technical field

The present invention relates to recombinant porcine pseudorabies strain, be specifically related to a kind of recombinant porcine pseudorabies strain of expressing pig parvoviral VP2 gene.

Background technology

Pig parvoviral (Porcineparvovirus, PPV) be Parvoviridae, parvovirus belong in member, one of important pathogen body of Reproduction Disorder, its principal character be cause first farrowing sow to miscarry, output stillborn foetus, mummy tire and cause the death of newborn piglet.This disease is distributed in pig farm all over the world, and early 1980s has been separated to this virus in the different areas of China, confirms that this virus is one of important pathogen body causing sow generation Reproduction Disorder afterwards, brings serious blow to China's pig industry.

At present, prevent the conventional vaccine of this disease to be PPV deactivation vaccine and Attenuate vaccine, but PPV deactivation vaccine need repeatedly booster immunization and stimulates body to produce humoral immunization only, and to cellular immunization without enhancement; PPV Attenuate vaccine has certain toxicity and there is the shortcomings such as virulence reversion.Though have the research of PPVDNA vaccine and subunit vaccine to report at present, because the high cost of subunit vaccine, DNA vaccination to limit the propagation and employment of these vaccines in machine expression in vivo uncertainty, therefore virus live vector vaccine research has important practical significance.

Pseudorabies virus (Pseudorabiesvirus, PRV) occurs except nervous symptoms except causing newborn piglet, also usually makes pregnant sow miscarry, produces stillborn foetus; This virus also can cause boar sterile simultaneously, is the another important pathogen body causing swinery breeding difficulty.PRV nucleic acid is double-strand linear DNA, and its length is about 150kb, viral genome has multiplely copy irrelevant dispensable gene with it, is one of conventional live vector.

The genome of PPV is sub-thread minus-strand dna, its genome is about 5kb, this virogene is encoded 3 kinds of virus structural proteins and 2 kinds of Nonstructural Proteins altogether, VP1, VP2, VP3 and NS1, NS2 albumen respectively, VP2 albumen is wherein the important antigen protein of this virus, there is the ability that oneself is folded into virus-like particle, and immune effect is better, effectively can produces immune response by induced animal body.

Therefore, the present invention using VP2 albumen stronger for immunogenicity in coding PPV structural protein as research object, with PRV attenuated vaccine strain for parent, construct the recombinant pseudorabies virus PRV-PPVPGVP2 strain that can give expression to VP2 albumen, by the proliferation test of PRV-PPVPGVP2 recombinant virus in various kinds of cell, probe into its growth infection characterization on some cells; Safety testing result shows that this recombinant virus is safe to mouse; Genetic stability test shows that the inherited character of the recombinant pseudorabies virus including VP2 gene is more stable; The VP2 gene that the display of RT-PCR, Westernblot result is inserted can be expressed in recombinant virus PRV-PPVPGVP2.Subsequently by recombinant virus PRV-PPVPGVP2, PRVHB98 vaccine, commercial PPV inactivated vaccine and DMEM negative control dorsal sc inoculation female KM small white mouse in 6 week age respectively, after two weeks, carry out a booster immunization again.One exempt from after within the 7th week, with PRV strong poison, challenge test is carried out to 5 mouse in every group.Result display PRV-PPVPGVP2 can produce PPV specific antibody by inducing mouse; The mensuration of peripheral T lymphocyte subsets of mice shows that recombinant virus group effectively can induce body generation cell immune response; Challenge test shows that recombinant virus immune group and PRV attenuated vaccine immunity group all can resist the attack of the strong poison of PRV, provides effective theory and technology support for the further exploitation of recombinant virus and PPV and PRV combine control.

Summary of the invention

The object of this invention is to provide a kind of recombinant porcine pseudorabies poison strain of expressing pig parvoviral VP2 gene, Classification And Nomenclature: the recombinant porcine pseudorabies poison PRV-PPVPGVP2 expressing PPVVP2 gene, Latin name: Herpesviridae.Depositary institution: China typical culture collection center, depositary institution is called for short: CCTCC, depositary institution address: Wuhan, China Wuhan University, preservation date: on November 18th, 2013, deposit number CCTCCNO:V201346.

Technical scheme of the present invention is: a kind of recombinant porcine pseudorabies poison strain of expressing pig parvoviral VP2 gene, is characterized in that: recombinant porcine pseudorabies poison (Herpesviridae) strain, CCTCCNO:V201346.

The invention has the beneficial effects as follows: the present invention for template with pig parvoviral (PPV) 7909 type strain DNA, has amplified by PCR method the VP2 protein gene fragment that length is 1635bp, and in upstream and downstream primer, all introduced BamH I restriction enzyme site.Be connected to pMD18-T carrier after being reclaimed by PCR primer (PPVVP2 object fragment) purifying, successfully construct recombinant plasmid pMD-VP2.This recombinant plasmid is proceeded to competent escherichia coli cell, VP2 gene is bred in a large number, then extract after recombinant plasmid pMD-VP2 BamH I enzyme cuts, reclaim VP2 fragment and be connected with pG plasmid.The present invention have selected structure and is not directly connected with pG plasmid by the PCR primer reclaimed containing the recombinant plasmid of pMD-VP2, because construct recombinant plasmid pMD-VP2, not only can obtain the single VP2 gene fragment of a large amount of purifying at any time, and the sequencing of the enzyme being more conducive to BamH I effect of cutting and PPVVP2 gene fragment.

Accompanying drawing explanation

Fig. 1 is the structure schema of recombinant virus PRV-PPVPGVP2, pG is pseudo-rabies universal transfer plasmids, containing PRV autogene gG late promoter, also have CMV promoter, SV40Poly (A) and green fluorescence protein gene (GFP) in addition.Cloned plasmids pMD-VP2 contains PPVVP2 gene (about 1.6kb).With BamH I enzyme cutting clone plasmid pMD-VP2, obtain PPVVP2 fragment, be inserted into same process and in dephosphorylized pG, obtain transferring plasmid pGVP2.Transferring plasmid pGVP2 and pseudo-rabies low virulent strain full-length genome cotransfection ST cell, obtain recombinant virus PRV-PPVPGVP2;

Fig. 2 is the pcr amplification of VP2 gene, M.DNAMarkerDL2000; 1-4.PCR product; C. negative control;

Fig. 3 is the pcr amplification of VP2 gene in recombinant plasmid pMD-VP2, M.DNAMarkerDL2000; 1.PCR product; C. negative control;

Fig. 4 is that the enzyme of recombinant plasmid pMD-VP2 cuts qualification figure, M1.Trans15KDNAMarker; 1-3.BamHI enzyme is cut; M2.DNAmarkerDL2000;

Fig. 5 is that the enzyme of recombinant plasmid pGVP2 cuts qualification figure, M1.SuperDNAMarker; 1. recombinant plasmid pGVP2 contrasts; 2.Hind III digestion products; 3.BamH I digestion products; 4. negative control; M2.DNAmarkerDL2000;

Fig. 6 is the green fluorescence that after transfection, after 24h, ST cell sends;

Fig. 7 is the green fluorescence that after optimal conditions transfection 24h, ST cell sends;

Fig. 8 is the plaque photo observed under different light after the 5th plaque select;

Fig. 9 is restructuring poison inoculation ST cell 6h cytopathy;

Figure 10 is restructuring poison inoculation ST cell 12h cytopathy;

Figure 11 is restructuring poison inoculation ST cell 24h cytopathy;

Figure 12 is restructuring poison inoculation ST cell 36h cytopathy;

Figure 13 is restructuring poison inoculation ST cell 48h cytopathy;

Figure 14 is restructuring poison inoculation PK-15 cell 6h cytopathy;

Figure 15 is restructuring poison inoculation PK-15 cell 12h cytopathy;

Figure 16 is restructuring poison inoculation PK-15 cell 24h cytopathy;

Figure 17 is restructuring poison inoculation PK-15 cell 36h cytopathy;

Figure 18 is restructuring poison inoculation PK-15 cell 48h cytopathy;

Figure 19 is restructuring poison inoculation PK-15 cell 60h cytopathy;

Figure 20 is recombinant virus inoculation VERO cell 6h cytopathy;

Figure 21 is recombinant virus inoculation VERO cell 12h cytopathy;

Figure 22 is recombinant virus inoculation VERO cell 24h cytopathy;

Figure 23 is recombinant virus inoculation VERO cell 36h cytopathy;

Figure 24 is recombinant virus inoculation VERO cell 48h cytopathy;

Figure 25 is recombinant virus inoculation IPEC cell 6h cytopathy;

Figure 26 is recombinant virus inoculation IPEC cell 12h cytopathy;

Figure 27 is recombinant virus inoculation IPEC cell 24h cytopathy;

Figure 28 is recombinant virus inoculation IPEC cell 36h cytopathy;

Figure 29 is recombinant virus inoculation IPEC cell 48h cytopathy;

Figure 30 is the growth curve analysis of recombinant virus PRV-PPVPGVP2;

Figure 31 is that mono-clonal recombinant virus goes down to posterity the green fluorescence photo observed after 20 times;

Figure 32 is the PCR qualification of recombinant virus VP2 gene, M.DNAMarkerDL2000; 1-10.PCR product; C. negative control

Figure 33 is RT-PCR product electrophorogram, M.DNAMarkerDL2000; 1.RT-PCR product; C. negative control;

Figure 34 is the Westernblot qualification of recombinant virus PRV-PPVPGVP2VP2 albumen, M.Proteinmarker; 1.PRV-PPVPGVP2; C1. pseudo-rabies low virulent strain contrast; C2.ST cell controls;

Figure 35 is mouse PPV antibody test;

Figure 36 is PRV NAT level (log2);

Figure 37 is the mensuration of CD3+, CD4+, CD8+T lymphocyte quantity in mouse peripheral blood.

Embodiment

Express a recombinant porcine pseudorabies poison strain for pig parvoviral VP2 gene, Classification And Nomenclature: the recombinant porcine pseudorabies poison PRV-PPVPGVP2 expressing PPVVP2 gene, Latin name: Herpesviridae.Depositary institution: China typical culture collection center, depositary institution is called for short: CCTCC, depositary institution address: Wuhan, China Wuhan University, preservation date: on November 18th, 2013, deposit number CCTCCNO:V201346.

One, the structure of pig parvoviral VP2 gene recombination pseudorabies virus live vector

1 materials and methods

1.1 material

1.1.1 virus and plasmid

Pseudo-rabies low virulent strain is purchased from certain biological products company; Pig parvoviral (PPV) 7909 type strain is purchased from China Veterinary Drugs Supervisory Inst.; PMD18-T carrier is purchased from precious biotechnology (Dalian) company limited.

1.1.2 main agents

DNAMarkerDL2000, SuperDNAMarker, pMD18-TVector, T ₄dNA ligase, Hind III, BamHI restriction enzyme etc. are purchased from precious biotechnology (Dalian) company limited; Health is that century quick sepharose DNA reclaims test kit, OMEGA

D6943-02PlasmidMiniKitI (200) plasmid Mini Kit is purchased from Tian Chi bio tech ltd, Zhengzhou; BIOMIGA without intracellular toxin plasmid extraction kit purchased from Sai Si bio tech ltd, Zhengzhou; Lipofectamine ^tM2000Reagent is purchased from Invitrogen company; 2 × TaqMasterMix is purchased from Beijing CoWin Bioscience Co., Ltd.; DMEM cell culture fluid, 1640 cell culture fluids, OPTI-MEM serum-free medium, foetal calf serum are purchased from Hyclone company.

1.2 method

1.2.1 design of primers and synthesis

With reference to the VP2 gene reading frame frame in the pig parvoviral gene (M38367.1) delivered in GenBank, primer-design software Premier5.0 is utilized to design 1 pair of primer, introduce a BamHI restriction enzyme site (underscore part) at 5 ' end of upstream and downstream primer, the object fragment that primer amplifies is about 1.6kb simultaneously.This primer is synthesized by Shanghai biotechnology company limited.

Upstream primer sequence is 5 '-ACC gGATCCaTGGGGGGGGTTGGTGTGTCTAC-3 '

Downstream primer sequence is 5 '-ATC gGATCCcTAGTATAATTTTCTTGG-3 '

1.2.2PPV cultivation and the extraction of viral DNA

The PPV that this laboratory is preserved is inoculated into the PK-15 cell growing up to individual layer, abandons supernatant after 37 DEG C of absorption 2h, then add the RPMI-1640 cell maintenance medium containing 2% foetal calf serum, 37 DEG C, 5%CO ₂be cultured to after pathology appears in 80% cell under condition, receive poison.

Get the PPV cell culture obtained,-20 DEG C with normal temperature multigelation 3 times with lysing cell, the centrifugal 5min of 8000rpm, get centrifugal after viral supernatant suspension 400 μ L be transferred in new centrifuge tube, add isopyknic SDS lysate and 6 μ L Proteinase Ks (final concentration is 200 μ g/mL), mix rear 55 DEG C of water-bath 1h ~ 3h, conventionally extract viral DNA, the DNA of extracting is dissolved in 20 μ LddH ₂o ,-20 DEG C save backup.1.2.3 the structure of recombinant plasmid pMD-VP2

1.2.3.1PPVVP2 the amplification of gene

With the PPVDNA extracted for template carries out pcr amplification, amplification system is: each 0.5 μ L of 2 × TaqMasterMix12.5 μ L upstream and downstream primer, DNA profiling, 3.0 μ L, make up water to 25 μ L.Reaction conditions: 95 DEG C of 5min; 94 DEG C of 1min; 55 DEG C of 45s; 72 DEG C of 2min carry out 30 circulations altogether; 72 DEG C of ends extend 10min; 4 DEG C of 10min.Amplification PCR primer 1% sepharose carries out electrophoresis observation result.1.2.3.2 connect

With reference to the specification sheets that health is in century quick sepharose DNA recovery test kit, purifying reclaims specific DNA object band.Get purifying and reclaim product, be connected with pMD18-TVector, linked system is: 5 μ L purifying DNA fragments, 4 μ LSolutionI, 1 μ LpMD18-T carrier, totally 10 μ L.This process need operate on ice chest, after application of sample completes, connects and spend the night in 16 DEG C of low temperature connective slots.

1.2.3.3 transform and choose spot

Getting 5 μ L connection products adds in 50 μ LDH5 α competent cells, ice bath 30min after mixing gently; 42 DEG C of water-bath heat shock 90s, immediately ice bath 15min; Add through 37 DEG C of preheated LB liquid nutrient medium 950 μ L, 37 DEG C of gentle vibrations (150 ~ 210rpm) cultivate 1h; The centrifugal 5min of 3000rpm; After supernatant is abandoned in aseptic suction, with 100 μ LLB liquid nutrient medium Eddy diffusions; First add 42 μ LX-gal (20mg/mL) and 42 μ LIPTG (20mg/mL) to containing even spread on the LB solid culture flat board of penbritin (100 μ g/mL), 37 DEG C of absorption 30min, and then add resuspended bacterium liquid, even with glass rod coating; The plate coated just is being put in 37 DEG C of constant incubators and is cultivating 30min, then be inverted cultivation 12-14h.

Have on the LB solid plate of bacterium colony in growth, the several single white colony of random picking, is inoculated in the LB liquid nutrient medium containing penbritin respectively, and 37 DEG C of water-bath concussion incubated overnight, set the locus coeruleus of picking as negative control simultaneously.

1.2.3.4 the PCR of recombinant plasmid pMD-VP2, enzyme are cut and check order qualification

Reference OMEGAD6943-02PlasmidMiniKitI (200) plasmid Mini Kit specification sheets extraction recombinant plasmid, carries out PCR to recombinant plasmid and enzyme cuts qualification, PCR reaction system and the same 1.2.3.1 of condition.

The PCR that learns from else's experience is initially identified as positive recombinant plasmid pMD-VP26 μ L, and carry out enzyme with Q.CutBamH I and cut, system is as follows: 10 × Q.CutG.Buffer1 μ L, Q.CutBamH I 1 μ L, plasmid 6 μ L, ddH ₂o2 μ L, totally 10 μ L.Put 30 DEG C of water-baths digestion 10-30min (general 20min), electrophoresis observation enzyme cuts result.

Get plasmid PCR and enzyme to cut qualification and be positive recombinant plasmid and serve marine life Engineering Co., Ltd and carry out sequencing.The sequence of mensuration is carried out the comparison of Blast homology in NCBI, with determine further clone's object fragment VP2 gene that is PPV.

1.2.4pGVP2 the structure of transferring plasmid

1.2.4.1pG the connection of carrier and foreign DNA object fragment (VP2)

Carry out enzyme with BamH I couple of plasmid pMD-VP2 to cut, obtain PPVVP2 fragment.Carry out enzyme with BamH I pair of pG plasmid again to cut, then with CIAP, dephosphorylation process is carried out to digestion products, 37 DEG C of rearmounted 4 DEG C of refrigerator overnight of water-bath 30min, then reclaim test kit with DNA gel and glue recovery is carried out to the product after dephosphorylation.PG carrier is connected with foreign DNA object fragment (VP2), LigationBuffer1.0 μ L, dephosphorylation pG carrier 2.0 μ L, external source VP2 gene 6.0 μ L, T ₄dNAligase1.0 μ L, totally 10 μ L, connect after mixing and spend the night in 16 DEG C of connective slots.

1.2.4.2 product conversion is connected

From-80 DEG C of cryogenic refrigerators get a DH5 α competent cell (50 μ L) put immediately mixture of ice and water melt after, add and connect product 5 μ L, after ice bath 30min, 42 DEG C of heat shock 90s, and then rapid ice bath 15min, add 950 μ L not containing the antibiotic LB liquid nutrient medium of Amp, 37 DEG C, 250r/min water-bath concussion cultivation 1h; Asepticly after the centrifugal 5min of 3000rpm discard 900 μ L supernatant liquors, with the resuspended precipitation thalline of remaining 100 μ L liquid in pipe, be uniformly coated on the LB solid plate containing Amp (50 μ g/mL), coat 20 μ LX-gal and 4 μ LIPTG mixing liquids again, first just putting in 37 DEG C of constant incubators after cultivating 30min and be inverted cultivation 12-16h again.

1.2.4.3 the qualification of recombinant plasmid pGVP2

The single white colony of picking from the flat board after above-mentioned conversion, and be inoculated in 4mLAmp+LB liquid nutrient medium, 37 DEG C, 250r/min water-bath concussion overnight incubation, with plasmid extraction kit to specifications step carry out plasmid extraction, by extract plasmid called after pGVP2 (Fig. 1).Carry out the pcr amplification of VP2 gene with recombinant plasmid pGVP2 for template, with BamHI, enzyme is carried out to recombinant plasmid pGVP2 simultaneously and cut qualification.And cut qualification with the enzyme that BamHI and Hind III couple of recombinant plasmid pGVP2 carries out direction of insertion respectively.

Learn from else's experience PCR and enzyme is cut qualification and is the positive and the correct pGVP2 plasmid of direction of insertion is delivered to Hua Da gene company limited and checked order.

1.2.5PRV the propagation of low virulent strain and genomic extraction thereof

The PRV low virulent strain preserved in this laboratory is inoculated into the ST cell growing up to individual layer, abandons supernatant, then add the RPMI-1640 cell maintenance medium containing 2% foetal calf serum, 37 DEG C, 5%CO after 37 DEG C of absorption 2h ₂be cultured to after pathology appears in 80% cell under condition, receive poison, put-20 DEG C of Refrigerator stores.

Get the PRV cell culture obtained,-20 DEG C with normal temperature multigelation 3 times with lysing cell, the centrifugal 5min of 8000rpm, get centrifugal after viral supernatant suspension 400 μ L be transferred in new centrifuge tube, add isopyknic SDS lysate and 6 μ L Proteinase Ks (final concentration is 200 μ g/mL), mix rear 55 DEG C of water-bath 1h-3h, shake up for several times to help digest evenly therebetween, then mixed solution is proceeded in autoclaved 1.5mLEppendorf pipe, conventionally extract viral full-length genome.

1.2.6 transfection

Recovery ST cell, before transfection, cell was reached for the 3rd generation by 24h according to a conventional method, is added in 6 orifice plates, when cell grows to about 90%, carries out transfection by cell suspension even for digestion after-blow.Go the little extraction reagent kit of intracellular toxin plasmid to extract recombinant plasmid (pGVP2) with BIOMIGA simultaneously.

With reference to liposome Lipofectamine ^tM2000 transfection reagent box specification sheetss carry out the cotransfection of pseudo-rabies low virulent strain full-length genome and transfer vector recombinant plasmid pGVP2, and after optimal conditions, step is as follows:

(1) get 2 and be also labeled as A, B respectively through autoclaved Eppendorf centrifuge tube.Add 4 μ gpGVP2 plasmids and PRVDNA10 μ g in A pipe and mend respectively to 250 μ LOPTI-MEM serum-free mediums and mix with have gentle hands bullet; Add 240 μ LOPTI-MEM serum-free mediums and 6 μ L liposomes in B pipe successively and flick mixing (time of repose is no more than 5min).Set up pGVP2 carrier to carry out transfection control simultaneously.

(2) with liquid-transfering gun, B liquid in pipe is dropwise slowly joined in A pipe, flick with full and uniform, leave standstill 25min.Discard six orifice plate inner cell nutrient solutions, wash 3 times with D-Hanks liquid, it is for subsequent use then to add 1.5mLOPTI-MEM serum-free medium.

(3) blow and beat A pipe gently, to make the mixture precipitation in pipe resuspended, suspension is dropwise inoculated into ST cell monolayer in six orifice plates, puts 37 DEG C, 5%CO ₂cultivate 3h in incubator, inhale afterwards and abandon nutrient solution in hole, D-Hanks liquid wash 3 times afterwards every hole add 2mL cell maintenance medium, put 37 DEG C, 5%CO ₂cultivate in incubator, and after transfection, 24h observes fluorescence, collects multigelation 3 times, to gather in the crops recombinant virus liquid after 36h cytopathy.1.2.7 the pcr amplification of VP2 fragment in recombinant virus PRV-PPVPGVP2

Learn from else's experience the recombinant virus cell culture fluid after multigelation 3 times, carry out viral DNA extraction according to 1.2.2 step, the PCR reaction system of amplification VP2 fragment and the same 1.2.3.1 of condition, amplification PCR primer 1% sepharose carries out electrophoresis observation result.

2 results and analysis

The pcr amplification result of 2.1PPVVP2 gene

Carry out pcr amplification by the VP2 gene fragment of Auele Specific Primer to PPV of synthesis, amplified production electrophoresis result shows to have amplified the band (see Fig. 2) of about 1.6kb, conforms to expected results.

PCR and the enzyme of 2.2 recombinant plasmid pMD-VP2 cut qualification result

Carry out pcr amplification with the VP2 gene of Auele Specific Primer to recombinant plasmid pMD-VP2 of synthesis, electrophoresis detection result is presented at about 1.6kb place object band (Fig. 3) clearly, conforms to expected results.

Carrying out enzyme with BamHI to pMD-VP2 plasmid to cut, there are 2 bands in electrophoresis result, and 1 is the object band inserted, and position is about 1.6kb, and other 1 is carrier ribbon, and position is about 2.7kb (Fig. 4).

2.3 the sequencing of VP2 fragment in recombinant plasmid pMD-VP2

Get plasmid to cut qualification through PCR and enzyme and be positive recombinant plasmid pMD-VP2 and serve marine life Engineering Co., Ltd and carry out sequencing.The sequence of mensuration, as described in SEQIDNo:1, is carried out the comparison of Blast homology by sequencing result in NCBI, result display clone the VP2 gene that object fragment is PPV.

ATGGGGGGGGTTGGTGTGTCTACAGGTACTTTCAATAATCAAACAGAATTTCAATACTTGGGGGAGGGCTTGGTTAGAATCACTGCACACGCATCAAGACTCATACATCTAAATATGCCAGAACACGAAACATACAAAAGAATACATGTACTAAATTCAGAATCAGGGGTGGCGGGACAAATGGTACAAGACGATGCACACACACAAATGGTAACACCTTGGTCACTAATAGATGCTAACGCATGGGGAGTGTGGTTCAATCCAGCGGACTGGCAGTTAATATCCAACAACATGACAGAAATAAACTTAGTTAGTTTTGAACAAGAAATATTCAATGTAGTACTTAAAACAATTACAGAATCAGCAACCTCACCACCAACCAAAATATATAATAATGATCTAACTGCAAGCTTAATGGTCGCACTAGACACCAATAACACACTTCCATACACACCAGCAGCACCTAGAAGTGAAACACTTGGTTTTTATCCATGGTTACCTACAAAACCAACTCAATACAGATATTACCTATCATGCATCAGAAACCTAAATCCACCAACATACACTGGACAATCACAACAAATAACAGACTCAATACAAACAGGACTACACAGTGACATTATGTTCTACACAATAGAAAATGCAGTACCAATTCATCTTCTAAGAACAGGAGATGAATTCTCCACAGGAATATATCACTTTGACACAAAACCACTAAAATTAACTCACTCATGGCAAACAAACAGATCTCTAGGACTGCCTCCAAAACTACTAACTGAACCTACCACAGAAGGAGACCAACACCCAGGAACACTACCAGCAGCTAACACAAGAAAAGGTTATCACCAAACAATTAATAATAGCTACACAGAAGCAACAGCAATTAGGCCAGCTCAGGTAGGATATAATACACCATACATGAATTTTGAATACTCCAATGGTGGACCATTTCTAACTCCTATAGTACCAACAGCAGACACACAATATAATGATGATGAACCAAATGGTGCTATAAGATTTACAATGGATTACCAACATGGACACTTAACCACATCTTCACAAGAGCTAGAAAGATACACATTCAATCCACAAAGTAAATGTGGAAGAGCTCCAAAGCAACAATTTAATCAACAGGCACCACTAAACCTAGAAAATACAAATAATGGAACACTTTTACCTTCAGATCCAATAGGAGGGAAATCTAACATGCATTTCATGAATACACTCAATACATATGGACCATTAACAGCACTAAACAATACTGCACCTGTATTTCCAAATGGTCAAATATGGGATAAAGAACTTGATACAGATCTAAAACCTAGACTACATGTTACAGCTCCATTTGTTTGTAAAAACAATCCACCAGGACAACTATTTGTAAAAATAGCACCAAACCTAACAGATGATTTCAATGCTGACTCTCCTCAACAACCTAGAATAATAACTTATTCAAACTTTTGGTGGAAAGGAACACTAACATTCACAGCAAAAATGAGATCCAGTAATATGTGGAACCCTATTCAACAACACACAACAACAGCAGAAAACATTGGTAACTATATTCCTACAAATATTGGTGGCATAAGAATGTTTCCAGAATATTCACAACTTATACCAAGAAAATTATACTAG

PCR and the enzyme of 2.4 recombinant plasmid pGVP2 cut qualification

Carry out pcr amplification with the VP2 Auele Specific Primer of synthesis to recombinant plasmid pGVP2, electrophoresis detection result is presented at about 1.6kb place object band (result does not show) clearly, conforms to expected results.

There are 2 bands after cutting in recombinant plasmid pGVP2 BamHI enzyme, wherein 1 is the VP2 object band inserted, and position is about 1.6kb, and other 1 is carrier ribbon, and position is about 7kb (Fig. 5), conforms to expected results.Recombinant plasmid pGVP2 HindIII enzyme there will be 2 bands after cutting, if closure correctly, there will be two fragments (as Fig. 6) that size is about 2.7kb and 5.8kb, if closure mistake, can at 1.9kb and 6.6kb place each appearance bright band, electrophoresis result shows, and the closure of VP2 gene and pG plasmid is correct.

The sequencing of VP2 gene fragment in 2.5 recombinant plasmid pGVP2

Cut qualification through PCR and enzyme and be positive recombinant plasmid pMD-VP2, serve marine life Engineering Co., Ltd and carry out sequencing.Check order row with 2.3 in check order arrange completely the same.

The green fluorescence of 2.6 recombinant virus PRV-PPVPGVP2 is observed

After plasmid pGVP2 transfection ST cell 24h, under inverted fluorescence microscope ultraviolet light, (wavelength region is: 420-490nm) can observe obvious green fluorescence (see Fig. 6), through transfection conditions optimization, observations (see Fig. 7) after pGVP2 plasmid and PRVDNA cotransfection ST cell cultures 24h.

The PCR qualification result of VP2 fragment in 2.7 recombinant virus PRV-PPVPGVP2

Carry out pcr amplification with the VP2 Auele Specific Primer of synthesis to recombinant virus PRV-PPVPGVP2, electrophoresis detection result is presented at about 1.6kb place object band (result does not show) clearly, conforms to expected results.

3 conclusions and discussion

The vertical topic foundation of 3.1PRV restructuring PPVVP2 and meaning

PRV and PPV is all the main pathogen that can cause pig generation breeding difficulty, and the phenomenon of both polyinfection clinically also has report more.These two kinds of diseases all have generation all over the world at present, and swinery is once be difficult to purification after infecting, and then persistent infection, causes very large financial loss.Although deactivation vaccine and Attenuate vaccine are widely applied in clinical at present; and certain effect is served in the prevention and corntrol of disease; but because the protection of deactivation vaccine is low, immune effect is unstable, duration of immunity is short, Attenuate vaccine then has the shortcomings such as the potential threat of virulence reversion.So research and develop the emphasis that a kind of vaccine is more safely and effectively porcine pseudorabies and porcine parvovirus immunoprophylaxis research always.There is scholar to show that PPVVP2 has the ability that oneself is folded into virus-like particle (VLPs) by experimental study, after immune animal, effectively can produce corresponding neutralizing antibody by induced animal body.PRV genome is about 150kb, containing multiple dispensable gene, can for the insertion of external source Effective Antigens gene, and do not affect multiplication capacity and the immunogenicity of virus after these genetically deficients, and then make body acquisition for the resistibility of PRV cause of disease corresponding to other, therefore study corresponding recombiant vaccine all significant for clinical production practice.

3.2PPVVP2 Structural protein analysis

The molecule of the VP2 albumen of PPV is about 64kDa; it is the capsid protein main forming PPV virus particle; and there is hemagglutination activity; this albumen accounts for 80% of whole viral capsid proteins total amount; and corresponding neutralizing antibody can be produced by induced animal body, the body that watches for animals is from virus attack.The ability of VLPs can be become by self assembly by the polypeptide chain of VP2 genes encoding, there is very strong inducing cellular immune function.

3.3 about the selection of virus vector

Virus live vector system for animals at present mainly contains vaccinia virus, baculovirus, adenovirus, retrovirus and pseudorabies virus etc., these virus vector have all played certain effect in the R&D work of live vaccine, but the virus expression carrier system of maturation is not but a lot.If adenovirus, retrovirus, SV40 etc. are because infection host scope is narrower or have damage to a certain degree or oncogenic function to humans and animals body, and be cautious in using.In current research work, only have the application of Vaccinia Virus System relatively extensive, but along with the propelling of research work, people have found some shortcomings of this virus vector gradually, and the host range as this virus infection too extensively makes it constitute potential threat to the health of the mankind to a certain extent; In addition, this virus only can identify the promotor of virus oneself, and the expression amount after foreign gene inserts is lower; In addition, this virus has the characteristic of lifetime immunity, is difficult to improve antibody horizontal further by booster immunization.By contrast, PRV genome is huge, gE is had in virogene, TK, gI, multiple dispensable gene such as gC, even if also can not be impacted copying of virus itself by the exogenous virus gene inserting about 40kb after some nonessential genetically deficients by genetic engineering technique, foreign gene can obtain the expression of higher amount level simultaneously.Pseudo-rabies low virulent strain used in the present invention is ripe PRV Attenuate vaccine, and in the market should be very extensive, this strain has lacked multiple major virulence gene simultaneously, has good security to animal, is the desirable live vector of external source Effective Antigens genetic expression.

3.4 about the structure of transferring plasmid pGVP2

If want successfully to obtain recombinant virus, the structure of a good transferring plasmid is absolutely necessary, the upstream and downstream viral oncogene homolog arm that excellent pseudo-rabies transferring plasmid must possess sufficient length is beneficial to virus restructuring, great expression, the significantly marker gene that stronger promotor need be had to be beneficial to foreign gene are beneficial to the screening of recombinant virus, and effective Poly (A) tail is also absolutely necessary simultaneously.Pseudo-rabies universal transfer plasmids pG used in the present invention contains PRV autogene gG late promoter, also have CMV promoter in addition, SV40Poly (A) and upstream and downstream viral oncogene homolog arm lengths are respectively 0.8kb and l.7kb, can satisfy the demand completely during virus homologous recombination, green fluorescence protein gene (GFP) in plasmid can effectively help to judge whether virus recombinates successfully, and be conducive to recombinant virus be further purified work.In addition, the promotor downstream of this Universal Transfer Vectors has multiple restriction enzyme site available, is beneficial to the insertion of single or multiple foreign antigen genes, and this is that the research of divalence or polyvalent recombinant PRV recombinant vaccine provides conveniently.

The committed step analysis of 3.5 virus restructuring

The present invention for template with pig parvoviral (PPV) 7909 type strain DNA, has amplified by PCR method the VP2 protein gene fragment that length is 1635bp, and in upstream and downstream primer, has all introduced BamH I restriction enzyme site.Be connected to pMD18-T carrier after being reclaimed by PCR primer purifying, successfully construct recombinant plasmid pMD-VP2.This recombinant plasmid is proceeded to competent escherichia coli cell, VP2 gene is bred in a large number, then extract after recombinant plasmid pMD-VP2 BamH I enzyme cuts, reclaim VP2 fragment and be connected with pG plasmid.The present invention have selected the recombinant plasmid pMD-VP2 built containing VP2, and be not directly connected with pG plasmid by the PCR primer reclaimed, because construct recombinant plasmid pMD-VP2, not only can obtain the single VP2 gene fragment of a large amount of purifying at any time, and the sequencing of the enzyme being more conducive to BamH I effect of cutting and PPVVP2 gene fragment.In test, we have selected as required to be inserted in pseudo-rabies universal support pG by PPVVP2 gene with single endonuclease digestion site BamH I and obtain recombinant plasmid pGVP2, so then may there are forward and Opposite direction connection two kinds of situations of VP2 gene fragment and pG plasmid, therefore need to identify the connection of VP2 gene fragment further.

Should careful operation during the DNA extraction of the extraction of the DNA of transfer recombinant plasmid pGVP2 and parent plant PRV virus, because require relatively high for plasmid DNA in transfection assay, therefore in the present invention, we adopt BIOMIGA to go intracellular toxin plasmid extraction kit to extract transferring plasmid DNA, eliminate Host Strains toxin for eukaryotic toxic action used during transfection as far as possible.Low temperature careful operation is answered, in order to avoid the DNA structure of break virus or viral DNA are degraded when extracting PRV parent plant DNA.Need before transfection in addition to measure DNA purity and concentration with uv analyzer, only have its purity and content all to reach transfection requirement and just can carry out transfection procedure.

Foreign gene is imported eukaryotic cell main method and have the methods such as liposome transfection, microinjection and calcium phosphate precipitation, wherein due to the similarity of liposome and biological cell membrane and histocompatibility higher, therefore lipofection has the advantages such as toxicity is little, simple, efficient, pollution-free, thus test in we adopt be lipofection.The length of cell state good during cotransfection, suitable concentration of liposomes and transfection time all will directly have influence on the height of transfection efficiency.Foreign gene is imported Pig testicular cell (ST cell) by the liposome cotransfection method after we adopt optimization in the present invention, thus obtains the live virus after PRV and PPVVP2 gene recombination.

Two, the purifying of recombinant virus PRV-PPVPGVP2 and some biological characteristics analysis

1 materials and methods

1.1 test materials

1.1.1 cell and strain

VERO cell (African green monkey kidney cell line), ST cell (Pig testicular cell system), PK-15 cell (porcine kidney cell line), IPEC cell (chitterlings epithelial cell line) are preserved by animal food safety key lab of Henan Province.

1.1.2 main agents

DNAMarkerDL2000, ProteinMarker, 2 × TaqMasterMix, BamHI, Hind III restriction enzyme, PrimeScript1stStrandcDNASynthesisKit (50 secondary amounts) etc. are purchased from precious biotechnology (Dalian) company limited; DMEM cell culture fluid, 1640 cell culture fluids, foetal calf serum purchased from American Hyclone company; OPTI-MEM serum-free cell culture medium, Lipofectamine ^tM2000Reagent is Invitrogen Products; VP2antibody (HostRabbit) purchased from American biorbyt company, horseradish peroxidase-labeled goat-anti rabbit two is anti-purchased from Beijing Bo Aosen Bioisystech Co., Ltd; 5 × SDS-PAGEProteinLoadingBuffer is purchased from doctor's moral biotechnology company limited.The plaque select of 1.2 recombinant virus PRV-PPVPGVP2

After ST cell grows up to individual layer, get the recombinant virus cell culture fluid after multigelation 3 times, the centrifugal 5min of 3000rpm, draws 100 μ L viral supernatant liquid, makes 10 times of gradient dilutions, will get 400 μ L10 respectively with serum-free DMEM cell culture fluid ^-1, l0 ^-2, 10 ^-3, 10 ^-4, 10 ^-5with 10 ^-6dilution virus liquid is inoculated in six porocyte culture plates, is placed in 37 DEG C, 5%CO ₂incubator internal adsorption 2h, discards each hole inner cell nutrient solution in six porocyte culture plates, washs 3 times with D-Hanks liquid, and every hole adds low melting point nutrient agar medium agarose 2mL, puts into and put 37 DEG C, 5%CO after agarose solidifies ₂2d is cultivated in incubator, the result of observing under combined with fluorescent microscope visible ray and blue light (wavelength 420-490nm) two kinds of conditions, green and the two-strain plaque without special fluorescence color can be found that there is, under fluorescent microscope, the fluorescence virus plaques in maximum dilution multiple hole is marked, the culture plate marked is put into Bechtop, green plaque is drawn with pasteur pipet, add a small amount of DMEM maintenance medium and smash agar block to pieces in aseptic operating platform ,-20 DEG C with normal temperature multigelation 3 times after receive poison.

The virus liquid got after multigelation 3 times is inoculated in the 6 porocyte culture plates containing individual layer ST cell, is placed in 37 DEG C, 5%CO ₂when being cultured to the cell generation pathology of more than 90% in cell culture incubator, collect nutrient solution under-20 DEG C with normal temperature condition and multigelation 3 times.Get the virus liquid after freeze thawing 400 μ L and add isopyknic SDS lysis buffer, after mixing, add 6 μ L Proteinase Ks (final concentration is 200 μ g/mL), after 55 DEG C of digestion 1h-3h, conventionally extract viral DNA.The DNA of extraction is carried out the pcr amplification of PPVVP2.Get 7 μ LPCR product 1% agarose gel electrophoresis and identify positive plaque, select PCR positive-virus liquid to proceed the plaque purification of recombinant virus.Pcr amplification in conjunction with PPVVP2 gene screens, until it is 100% that the VP2 goal gene positive rate that plaque purification the 5th takes turns all plaque pcr amplifications reaches, purifying is complete to show recombinant virus PRV-PPVPGVP2, by purifying poison enlarged culturing on ST monolayer cell, observation of cell in the middle of 24-72h, when more than 80% cells showed cytopathic, receive poison ,-80 DEG C of cryogenic refrigerators save backup.

The malicious valency of 1.3 recombinant viruses in various kinds of cell measures

TCID is carried out respectively with the recombinant virus of VERO cell, ST cell, PK-15 cell and IPEC cell proliferation ₅₀measure, above-mentioned cell is inoculated into respectively in 96 hole Microtitration plates, tests when each cell grows to 90% individual layer.Concrete operation method is as follows: recombinant virus serum-free DMEM cell culture fluid is made 10 times of gradient dilutions, namely from 10 in aseptic Eppendorf pipe ^-1-10 ^-10carry out viral dilution.Be inoculated in 96 hole Microtitration plates by each dilution gradient virus liquid, each extent of dilution is done 8 holes and is repeated, and 100 μ L are inoculated in every hole, and after viruses adsorption 2h, every hole adds 100 μ LDMEM nutrient solutions again.Simultaneously using the last two tandem holes of every plate as normal cell controls, put 37 DEG C, 5%CO ₂cultivate in incubator, observe by sky and record result, data carry out TCID according to Reed-Muench Liang Shi method ₅₀to tire evaluation.

The cultural characters of 1.4 recombinant viruses in various kinds of cell

Treat that ST cell, PK-15 cell, VERO cell and IPEC cell are at 25cm respectively ²long for after monolayer cell in Tissue Culture Flask, by 10 ⁶ _. ⁵tCID ₅₀/ 0.1mL connects poison amount and inoculates four kinds of cells respectively, after absorption 2h, is changed to the cell culture maintenance medium of 2% foetal calf serum, puts 37 DEG C, 5%CO ₂cultivate in incubator, and respectively at the fluorescence situation connect after rear 0h, 6h, 12h, 24h, 36h, 48h, 60h inverted fluorescence microscope observation of cell form of poison and virus infected cell.

1.5 recombinant viruses and the parent plant malicious valency on ST cell measures

Get 10 respectively ^5.5tCID ₅₀recombinant virus PGVP2 and the weak poison of parent plant pseudo-rabies, in inoculation 25cm Tissue Culture Flask, the long ST cell thin for individual layer, puts 37 DEG C, 5%CO ₂cultivate in incubator, when more than 80% cells showed cytopathic, receive poison, after multigelation 3 times, the centrifugal 5min of 3000rpm, gets supernatant-70 DEG C and saves backup.Then according to check weighing papova and the viral titer of parent plant on ST cell respectively of method described in 1.3 steps.

The one step growth of 1.6 recombinant viruses measures

Conveniently virusology side measures the growth curve that recombinant virus PRV-PPVPGVP2 cultivates on ST cell, gets recombinant virus nutrient solution 10 μ L (10 ^6.5tCID ₅₀/ 0.1mL) be inoculated in ST cell and grown up in the little culture dish of individual layer (parallel make 8 plates), establish the ST cell not connecing poison as negative control simultaneously; 4h, 6h, 8h, 10h, 12h, 24h, 36h and 48h collecting cell culture supernatant and cell precipitation respectively after inoculation recombinant virus.Get cell precipitation and to add with supernatant isopyknic DMEM cell culture fluid multigelation 3 times, the centrifugal 5min of 3000rpm, gets supernatant-70 DEG C and saves backup; After archeocyte nutrient solution supernatant being done equal freeze thawing treatment ,-80 DEG C save backup simultaneously, its TCID of Simultaneously test ₅₀, analyze the multiplication characteristic on the ST cell of recombinant virus.

The genetic stability evaluation of 1.7 recombinant viruses

The recombinant virus PGVP2 obtained after purifying being reached in ST cell the 20th generation observes its green fluorescence situation, receives poison when 80% pathology appears in cell simultaneously ,-20 DEG C with normal temperature multigelation 3 times after, by 10 ^-1, 10 ², 10 ^-3, 10 ^-4, 10 ^-5, 10 ^-6gradient dilution after inoculate individual layer ST cell in six orifice plates and with low melting point nutrient agar medium bed board, after virus plaque to appear, random picking 10 plaques carry out the pcr amplification qualification of VP2 gene, and gene clone is carried out to PCR primer, examining order is completed by Hua Da Gene Tech. Company Limited.

VP2 gene transcribing and detection of expression on ST cell in 1.8 recombinant viruses

1.8.1 recombinant virus PGVP2 strain VP2 gene detects in transit cell record

Recombinant virus liquid after purifying is inoculated in individual layer ST cell, poison is received when pathology appears in more than 80% cell,-20 DEG C with normal temperature multigelation 3 times after, extract by RNA the extraction that test kit specification sheets carries out cell total rna, whether the pcr amplification order-checking carrying out PPVVP2 object fragment after reverse transcription transcribes in ST cell to detect PPVVP2 gene.Primer and method are with 1.2.1 and 1.2.3.1 in test one.

1.8.2 the SDS-PAGE electrophoresis of recombinant virus and Westernblot detect

Recombinant virus PGVP2 is inoculated individual layer ST cell, collecting cell liquid after pathology, carry out SDS-PAGE electrophoresis, arrange simultaneously independent ST cell cultures contrast and PRV parent plant connect poison contrast, carry out SDS-PAGE electrophoresis, electricity is transferred to nitrocellulose filter, and the BSA confining liquid with 5% is closed and spent the night, the primary antibodie VP2antibody (HostRabbit) diluted with TBST, under room temperature, on shaking table, slowly shake is hatched one hour or slowly shakes overnight incubation at 4 DEG C.Add Western washings, shaking table slowly shakes washing 5 times, each 5-10min.Exhaust washings, add immediately with TBST diluted two anti-, lie against incubated at room 1h on shaking table.Add Western washings, shaking table slowly shakes washing 5 times, each 10min.Can proper extension washing time increase washing times if result background is higher.Nitrocellulose filter is put into substrate solution, colour developing 1-15min, once there is protein band, stop with deionized water immediately, observe albumen.

The security Preliminary detection of 1.9 recombinant viruses

Get 20 PRV, PPV Serologic detection to be negative female Sexual health kunming mice in 6 week age and to use recombinant virus 0.5mL (about toxic amount 10 respectively ^6.5tCID ₅₀) dorsal sc injection, isolated artificial feeding, the day by day spirit of viewing test mouse and appetite.

2 results and analysis

The plaque select of 2.1 recombinant viruses

Virus liquid PCR and fluoroscopic examination are all positive is by 10 ^-1, 10 ^-2, 10 ^-3, 10 ^-4, 10 ^-5, 10 ^-6gradient dilution after inoculate individual layer ST cell in six orifice plates, and with carrying out the plaque screening of recombinant virus after low melting point nutrient agar medium bed board, 5 viral purifications are carried out altogether according to this step, 1st the selection result shows in six orifice plates of each extent of dilution virus liquid inoculation all to observed and has green fluorescence and non-blooming plaque, and along with the dilution increase of virus liquid, green plaque quantity is fewer, each viral purification is all chosen the green fluorescent plaques can observed in the most high dilution inoculation hole of green fluorescence and is carried out lower whorl purifying, aforesaid operations is repeated by after the virus liquid multigelation collected 3 times, until obtain restructuring positive monoclonal after the 5th purifying (as Fig. 8, wherein A is the photo gathered under ordinary light, the fluorescence photo that B collects when being blue light observation).

The malicious valency measurement result of 2.2 recombinant viruses in various kinds of cell

With VERO cell, ST cell, PK-15 cell and IPEC cell, TCID is carried out to recombinant virus respectively ₅₀measure, viral titer is respectively 10 ^4.375/ 0.1mL, 10 ^6.5/ 0.1mL, 10 ^3.75/ 0.1mL, 10 ^5.625/ 0.1mL, test-results shows the viral titer of recombinant virus on ST cell and the viral titer (10 of PRV parent plant ^6.125/ 0.1mL) similar, and VERO cell and PK-15 cell proliferation titre lower, therefore ST cell is more suitable for the mass propgation of recombinant virus.

The cultural characters of 2.3 recombinant virus PGVP2 strains in various kinds of cell is observed

2.3.1 the cultural characters of recombinant virus PGVP2 strain on ST cell is observed

Recombinant virus is inoculated on individual layer ST cell, different time sections observation of cell pathology and fluorescence situation.After observing discovery 6h, cell is without obvious pathology, redgreen fluorescence under inverted fluorescence microscope; After 12h some cell start become circle, can green fluorescence be observed under inverted fluorescence microscope, but and unintelligible; After 24h, cell rounding is obvious, under inverted fluorescence microscope, can be observed a large amount of green fluorescence; Can be observed cell detachment after 36h, under inverted fluorescence microscope, now can be observed the green fluorescence of floating shape, and fluorescence is comparatively obvious; After 48h, cell comes off in a large number, only can observe a small amount of green fluorescence, sees Fig. 9-13 (wherein A is the photo gathered under ordinary light, and B is the photo gathered under fluorescent microscope).2.3.2 the cultural characters of recombinant virus PGVP2 strain on PK-15 cell is observed

Recombinant virus PGVP2 strain is inoculated on individual layer PK-15 cell, different time sections observation of cell pathology and fluorescence situation.After observing discovery recombinant virus inoculation individual layer PK-15 cell 6h, cell is without obvious pathology, and does not observe green fluorescence under inverted fluorescence microscope; After 12h, a small amount of cell starts to become circle, brighten and can observe green fluorescence faint on a small quantity; Also there is PRV characteristic cavity pathology in about 50% cell rounding after 24h, can observe a large amount of green fluorescence under inverted fluorescence microscope; Can be observed obvious cytopathy after 36h, about 70% cell rounding comes off, the green fluorescence simultaneously observed is more brighter; After 48h, about 80% cell rounding comes off, and still can observe a large amount of green fluorescence; After 60h, about cell comes off become circle completely, and occurs cytogamy, now only can observe green fluorescence faint on a small quantity, see Figure 14-19 (wherein A is the photo gathered under ordinary light, and B is the photo gathered under fluorescent microscope).

2.3.3 the cultural characters of recombinant virus PGVP2 strain on VERO cell is observed

There is not obvious cytopathy in recombinant virus PGVP2 strain inoculation individual layer VERO cell 6h, can not observe green fluorescence under inverted fluorescence microscope; 12h starts to occur cell rounding, merges, can be observed more weak green fluorescence under inverted fluorescence microscope; 24h most cells becomes circle, draws in the net obviously, visible significantly green fluorescence under inverted fluorescence microscope; 36h cells show is a large amount of cell detachment, becomes circle, now can be observed a large amount of green fluorescences under inverted fluorescence microscope; 48h cell all comes off, and forms island shape fusion, still can be observed lumps green fluorescence, see Figure 20 to 24 (wherein A is the photo gathered under ordinary light, and B is the photo gathered under fluorescent microscope) under inverted fluorescence microscope.

2.3.4 the cultural characters of recombinant virus PGVP2 strain on IPEC cell is observed

Recombinant virus PGVP2 strain inoculation individual layer IPEC cell 6h cell without obvious pathology, and does not observe green fluorescence under inverted fluorescence microscope; 12h respective cells becomes circle, brightens, and can observe a small amount of green fluorescence; 24h starts to occur that cell draws in the net, and PRV characteristic cavity pathology, can observe a large amount of green fluorescences under fluorescent microscope; Occur after 36h that big area born of the same parents come off, and occur that cell elongation, change circle etc. are irregularly shaped, under inverted fluorescence microscope, still can be observed a large amount of green fluorescence; After 48h, cell comes off completely, can be observed a small amount of green fluorescence under fluorescent microscope.See Figure 25-29 (wherein A is the photo gathered under ordinary light, and B is the photo gathered under fluorescent microscope).

2.4 recombinant viruses and the parent plant malicious valency measurement result on ST cell

Get 10 respectively ^5.5tCID ₅₀recombinant virus PGVP2 and parent plant PRV, in inoculation 25cm Tissue Culture Flask, the long ST cell for individual layer, puts 37 DEG C, 5%CO ₂cultivate in incubator, when more than 80% cells showed cytopathic, receive poison, after multigelation 3 times, the centrifugal 5min of 3000rpm, collects viral supernatant liquid and surveys its TCID respectively ₅₀, result parent plant PRV poison valency is 10 ⁶ _. ¹²⁵tCID ₅₀/ 0.1mL, recombinant virus PRV-PPVPGVP2 poison valency is 10 ⁶ _. ⁵tCID ₅₀/ 0.1mL, the result display viral titer of recombinant virus on ST cell is similar to the viral titer of parent plant PRV, and the insertion of foreign gene is to the increment titre of virus and have no significant effect.

The one step growth of 2.5 recombinant viruses measures

The recombinant virus growth curve of PGVP2 strain on ST cell (the results are shown in Figure 30) is measured with single stage method.The viral gradient infected before after ST cell in 10h cell and in supernatant by growth curve known recombinant virus PGVP2 strain all increases along with the increase of time, but virus is still mainly present in cell generally.Metainfective 10h-12h virus is tending towards equal in upper cleer and peaceful intracellular titre; The recombinant virus particle that recombinant virus PRV-PPVPGVP2 strain infection ST cell 12h breeds later is discharged in supernatant in a large number, and the virus titer of 36h in cell and in supernatant is all tending towards constant after infecting, and concrete each time point virus titer is in table 1.

The growth curve analysis of table 1 recombinant virus PGVP2

The genetic stability analysis of 2.6 recombinant viruses

The recombinant virus PGVP2 obtained after purifying being reached in ST cell the 20th generation still can observe green fluorescence (see Figure 31) clearly, the pcr amplification qualification of VP2 gene is carried out after random picking 10 plaques extract viral DNA, 10 plaques have all expanded VP2 goal gene fragment (see Figure 32) as a result, confirm that the recombinant virus after going down to posterity is still containing VP2 gene.Sequencing result consistent with VP2 gene order in universal plasmid (as shown in SEQIDNo:2), the above results shows the recombinant virus inheritance stability carrying VP2 gene.

Sequencing result is as follows, consistent with the gene order of VP2 in transferring plasmid pGVP2:

2.7RT-PCR detects VP2 gene transcribing in cell in recombinant virus

Extract total serum IgE in the sick cell of recombinant virus PGVP2 inoculation, RT-PCR amplification is carried out with specificity PPVVP2 gene primer, detected by agarose gel electrophoresis, obtain 1 treaty 1.6kb specific band (as Figure 33), consistent with expection target DNA expanding fragment length.2.8Westernblot detects PPVVP2 protein expression

Get recombinant virus PGVP2 and inoculate individual layer ST cell, collecting cell liquid after 80% cytopathy, after multigelation 3 times, preparation SDS-PAGE sample, arrange simultaneously independent ST cell cultures contrast and parent plant PRV connect poison contrast, Westernblot detection is carried out after SDS-PAGE electrophoresis, result shows, PGVP2 is being about 64kDa place appearance specific band (Figure 34), conform to the molecular weight of expection VP2 albumen, negative control is set up simultaneously, and test proves that recombinant virus PGVP2 can correction PPVVP2 gene.

The security detected result of 2.9 recombinant virus PGVP2 strains

Get 20 PRV, PPV Serologic detection to be negative health in 6 weeks age Kunming small white mouse and to use recombinant virus 0.5mL (about toxic amount 10 respectively ⁶ _. ⁵tCID ₅₀) dorsal sc injection, isolated artificial feeding, the day by day spirit of viewing test mouse and appetite.There is not obvious stress reaction in result, normally, test-results tentatively shows that this recombinant virus PRV-PPVPGVP2 strain is safe to healthy Kunming small white mouse for spirit and appetite.

3 conclusions and discussion

3.1 Plaque-purified about recombinant virus PRV-PPVPGVP2

In order to the VP2 gene fragment of PPV is inserted in PRV genome smoothly, in the present invention, we adopt liposome method to be imported in ST cell in the mode of cotransfection by the DNA of PRV genome and universal transfer plasmids pGVP2, and utilize the upstream and downstream homology arm in universal plasmid to exchange VP2 gene recombination in PRV genome through DNA homolog.Owing to carrying GFP marker gene in homology segment, therefore under fluorescent microscope, picking purifying can be carried out to the single virus plaque with green fluorescence, often during wheel viral purification, we distinguish inoculating cell after first the virus liquid of acquisition being carried out doubling dilution, then picking green fluorescent plaques from extent of dilution the highest culture hole, by after 5 plaque purifications, we obtain monoclonal recombinant virus.Detect the virus plaque DNA after purifying with PCR, result is the positive in PRV and VP2 all, and our virus that obtains of preliminary proof is recombinant virus.The cultivation multiplication characteristic of 3.2 recombinant virus PGVP2 is observed

By recombinant virus PGVP2 strain being cultivated in various kinds of cell, find that this recombinant virus can carry out breeding and produce the distinctive cytopathy of PRV on PK-15, ST, IPEC and VERO cell, its cell adapted scope is identical with parent plant.Recombinant virus all can form obvious virus plaques on PK-15, ST, IPEC and VERO cell, and above-mentioned several cell connect poison after about 12h all can observe faint green fluorescence under fluorescent microscope, by contrast, fluorescence now in ST cell is brighter compared with other cell, but during 12h, obvious cytopathy does not all appear in all cells; Connect the green fluorescent protein showed increased in the various cell of about 24h after poison, and start to occur a small amount of cell rounding, vacuolation, VERO cell now also shows and significantly draws in the net phenomenon; The quantity connecing the green fluorescent protein that malicious about 36h can observe is maximum, and above-mentioned several test cell all occurs that large quantitative change is justified and comes off.When meeting poison about 48h, various test cell almost comes off completely, and presents cytogamy, and now various intracellular green fluorescence obviously reduces.

With VERO cell, ST cell, PK-15 cell and IPEC cell, TCID is carried out to the recombinant virus after propagation respectively ₅₀measure, its virus titer is respectively 10 ^4.375/ 0.1mL, 10 ^6.5/ 0.1mL, 10 ^3.75/ 0.1mL, 10 ^5.625/ 0.1mL, result shows the viral titer of recombinant virus on ST cell and the viral titer (10 of parent plant PRV ^6.125/ 0.1mL) close, and VERO cell and PK-15 cell proliferation progeny virus titre relatively low, therefore therefore ST cell is more suitable for a large amount of propagation of recombinant virus PRV-PPVPGVP2.

3.3 about the exploration of recombinant virus rule of proliferation in optimal cell

Determine the growth curve of recombinant virus PRV-PPVPGVP2 strain on its optimal cell ST cell by single stage method, in test, connect the virus titer in the mensuration of the different time points after poison cell and in supernatant respectively at ST cell.Test-results shows, and the viral gradient in the front 10h cell after recombinant virus infects ST cell and in supernatant all increases along with the increase of time, but virus is still mainly present in cell generally.Metainfective 10h-12h virus is tending towards equal in upper cleer and peaceful intracellular titre; The recombinant virus particle that recombinant virus PRV-PPVPGVP2 strain infection ST cell 12h breeds later is discharged in supernatant in a large number, and the virus titer of 36h in cell and in supernatant is all tending towards constant after infecting, the rule of proliferation of this recombinant virus in optimal cell ST cell can be understood further by the present invention, for this recombinant virus ST cell cultures and receive poison the time determination provide the firsthand information.

3.4 about the mensuration of recombinant virus VP2 protein expression when cellular proliferative

Whether the present invention measures the expression of VP2 gene from transcribing with translation skill respectively.Total serum IgE in the sick cell of recombinant virus PRV-PPVPGVP2 inoculation is extracted in test, but the recombinant virus due to us is DNA virus, in order to avoid DNA remains the false positive caused, after we carry out DNA digestion with DNaseI, RT-PCR amplification is carried out again with specificity PPVVP2 gene primer, detected by agarose gel electrophoresis, obtain 1 be about 1.6kb specific band, consistent with expection target DNA expanding fragment length, this to show in recombinant virus that VP2 gene obtains and effectively transcribes.

Translation skill measures, get recombinant virus PRV-PPVPGVP2 in test and inoculate individual layer ST cell, collecting cell liquid after 80% cytopathy, after multigelation 3 times, carry out Westernblot technology for detection, result shows, PRV-PPVPGVP2 is being about 64kDa place appearance specific band, conform to the molecular weight of expection VP2 albumen, negative control is set up simultaneously, and test proves that recombinant virus PRV-PPVPGVP2 can go out VP2 albumen by correction.

Three, the immunogenicity research of the recombinant porcine pseudorabies poison of PPVVP2 albumen is expressed

1 materials and methods

1.1 material

1.1.1 experimental animal

100 6 week age female KM mouse, purchased from experimental animal center, Henan Province.

1.1.2 vaccine and seed culture of viruses

PRV (Pseudorabies virus) attenuated vaccine (HB98 strain) and porcine parvovirus inactivated vaccines (WH-1 strain) are all purchased from Wuhan Ke Qian biological products company limited; PPV is purchased from China Veterinary Drugs Supervisory Inst., and PRVNY virulent strain and pseudo-rabies live vector recombinant virus PRV-PPVPGVP2 strain are preserved by animal food safety key lab of Henan Province.

1.1.3 main agents and instrument

DMEM cell culture fluid purchased from Hyclone company, folium ilicis chinensis foetal calf serum purchased from Sai Si bio tech ltd, Zhengzhou; The goat anti-mouse igg antibody that pig parvoviral ELISA antibody assay kit marks purchased from Wuhan Ke Qian biological products company, horseradish peroxidase (HRP) is purchased from Beijing Bo Aosen biotech development company; 206 hemolysins are purchased from BD company; AntiCD3 McAb, CD4, CD8 monoclonal antibody of SPRD, FITC, PE mark are purchased from SouthernBiotech company; FACSAria type flow cytometer is purchased from BD company; Tetramethyl benzidine (TMB) nitrite ion, purchased from Jin Sirui bio tech ltd.

1.2 experimental animal immunity groupings and serum preparation

By 80 6 week age female mice be divided into 4 groups at random, often organize 20, wherein A group is PRVHB98 vaccine immunity group, B group is PPV inactivated vaccine immune group, C group is PRV-PPVPGVP2 recombinant virus immune group, D group is DMEM nutrient solution immunized controls group, and immunization route is the injection of dorsal sc branch, and 500 μ L/ only.One exempt from before from 80 mouse, randomly draw 20 tail vein bloods, 80 mouse are carried out head by above-mentioned grouping to exempt from simultaneously, head exempts from (namely head exempts from rear 14d) after two weeks and carries out second time immunity, one exempt from after tail vein blood weekly, within the 7th week that takes a blood sample after exempting to one, stop blood sampling, separation of serum is for subsequent use, and concrete immunization protocol is in table 2.

Table 2 tests mouse grouping and Immunity

1.3 hemagglutination-inhibition tests (HI) detect PPV antibody

1.3.11% the preparation of guinea-pig red blood cell suspension

Conventionally asepticly take guinea pig heart blood (every milliliter of blood adds the sodium citrate solution 0.2mL of 3.8%), blood is injected centrifuge tube, the PBS liquid that pH value is 7.4 is added according to the ratio of 1:9, through the centrifugal 5min of 2000rpm, the white corpuscle film on supernatant liquor and red corpuscle upper strata is sucked with suction pipe, the red corpuscle of precipitation is washed with PBS liquid, repetitive scrubbing like this twice, supernatant liquor is abandoned after 3rd centrifugal 10min, add the red cell suspension that PBS is mixed with 1.0%, 4 DEG C save backup.

1.3.2PPV hemagglutination test (HA)

After obvious cytopathy appears in the PK-15 cell of malicious PPV waiting, multigelation 3 times, the centrifugal 5min of 3000rpm, gets supernatant and carry out hemagglutination test in 96 hole V-type plate.On 96 hole V-type micro-reaction plates, adding pH value is that the PBS liquid 50 μ L of 7.4 is in the 1st hole of Sptting plate to the 12nd hole, add the PPV virus liquid of 50 μ L results again in the 1st hole, by 1:2,1:4,1:8 ... the 11st hole is diluted to etc. multiple proportions, discard 50 μ L, 12nd hole is negative control hole, and every hole adds the guinea-pig red blood cell suspension 50 μ L of 1.0%.Micro-oscillator shakes up 15-30s, place 37 DEG C of incubators and leave standstill 40min-1h, with 50% red cell agglutination for terminal, sample occurs that the most high dilution of aggegation terminal is tired for this virus liquid HA, 4 unit antigens then needed for the PPV hemagglutinative titer preparation of measuring.

1.3.3 the process of serum to be checked

Get 100 μ L serum to be checked, after 56 DEG C of water-bath deactivation 30min, add 300 μ L25% white bole suspensions, the centrifugal 5min of room temperature effect 30min, 10000rpm after mixing, draws supernatant, add 100 μ L25% guinea-pig red blood cell mud, the rear 37 DEG C of centrifugal 5min of effect 1h, 6000rpm of vibration mixing, collection supernatant is the serum sample after 1:4 dilution.

1.3.4 hemagglutination-inhibition test (HI)

From the second hole of 96 hole hemagglutination plates, every hole adds 50 μ LPBS, red corpuscle control wells adds 100 μ L, treated serum to be checked 50 μ L is added subsequently in the 1st hole, also 50 μ L serum to be checked is added equally in the second hole, take out 50 μ L after mixing to be added in the 3rd hole, the rest may be inferred, until the 10th hole, discard 50 μ L, now the extent of dilution of serum to be checked be respectively 1:4,1:8,1:16 ..., 1:2048.Except red corpuscle control wells, every hole adds the pig parvoviral liquid 50 μ L of 4 × HAU again, now the 11st hole is virus control wells, vibrate rear 37 DEG C of effect 1h, then every hole adds 1% guinea-pig red blood cell suspension 50 μ L, the vibration rearmounted room temperature of mixing (25 DEG C) effect 30-40min, observations.Result judges, so that the most highly diluted multiple of the serum of red cell agglutination can be suppressed completely as the HI antibody titer of tested serum.According to the method described above hemagglutination-inhibition test is carried out to each test group mice serum gathered weekly, and record result.

1.4 indirect ELISAs detect PPV antibody horizontal

1.4.1 the preparation of serum

One exempt from before from 80 mouse, randomly draw 20 tail vein bloods, 80 mouse are carried out head by above-mentioned grouping to exempt from simultaneously, head exempts from (namely head exempts from rear 14d) after two weeks and carries out second time immunity, one exempt from after weekly often group randomly draw the blood sampling of 5 mouse tail veins, separation of serum, detects the PPV antibody horizontal of mouse with PPVELISA antibody assay kit before the section of Wuhan.

1.4.2PPV antibody test

According to the PPVELISA antibody assay kit specification sheets produced before the section of Wuhan, PPV antibody horizontal in the mice serum gathered weekly is detected, but needing to resist two of the sheep anti mouse horseradish peroxidase-labeled of ELIAS secondary antibody suitable concn supporting in test kit substitutes.

1.5 serum neutralization tests detect PRV antibody horizontal

Neutralization test (end-point method) fixed virus-diluted blood heat-clearing method (β method)

(1) virus treated: get the PRVNY intensity strain cell culture after multigelation 3 times, the centrifugal 10min of 3000rpm, gets viral supernatant liquid, preserve after packing, a virus liquid then got wherein surveys TCID ₅₀.Take out from cryogenic refrigerator the virus liquid preserved when doing neutralization test, after thawing, be diluted to 200 TCID according to the virus titer measured in advance ₅₀/ 0.1mL, after serum to be checked with equivalent like this mixes, then containing 100 TCID in a dosage of inoculation ₅₀.

(2) inactivating blood serum and doubling dilution: mice serum to be checked is put 56 DEG C of water-bath 30min, to destroy the thermo-labile non-specific Summing Factor complement that kills the virus in serum to be checked, 2 times of serial dilutions are carried out with 1640 cell culture fluids subsequently in 96 orifice plates, obtain 1:2,1:4,1:8 ... the serum dilution of 1:1024,4 repetitions established by each serum to be checked, 50 μ L/ holes.

(3) sense is done: get quantitate virus liquid extent of dilution serum different from equal-volume, put in 96 hole Microtitration plates, and fully 1-2h is made in mixing 37 DEG C of senses.(4) experimental control is arranged

1. virus control: generally now virus liquid is mixed with each inoculum size containing 0.2,2,20 and 200TCID ₅₀concentration, then add equivalent low power dilution normal control serum (being equivalent to the minimum extent of dilution of the tested serum of neutralization test), fully mix, now virus concentration reduces to 0.1,1,10 and 100TCID respectively ₅₀, measure with tissue culture cells immediately, 0.1TCID ₅₀any pathology of tissue culture cells should not be caused, and 100TCID ₅₀histocyte generation cytopathy must be made.

2. serum toxicity control: the serum to be checked (being equivalent to the minimum extent of dilution of tested serum in neutralization test) adding low power dilution in tissue culture cells.Tested serum reply culturing cell itself is without any toxic action.

3. host's contrast: i.e. so-called " blank " culture of not virus inoculation and serum to be checked.This blank culture should keep good form and feature in whole neutralization test always.For avoiding culture plate itself to cause testing error, should all set up this contrast on every block plate.

4. positive and negative serum control: carry out parallel test with serum to be checked, positive serum should present the Neutralizing titer of expection, and negative serum does not have Neutralizing titer.

(5) inoculate: after treating that sense is done, the virus of virus-serum mixture or control group or serum etc. are inoculated into rapidly in the individual layer ST cell in 96 porocyte culture plates, operation should be rapid, so as not to the sense of each group to make time phase difference too many.

(6) result judges and calculates: about cultured continuously 5d, records cytopathy situation every day, when viral Orthogonal Rotational Regressive Tests; negative, positive, normal cell controls phase; when serum toxicity control is all set up, just can judge, calculate the half protective number (PD of neutralization test with Karber ₅₀).The mensuration of 1.6 peripheral T lymphocyte subsets of mice

Two exempt from after the 5th week (i.e. head exempt from after the 7th week) often group randomly draw 5 mouse, gather anticoagulation, carry out mark, with flow cytometer the peripheral blood T lymphocyte subgroup now often organizing mouse changed and detect.Anticoagulation 300 μ about the L/mouse that during operation, label taking has been remembered, adds each 1 μ L of monoclonal antibody of fluorescently-labeled AntiCD3 McAb, CD4, CD8, light and slow shake up after, incubated at room 30min; Often add 2mL hemolysin again in pipe measuring samples after hatching end, light and slowly to shake up, room temperature effect 20min; The centrifugal 5min of 200grpm; Add 2mL2%FBS-PBS again, the centrifugal 5min of 200grpm, finally add 400 μ LPBS damping fluids, use flow cytomery CD3 ⁺, CD4 ⁺, CD8 ⁺t cell quantity.1.7 protest test

Two exempt from after the 5th week (i.e. head exempt from afterwards the 7th week) often group randomly draw 5 mouse, with PRVNY strain minimum lethal dose (MLD) (about 10 ² _. ⁹⁵tCID ₅₀) poison is attacked to every mouse back subcutaneous injection, raise 3 weeks Continuous Observations afterwards, log, and the protection obtained after analyzing each group of mouse immune.

1.8 data processing

With SPSS19.0forWindows and MicrosoftExcel statistical software, statistical analysis is carried out to testing data.

2 results and analysis

2.1 hemagglutination-inhibition tests (HI) detect PPV Antibody Results

Carry out hemagglutination-inhibition test according to HI testing sequence to each group of mice serum gathered weekly, TPPA the results are shown in Table 3.Result shows: the equal nonreactive PPV HI antibody titer of serum weekly after the immunity of PRVHB98 immunized controls group and DMEM control group, the anti-PPV hemagglutination inhibition antibody titer of PPV commodity deactivation vaccine immune group and PRV-PPVPGVP2 recombinant virus immune group is the highest can reach 1:2 respectively ⁶and 1:2 ⁵.

The anti-PPV HI antibody titer of table 3

2.2 indirect ELISAs detect PPV Antibody Results

Detect PPV antibody with indirect ELISA method, result as shown in figure 35 (*: P<0.05, * *: P<0.01, * * *: P<0.001).Analyze and find, after head exempts from, during 7d, PPV commodity deactivation vaccine has stimulated mouse to create obvious PPV antibody, now recombinant virus PRV-PPVPGVP2 also effective stimulus body create anti-PPV antibody (P<0.05), but antibody horizontal is relatively low; Head exempt from rear 14d recombinant virus PRV-PPVPGVP2 and PPV commodity deactivation vaccine all effective stimulus mouse body create PPV antibody, and their antibody horizontal of 28d after head exempts from all reaches peak, and 35d-49d all detects constant high-level PPV antibody afterwards.And DMEM control group in test and PRVHB98 vaccine immunity group all can not stimulate mouse to produce PPV antibody.Test-results shows that recombinant virus PRV-PPVPGVP2 and PPV commodity deactivation vaccine all can produce high-level PPV antibody by effective stimulus mouse body.

2.3 serum neutralization tests detect PRV Antibody Results

What test mice serum neutralization test detected PRV antibody the results are shown in Figure 36 (*: P<0.05, * *: 0.001<P<0.01, * * *: P<0.001).Result shows, and the 7d of mice serum after head exempts from of recombinant virus PRV-PPVPGVP2 immune group and PRVHB98 immune group can't detect PRV neutralizing antibody; Head exempts from rear 14d can detect PRV neutralizing antibody in PRVHB98 immune group mice serum, but PRV neutralizing antibody do not detected yet in recombinant virus immune group mice serum; When head exempts from rear 21d, the antibody horizontal of PRV-PPVPGVP2 immune group and PRVHB98 immune group all significantly improves, and difference extremely significantly (P<0.001) compared with negative control DMEM immune group; Analyze and find, after second time immunity, the PRV neutralizing antibody level of (after namely head exempts from the 2nd week) recombinant virus PRV-PPVPGVP2 immune group and PRVHB98 immune group is basically identical, all occurred obvious rising, and antibody horizontal is significantly higher than negative control DMEM immune group (P<0.001).Test-results illustrate recombinant virus PRV-PPVPGVP2 and PRVHB98 stimulation mouse body produce PRV neutralizing antibody horizontal in all have obvious effect, the insertion of foreign antigen genes PPVVP2 gene does not have a significant effect its immunogenicity.

The mensuration of 2.4 peripheral T lymphocyte subsets of mice

Two exempt from after the 5th week (i.e. head exempt from after the 7th week) often group randomly draw 5 mouse, collection anticoagulation, carries out mark, measures with flow cytometer to the t lymphocyte subset group in anticoagulation to be checked.Test-results is shown in Figure 37, the CD3 in recombinant virus PRV-PPVPGVP2 immune group and PRVHB98 vaccine immunity group mouse peripheral blood ⁺, CD4 ⁺, CD8 ⁺t lymphocyte quantity, all higher than DMEM control group and PPV commodity deactivation vaccine immune group, illustrates that recombinant virus PRV-PPVPGVP2 strain and PRVHB98 all can stimulate mouse body to produce effective cellular immunization.2.5 protest test

Two exempt from after the 5th week (i.e. head exempt from after the 7th week) often group randomly draw 5 mouse, attack poison with PRVNY virulent strain minimum lethal dose (MLD) to every mouse back subcutaneous injection, attack the rear continuous breeding observing 21d of poison, test-results is in table 4.The mouse of recombinant virus PRV-PPVPGVP2 and PRVHB98 immune group is being subject to all obtaining 100% protection when PRVNY virulent strain minimum lethal dose (MLD) is attacked, and the blank group of DEME immunity and the small white mouse of PPV commodity deactivation vaccine immunity are all dead within l week after attacking poison.It can thus be appreciated that recombinant virus PRVPGVP2 strain can provide high-caliber provide protection to mouse, to resist the attack of PRV virulent strain.

The protected effect that table 4 test mice is attacked minimum lethal dose (MLD) PRV-NY strain

Group	Dead mouse (only)	Total mice (only)	Protection ratio (%)
				PRV HB98	0	5	100
PPV commodity deactivation vaccine	5	5	0
				PRV-PPV PGVP2	0	5	100
DMEM	5	5	0

3 conclusions and discussion

3.1 recombinant virus PRV-PPVPGVP2 are to the Humoral analysis of mouse

When measuring the PPV antibody in each test group mice serum, we measure respectively by HI test and indirect ELISA test method antagonist level.HI test-results shows, recombinant virus PRV-PPVPGVP2 strain and PPV commodity deactivation vaccine all can produce and have the PPV antibody of blood clotting rejection characteristic by effective stimulus mouse body, and PPV antibody horizontal after recombinant virus PRV-PPVPGVP2 strain and the immunity of PPV commodity deactivation vaccine is the highest can reach 1:2 respectively ⁵and 1:2 ⁶.Put out a fire compared with seedling with PPV commodity, the antibody horizontal that recombinant virus PRV-PPVPGVP2 stimulates mouse to produce is slightly low, and its reason may be optimized in immunization route, immunizing dose and immunological adjuvant etc. for commercially available vaccine; And recombinant virus used in the present invention is only the virus liquid by obtaining after ST cell cultures, therefore still need to explore in the immunizing dose to recombinant virus, route of inoculation and immunological adjuvant etc. in follow-up study.But do not get rid of recombinant virus PRV-PPVPGVP2 only can be correlated with by the stimulating animal body antibody that produces PPVVP2 albumen, because commodity deactivation vaccine is often by adding after utilizing the totivirus deactivation of virulent strain, proper adjuvant obtains, can produce for the antibody of totivirus by stimulating animal body, effect may be better.But deactivation vaccine but has can not stimulate body to produce cellular immunization, needs repeatedly booster immunization, and immunizing dose is large, the shortcomings such as the potent antibodies persistent levels time is short.Believe through follow-up test optimization, the advantage of the alternative strain of this recombinant viral vaccine obtains point performance further surely.

Detect PPV antibody in mice serum with indirect ELISA method, analytical results finds, recombinant virus and PPV commodity deactivation vaccine all can produce PPV antibody by effective stimulus animal body.But antibody produces that but there is some difference in rule aspect, the anti-PPV antibody that PPV commodity deactivation vaccine immune group mouse produces will early than recombinant virus PRV-PPVPGVP2 immune group, but the later stage antibody horizontal of deactivation vaccine immune group has but showed downward trend.By comparison, although the antibody horizontal that the recombinant virus living vaccine immune group initial stage produces is relatively low, the trend increased continuously is presented in the later stage.This may be because the antigen amount in deactivation vaccine is through optimization, has sufficient antigen amount in vaccine, can produce corresponding antibodies by stimulating animal body in time; But restructuring poison PRV-PPVPGVP2 used in the present invention is without concentrated, if during injecting virus quantity not sufficient, need breed further in vivo and stimulate body to produce corresponding antibodies, therefore recombinant virus immune group is relatively low at the antibody horizontal of immunity generation in early stage; But along with the propagation of later stage live virus, internal antibody level also presents the trend of rising, therefore follow-up study needs docking toxic agent amount further to explore.

Serum neutralization test detects the result display of PRV antibody, recombinant virus PRV-PPVPGVP2 and PRVHB98 vaccine produce in PRV antibody horizontal at stimulation mouse body all obvious effect, and effect is suitable, the insertion of foreign antigen genes PPVVP2 gene does not affect its immunogenicity.

3.2 recombinant virus PRV-PPVPGVP2 are to the Study On Cellular Immune analysis of mouse

CD3 in 7th week mouse peripheral blood after head being exempted from by flow cytometer ⁺, CD4 ⁺, CD8 ⁺t lymphocyte subset group detect, and result shows the CD3 in recombinant virus PRV-PPVPGVP2 immune group and PRVHB98 vaccine immunity group mouse peripheral blood ⁺, CD4 ⁺, CD8 ⁺t lymphocyte quantity is all higher than DMEM control group and PPV commodity deactivation vaccine immune group.CD3 molecule is only expressed in all mature T cells surface, is surface molecular specific to T cell, is usually used in T cell sum and detects.CD4 ⁺t cell: be functionally have heterogeneous T lymphocyte populations, major subpopulations is helper T cell, and its biological action is helping B cell activation and produces antibody, auxiliary CD8 ⁺t cell activation, activating macrophage, strengthens it and kills and wounds bacterium and HLA-II antigen in born of the same parents; DC and scavenger cell can catch some virus, and processing treatment is virus antigen peptide-MHC-class Ⅱmolecule mixture, offers to CD4 ⁺t cell also makes it to activate, and activates CTL by producing the cytokines such as IL-2.CD8 ⁺t cell: its TCR identifies the antigen peptide-mhc class i molecular complex on target cell (as virus infected cell, tumour cell etc.) surface, CD8 ⁺a T cell mainly class has the effector cell of killing activity, is called cytotoxic T cell.Test shows, recombinant virus PRV-PPVPGVP2 strain and PRVHB98 vaccine all can produce cellular immunization by effective stimulus mouse body.

3.3PRV protest test is analyzed

With PRVNY virulent strain minimum lethal dose (MLD) (about 10 ^2.95tCID ₅₀) head is exempted from after often group was randomly drawed in the 7th week 5 mouse carry out protest test.The mouse of result display recombinant virus PRV-PPVPGVP2 and PRVHB98 vaccine immunity group is being subject to all obtaining 100% protection when PRVNY virulent strain minimum lethal dose (MLD) is attacked, it can thus be appreciated that recombinant virus PRV-PPVPGVP2 strain and PRVHB98 all can resist the attack of PRV virulent strain by available protecting mouse.

To sum up, the present invention with pseudo-rabies low virulent strain for carrier, construct the recombinant pseudorabies virus can expressing PPV VP 2 protein, test-results display recombinant virus PRV-PPVPGVP2 strain both can stimulate mouse body to produce effective humoral immunoresponse(HI), again can the cellullar immunologic response of enhancing body, this has established theory and technology support for recombinate research and development of PPVVP2 genetically engineered live vector vaccine of PRV.

Claims

1. express a recombinant porcine pseudorabies strain for pig parvoviral VP2 gene, it is characterized in that: recombinant porcine pseudorabies poison (Herpesviridae) strain, CCTCCNO:V201346.