CN103409374A - Trigeminy inactivated vaccine for porcine circovirus disease, porcine streptococcus suis disease and porcine haemophilus parasuis disease, preparation method of the vaccine and applications of the vaccine - Google Patents
Trigeminy inactivated vaccine for porcine circovirus disease, porcine streptococcus suis disease and porcine haemophilus parasuis disease, preparation method of the vaccine and applications of the vaccine Download PDFInfo
- Publication number
- CN103409374A CN103409374A CN2013103096800A CN201310309680A CN103409374A CN 103409374 A CN103409374 A CN 103409374A CN 2013103096800 A CN2013103096800 A CN 2013103096800A CN 201310309680 A CN201310309680 A CN 201310309680A CN 103409374 A CN103409374 A CN 103409374A
- Authority
- CN
- China
- Prior art keywords
- haemophilus parasuis
- porcine
- vaccine
- porcine circovirus
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a trigeminy inactivated vaccine for porcine circovirus disease, porcine streptococcus suis disease and porcine haemophilus parasuis disease, a preparation method of the vaccine and applications of the vaccine. Porcine circovirus 2-WH has an accession number of CCTCC NO: V20133 and has strong virulence, good immunogenicity, a high antigen titer, and a high virulence reaching 10<7.4>TCID[50]/mL. The trigeminy inactivated vaccine, which is prepared by mixing the porcine circovirus 2-WH, porcine streptococcus suis 2-LT, and porcine haemophilus parasuis 4-MD0322 and porcine haemophilus parasuis 5-SH0165, can simultaneously prevent the porcine circovirus disease and diseases caused by porcine streptococcus suis 2-type, porcine haemophilus parasuis 4-type and porcine haemophilus parasuis 5-type, the immune protective effect on the same serotype reaches over 80%.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis triple inactivated vaccine, the preparation method who also relates to a kind of Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis triple inactivated vaccine, also relate to the application of a kind of Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis triple inactivated vaccine.The present invention prepares triple inactivated vaccine and mainly is applicable to sow, and boar and piglet have good immune effect.
Technical background
Porcine circovirus type 2 infection is the major cause that causes wean pig multisystemic exhaustion syndrome (PMWS), and other co-factor can strengthen the severity of disease.Porcine circovirus desease can cause that infected pigs only becomes thin, poor growth, and the price of deed reduces; Because this disease is immunosuppressant disease, the immunity of organism defense function reduces, and causes polyinfection usually occurs clinically, produces so-called various syndrome simultaneously, increases the difficulty that disease is controlled.
Swine streptococcus and haemophilus parasuis are all conditionality pathogenic bacterium, in the situation that immunity of organisms reduces the generation that easily causes disease, often cause the polyinfection of body.
Swine streptococcus is the important pathogenic bacteria that causes Streptococcus suis, have 33 kinds of serotypes, wherein streptococcus suis 2-type can cause pig acute sepsis, meningoencephalitis, sacroiliitis and acute death, also can cause the specific crowd in the live pig practitioner to infect and dead (J Clin Microbiol, 2002,40 (8): 2922～2929.).6～August in 2005, the streptococcus suis 2-type disease has been broken out in the areas such as Ziyang City, Sichuan Province, Neijiang City, and causes 204 people to infect, 38 people dead (journal of animal science and veterinary medicine, 2007,38 (4): 367～381.).
Haemophilus parasuis (Haemophilus parasuis, HPS) can cause polyserositis, sacroiliitis and the meningitis of pig, can affect sucking piglets from 2 ages in week to the growing and fattening pigs at 4 monthly ages, mainly after wean, fall ill with the child care stage, be more common in the pig in 5～8 ages in week, sickness rate is generally 10%～15%, and when serious, mortality ratio is up to 50%.It easily with swine streptococcus, pig, breeds with disordered breathing syndrome virus, mycoplasma pneumoniae and other cause of disease is mixed or secondary infection, and according to many pieces of bibliographical informations, Haemophilus parasuis is easily by mistaken diagnosis (Hua Zhong Agriculture University's journal, 2005,24 (1): 55～58).Therefore, control clinically Haemophilus parasuis not only to this disease itself, also be conducive to the control of Other diseases, and then provide guarantee for improving swinery holistic health level.
At present, the vaccine used on the market only has the inactivated vaccine of independent prevention Streptococcus suis, Haemophilus parasuis and pig circular ring virus 2.Prevent simultaneously Streptococcus suis, the inactivated vaccine of Haemophilus parasuis and pig circular ring virus 2, yet there are no report both at home and abroad.And domestic bacterial epidemic disease is mainly with the microbiotic control, due to antibiotic abuse, has caused the generation of Resistant strain, make the pharmacological agent trend invalid; Antibiotic medicine residual caused serious food-safety problem; And pig circular ring virus easily causes the immunosuppression of body, this has increased the polyinfection probability, particularly swine streptococcus of body and the secondary infection of haemophilus parasuis.Therefore, prevent Porcine circovirus desease with vaccine, Streptococcus suis and Haemophilus parasuis not only can be controlled the polyinfection of body, are also current most economical, effective meanss.
Therefore, on market, be badly in need of a kind of new triple inactivated vaccine that can prevent simultaneously Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis of invention, to address the above problem.Our company, after lot of experiments, has developed this triple inactivated vaccine, and this vaccine effect of experiment results proved is good.
Summary of the invention
The object of the present invention is to provide a kind of porcine circovirus 2 type-WH strain, this strain is delivered Chinese Typical Representative culture collection center (CCTCC) preservation in the Wuhan University of Wuhan City, Hubei Province on July 19th, 2013, Classification And Nomenclature: porcine circovirus 2 type-WH strain Porcine circovirus2-WH, CCTCC NO:V201333.This virus virulence is strong, immunogenicity good, and viral level is high when vitro culture.
A further object of the invention is to be to provide a kind of Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis triple inactivated vaccine, this vaccine can effectively prevent Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis simultaneously, and only need a pin immunity, reduced pig stress, reduced cost.Reach clinically-mono-pin and prevent the effect of ‖ more, and do not have loose malicious hidden danger, safe and reliable.
Another object of the present invention is the preparation method who has been to provide a kind of Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis triple inactivated vaccine, the antibody horizontal that vaccine prepared by the method produces is high, the time length is long, and does not have loose malicious hidden danger.
Purpose in addition of the present invention is to be to provide the application in preparation prevention pig circular ring virus medicine of a kind of Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis triple inactivated vaccine.In vaccine prepared by the method, the pig circular ring virus antigen titre is high, and viral titer can reach 10
7.4TCID
50/ ml, immunogenicity is good, and Porcine circovirus desease is had to good immune protection effectiveness.
In order to realize above-mentioned purpose, the present invention adopts following technical measures:
The separation of porcine circovirus 2 type, screening and identification
1.1 the separation and Culture of virus
Pathological material of disease to be separated---respectively to organize pathological material of disease be the applicant separates in September, 2004, being located away from the inguinal lymph nodes of the dead pig that the doubtful PCV-II in pig farm, Hubei infects and obtains.Its concrete separation method is: after organizing pathological material of disease to rinse by stroke-physiological saline solution, in mill, add appropriate DMEM substratum to grind to form tissue suspension, multigelation 3 times, centrifugal 25 minutes of 5000rpm/min, get supernatant liquor, the degerming of 0.22um millipore filtration, preserve or namely use for-20 ℃.Get part pathological material of disease tissue extraction DNA, detect by PCR method, the pathological material of disease that takes out test positive is inoculated in the PK-15 cell suspension culturing bottle of new digestion, 37 ℃ of static cultivations are after 24 hours, press the Tischer method cultivate virus (Arch Virol, 1987,96:39-57).
1.2 the evaluation of virus
(1) adopt the PCR method Screening and Identification: according to PCV2 strain isolated (GenBank No.AF027217), design a pair of Auele Specific Primer, primer sequence is:
Upstream primer P1:5-CAC GGA TAT TGT AGT CCT GGT-3 '
Downstream primer P2:5-CGC ACC TTC GGA TAT ACT GTC-3 '
The primer amplification clip size is 493bp, between 1093～1586 Nucleotide, is the ORF2 gene, by Shanghai, gives birth to work biotechnology company limited and synthesizes, and is made into proper concn with the TE damping fluid, puts below-20 ℃ standby.
(2) indirect immunofluorescence assay: PCR is accredited as to positive sample and goes down to posterity and cultivated for 3 generations, again by virus liquid and PK-15 cells Synchronous inoculation 96 orifice plates, cultivated 24 hours for 37 ℃, after cell forms individual layer, add appropriate 300mmol D-glucosamine to process (being as the criterion covering cell monolayer fully), in 37 ℃ of cultivation 30min, discard D-glucosamine, add the DMEM maintenance medium that contains 2% new-born calf serum to continue to discard cell maintenance medium after cultivation 48h; With PBS washing 3 times, dry, add the anti-PCV2-ORF2 monoclonal antibody of 100ul, put in 37 ℃ of incubators and act on 1 hour, with PBS washing 3 times, dry, add the FITC-sheep anti-mouse igg of 1:100 dilution, 100ul/ hole, 37 ℃ of effect 30min.After PBS washing for several times, finally use the PBS back cover, observe under inverted fluorescence microscope
According to PCR method and immunofluorescent test, the strain of determining above-mentioned separation is pig annulus 2 type strains, this strain is delivered Chinese Typical Representative culture collection center (CCTCC) preservation in Wuhan, China city Wuhan University on July 19th, 2013, Classification And Nomenclature: porcine circovirus 2 type-WH strain Porcine circovirus2-WH, CCTCC NO:V201333.
1.3 physio-biochemical characteristics
Porcine circovirus 2 type-WH strain adopts the DMEM substratum to cultivate, and has prolificacy in the PK-15 cell, in substratum, adds appropriate D-glucosamine, can promote viral massive duplication; In virus 25 generations of blind passage on the PK-15 cell,, virus titer can reach 10
7.4TCID
50/ ml, the vaccine that utilizes it to prepare can provide preferably the protection for Porcine circovirus desease.
The preparation method of a kind of pig circular ring virus (2 type), Streptococcus suis (2 type) and Haemophilus parasuis (4 types, 5 types) triple inactivated vaccine, its step is as follows:
A. respectively by pig circular ring virus (Porcine circovirus) 2 types-WH strain, CCTCC NO:V201333; Swine streptococcus (Streptococcus suis) 2-LT, CCTCC NO:M2011282; Haemophilus parasuis (Haemophilus parasuis) 4-MD0322, CCTCC NO:M2011283 and haemophilus parasuis (Haemophilus parasuis) 5-SH0165, CCTCC NO:M2011284 carries out respectively the ordinary method multiplication culture, obtain the porcine circovirus 2 type virus liquid, streptococcus suis 2-LT bacterium liquid, haemophilus parasuis 4-MD0322 bacterium liquid and haemophilus parasuis 5 types-SH0165 bacterium liquid.
B. the porcine circovirus 2 type virus liquid prepared to a step respectively, streptococcus suis 2-LT strain bacterium liquid, haemophilus parasuis 4-MD0322 strain bacterium liquid, haemophilus parasuis 5 types--in SH0165 bacterium liquid, add 0.3%～0.4% formaldehyde solution by total amount, be placed in 37 ℃ of deactivations 48～72 hours, during every 6 hours, stir 1 time.
C. the porcine circovirus 2 type virus liquid that will collect, streptococcus suis 2-LT strain bacterium liquid, haemophilus parasuis 4-MD0322 strain bacterium liquid, 5 types-SH0165 bacterial classification mix according to the volume ratio of 1:1:1:1, make water; White oil (matching northern gram 201 adjuvants) is sterilizing, and normal temperature is placed; Water mixes according to 70%～75%:30%～25% volume ratio with oil phase, preferably the 75%:25% volume ratio.Slowly add the water homogeneous after 3～5 minutes oil phase, make even emulsion, be the oil-in-water-type triple inactivated vaccine.The preservation condition of this triple inactivated vaccine is: 2～8 ℃.
D, the inactivated vaccine that step c is obtained carry out packing.
The application in preparing Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis medicine of a kind of Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis triple inactivated vaccine, the steps include:
1, with 30 of the healthy weanling pigs of 28～35 ages in days, wherein 15 vaccine 2ml that each intramuscular injection embodiment 4 makes, contain 1 using dosage, and head exempts to carry out in latter 21 days the immunity for the second time of same dose; Remaining 15 not immune control groups of conduct.After immunity, measure animal heat, observe clinical manifestation.
2, two exempted from latter 14 days, streptococcus suis 2-type adopts vein to attack poison, and haemophilus parasuis adopts abdominal cavity inside fire attack poison, and porcine circovirus 2 type adopts collunarium and intramuscular injection to attack poison.Use respectively 2.0 * 10
6CFU streptococcus suis 2-LT strain, 15.0 * 10
9The haemophilus parasuis 4-MD03220 strain of CFU, 8.0 * 10
9Haemophilus parasuis 5 types (SH0165) and 10 of CFU
7.0The porcine circovirus 2 type of TCID50 is attacked poison, attacks rear its clinical symptom and the death condition of observing of poison, calculates the protection ratio of every batch of vaccine.
Compared with prior art, the present invention has the following advantages:
Advantage of the present invention is the disease that can prevent simultaneously Porcine circovirus desease, streptococcus suis 2-type and pig haemophilus parasuis 4 types, 5 types to cause; immune protective effect for homologous serotype reaches more than 80%; with respect to current commercially available vaccine; can single needle the more serotype of immunity; reach the purpose of the anti-how sick ‖ of-mono-pin, and easy to use, having reduced pig stress; and do not have loose malicious hidden danger, safe and reliable.
Advantage of the present invention be in vaccine porcine circovirus 2 type-WH strain virulence is strong, viral titer is high in cell, immunogenicity good.
The accompanying drawing explanation:
Fig. 1 is that a kind of porcine circovirus 2 type-WH strain and other strain isolated nucleotide sequence homology compare schematic diagram
Fig. 2 is that evolutionary tree occurs a kind of porcine circovirus 2 type-WH strain system.
Embodiment
Easier to understand for the present invention, below will further set forth embodiments of the invention.The present invention will be further described and demonstration in conjunction with implementing, and technical scheme described in the present invention, if not otherwise specified, be conventional scheme.
Embodiment 1: the separation of porcine circovirus 2 type, screening and identification
1. separation and the cultivation of virus
Pathological material of disease to be separated---respectively organizing pathological material of disease is that applicant's contriver is located away from Hubei large-scale pig farm natural occurrence pig in September, 2004.Select multisystemic wasting syndrome (PMWS) case after doubtful weaned piglet, gather the tissues such as lungs and lymphoglandula.Its concrete separation method is: after organizing pathological material of disease to rinse by stroke-physiological saline solution, in mill, add appropriate DMEM substratum to grind to form tissue suspension, multigelation 3 times, centrifugal 25 minutes of 5000rpm/min, get supernatant liquor, the degerming of 0.22um millipore filtration, preserve or namely use for-20 ℃.Get part pathological material of disease tissue extraction DNA, detect by PCR method, the pathological material of disease that takes out test positive is inoculated in the PK-15 cell suspension culturing bottle of new digestion, 37 ℃ of static cultivations are after 24 hours, press the Tischer method cultivate virus (Arch Virol, 1987,96:39-57).
(1) PCR method is identified:
According to the PCV2 gene order that GenBank No.AF027217 includes, design a pair of expansion PCV2-ORF2 gene-specific primer primers, synthetic by Shanghai Sheng Gong company:
Upstream primer: 5 '-CACGGATATTGTAGTCCTGGT – 3 '
Downstream primer: but 5 '-CCCACCTTCGGATATACTGTC – the 3 ' amplification length is the target DNA fragment of 493bp, and its sequence is shown in SEQ ID NO.1.
DNA extraction in the pathological material of disease tissue: get the clinical sample to be checked of 900 μ l in the Eppendorf of 2ml pipe, add Digestive system (the 255 μ l TNE of 300 μ l; 15 μ l10%SDS; 30 μ l20mg/ml Proteinase Ks), put 56 ℃ of water-baths 3 hours, then use isopyknic phenol: chloroform: Virahol (25: 24: 1) extracting 3 times, centrifugal 10 minutes of 12000rpm, get supernatant, the dehydrated alcohol that adds two volumes was put-20 ℃ of precipitations 30 minutes, and 12000rpm removed supernatant in centrifugal 10 minutes, add the resuspended precipitation of 75% ethanol, 7500rpm removed supernatant in centrifugal 10 minutes, after seasoning, dissolved with 50 μ lTE, then added the RNA enzyme, 37 ℃ of digestion, after 30 minutes, are put below-20 ℃ and are preserved.
Reaction system (50 μ l): 10 times of damping fluid 5 μ l, 25mmol/L MgCl
21.5 μ l, dNTPs1.0 μ l, 1.5umol/L upstream primer 1.5 μ l, 1.5umol/L downstream primer 1.5 μ l, ExTaqE0.5 μ l, sterilized water 9 μ l, template 10 μ l.
Reaction conditions: 94 ℃ of sex change 4 minutes; 94 ℃ 50 seconds, 55 ℃ 1 minute, 72 ℃ 1.5 minutes, 72 ℃ 10 minutes, 4 ℃ of preservations of PCR product.
The PCR result is observed: get pcr amplification reaction product 10 μ l and Mark2000plus5 μ l, be added in 0.8% agarose gel that contains EB, electrophoresis is 30 minutes under 80 volts of voltages, then under UV-lamp, observes.The purpose band of visible 496bp.
(2) separation of virus
Take a morsel and detect as the pathological material of disease of the PCV2 positive through PCR, making the pathological material of disease suspension synchronously is inoculated in the PK-15 cell suspension of new digestion by 10%, put under 37 ℃ and cultivated 24 hours, after cell forms individual layer, by the Tischer method, add appropriate 300mmol/L D-glucosamine to process (being as the criterion covering cell monolayer fully), put under 37 ℃ and cultivated 30 minutes, discard D-glucosamine, add the DMEM maintenance medium that contains 2% new-born calf serum to continue to cultivate 48 hours, the results virus liquid, put below-20 ℃ and temporarily preserve (prolonged preservation need be put below-70 ℃).
2. indirect immunofluorescence assay (IFA)
The viral suspension of results and PK-15 cell are mixed, be inoculated in 96 orifice plates (100 μ l/ hole), putting 37 ℃ cultivated 24 hours, with 300mmol/L D-glucosamine solution, hatched 30 minutes, after with the aseptic PBS of 10mmol/L that the pH value is 7.4, washing 2 times again, continue to cultivate by maintenance medium, establishing simultaneously the not cell of virus inoculation is the blank group.Above-mentioned 2 groups of cell cultures were discarded to cell maintenance medium after 48 hours, with cold dehydrated alcohol, fix 30 minutes after the PBS washing, discard stationary liquid, 96 porocyte plates are dried naturally.96 fixing orifice plates are washed 3 times with PBS, each 5 minutes, seasoning.In test holes and blank hole, drip respectively 100 μ l PCV2 negative serum and positive serums, put 37 ℃ of effects 1 hour, PBS washs 3 times (5 minutes/time).In test holes and blank hole, all drip the FITC-goat-anti pig IgG of doing 1: 50 times of dilution with PBS, 50 μ l/ holes, put 37 ℃ of effects 30 minutes, PBS washing 3 times.Finally use the PBS back cover, observations under inverted fluorescence microscope.
According to PCR method and indirect immunofluorescence assay, the strain of determining above-mentioned separation is porcine circovirus type 2 strain, called after 2 porcine circovirus-WH strain.So far separation obtains a strain and has the pig circular ring virus that virulence is strong (porcine circovirus) 2 type strains, this bacterial strain is delivered Chinese Typical Representative culture collection center (CCTCC) preservation in the Wuhan University of Wuhan City, Hubei Province on July 19th, 2013, Classification And Nomenclature: porcine circovirus 2 type-WH strain Porcine circovirus2-WH, CCTCC NO:V201333, address: Wuhan, China Wuhan University.
Embodiment 2: the sequential analysis of porcine circovirus 2 type-WH strain
Genome to the porcine circovirus 2 type identified-WH strain carries out sequential analysis and evolutionary analysis, specific as follows:
(1) design of primers
With reference to PCV2 strain (AY122275) nucleotide sequence that GenBank has delivered, the design pair of primers, primer amplification purpose clip size is 1767bp, utilizes the overlap of two amplified fragments to be spliced into the viral genome total length.Primer sequence is as follows:
P
3：5’－GCACCGCGGAAATTTCTGACAAACGTTACA－3’
P
4: 5 '-GAACCGCGGGCTGGCTGAACT TTTGAAAGT-3 ' primer is synthetic by Shanghai Sheng Gong biotech firm.
After nucleotide sequencing, analyze with DNAStar6.0.From following different Local Isolates (in Table 1), carry out Nucleotide and phylogenetic analysis respectively.
Source and the number of logging in of the different local PCV2 strain isolateds of table 1
(2) phylogenetic analysis
9 strain PCV2 sequences (NB0701 strain, HK803 strain, HN0602 strain, DK408 strain, DK405 strain, DM179 strain, LUOHE strain, CAOS strain and the VOS～3415 strains) homology of WH strain whole genome sequence and GeneBank login is 98.2%～99.9%.
For understanding the sibship between the different Local Isolates in the world, from the sequence that GenBank has delivered, choosing the strain sequence of separating from country variant, comprising strain in China, Denmark's strain, Slovakia's strain, Canadian strain.By the full genic system of DNAStar Software on Drawing, grow evolutionary tree.
Embodiment 3: the mensuration of porcine circovirus 2 type-WH strain TCID50
By 5 generations of blind passage and 25 generations the porcine circovirus 2 type-WH strain positive PK-15 cell-20 ℃ multigelation 3 times, the PK-15 cell (polluting without PCV) grown fine is used to 0.05% trysinization, packing 96 orifice plates, the 90 every holes of μ L, then add with the DMEM substratum 10 that contains 10% serum
-1-10
-12The virus liquid of dilution.Each 6 hole of extent of dilution inoculation, put into CO after mixing
2In incubator, continue to cultivate.After 12h, discard nutrient solution, process 30min with the 300mmol/L D-glucosamine, after the PBS washing, add the DMEM nutrient solution that contains 2% serum to continue to cultivate 48h; Discard nutrient solution, by embodiment 1, making indirect immunofluorescence assay (IFA) result of determination.Press the TCID that the Reed-Muench method is calculated virus strain
50.
The porcine circovirus 2 type separated-WH strain blind passage after 5 generations malicious valency be 10
4.0TCID
50/ mL, be passaged to the 25th generation viral titer be 10
7.4TCID
50/ mL.
Embodiment 4: porcine circovirus 2 type-WH strain is to the piglet virulence experiment
Get the 25th generation virocyte culture (10
7.4TCID
50/ ml), and 5 of collunarium and musculi colli inoculation 49～56 age in days pig circular ring virus negative antibody piglets, every equal collunarium and musculi colli injection 2.5ml, establish 5 of non-infection contrast pigs, isolated rearing simultaneously.After 28 days, cut open to kill and infect piglet, dissects as seen, 5 pigs that test group is inoculated all show the inguinal lymph mesocolic lymph nodes, the remarkable enlargement of submandibular lymph nodes, and large 2 times than the normal healthy controls pig, lung's swelling, have obvious blutpunkte; Infected pigs was in latter 1 day of inoculation, and 7 days, 14 days, the serum gathered in 28 days carried out porcine circovurus type 2 specific PCR detection, all is positive; Cut open while killing and get infected pigs's inguinal lymph nodes and mesenteric lymph nodes, carry out histology and immunohistochemistry and detect, result all is positive.And the contrast pig is acted normally at duration of test, do not observe untoward reaction.
Embodiment 4: the preparation method of a kind of pig circular ring virus (2 type), Streptococcus suis (2 type) and Haemophilus parasuis (4 types, 5 types) triple inactivated vaccine, and its step is as follows:
1 vaccine manufacture and the inspection of semifinished product
1.1 produce the preparation with seed
1.1.1 the breeding of first order seed
The streptococcus suis 2-type LT strain (CCTCC NO:M2011282) of freeze-drying, haemophilus parasuis 4 type MD0322 strains (CCTCC NO:M2011283) and haemophilus parasuis 5-SH0165 strain (CCTCC NO:M2011284) are inoculated in to the TSA solid medium, putting 37 ℃ cultivated 24 hours, then choose well-grown bacterium colony, inoculation TSA solid medium several, put 37 ℃ and cultivated 12～16 hours, as first order seed.2～8 ℃ of preservations, preservation period is no more than 5.On substratum, go down to posterity, be no more than for 5 generations.
The porcine circovirus 2 type seed culture of viruses of freeze-drying (CCTCC NO:V201333) is returned to 3ml with the DMEM growth media, adopt synchronous inoculation method, by virus liquid and the growth media amount of 1: 10, seed culture of viruses is inoculated in to the PK-15 cell, put 37 ℃ of rotating and culturing, 37 ℃ of standing cultivation 24h, after cell forms individual layer, by the Tischer method, add appropriate 300mmol D-glucosamine to process (being as the criterion covering cell monolayer fully), in 37 ℃, cultivate 30min, discard D-glucosamine, add the DMEM maintenance medium that contains 2% new-born calf serum to continue to cultivate 48h, results virus, the seed culture of viruses subculture should be no more than for 5 generations.
1.1.2 the secondary seed breeding is got the first order seed of streptococcus suis 2-type LT strain, haemophilus parasuis 4 type MD0322 strains and haemophilus parasuis 5 type SH0165 strains and is inoculated in the TSB liquid nutrient medium, putting 37 ℃ cultivated 12～16 hours, by " Chinese veterinary pharmacopoeia " appendix, purely check, qualified rear as secondary seed.2～8 ℃ of preservations, preservation period is no more than 5.
The first order seed of getting porcine circovirus 2 type is inoculated in the PK-15 cell, put 37 ℃ of rotating and culturing, 37 ℃ of standing cultivation 24h, after cell forms individual layer, by the Tischer method, add appropriate 300mmol D-glucosamine to process (being as the criterion covering cell monolayer fully), in 37 ℃ of cultivation 30min, discard D-glucosamine, add the DMEM maintenance medium that contains 2% new-born calf serum to continue to cultivate 48h, the results virus liquid.The virus liquid be up to the standards is mixed, and quantitative separating, indicate title, harvest date, Virus passages etc., puts under-20 ℃ and preserve.
1.2 the seedling substratum is the TSB liquid nutrient medium, DMEM growth media, DMEM maintenance medium.
1.3 seedling liquid preparation
1.3.1 antigen is cultivated bacterium liquid and the pig circular ring virus venom of three kinds of serotypes and is cultivated respectively preparation.By the porcine circovirus 2 type secondary seed solution kind of accreditation in the PK-15 cell, and supply DMEM or the MEM growth media (contains penicillin 100U/ml, Streptomycin sulphate 100 μ g/ml, 10% calf serum), put 37 ℃ of rotating and culturing 24h, after cell forms individual layer, by the Tischer method, add appropriate 300mmol D-glucosamine to process (being as the criterion covering cell monolayer fully), in 37 ℃, cultivate 30min, discard D-glucosamine, add the DMEM maintenance medium that contains 2% new-born calf serum to continue to cultivate, when CPE reaches 80% when above (after inoculation approximately 60～80 hours) results virus liquid,
The streptococcus suis 2-type secondary seed solution is inoculated in the TSB liquid nutrient medium by 1%, puts 37 ℃ and cultivates 12 hours;
The haemophilus parasuis of accreditation 4 types and 5 type secondary seed solution are inoculated in to the TSB liquid nutrient medium by 1%, put 37 ℃ and cultivated 24 hours.
1.3.2 purely check and purely check by existing " Chinese veterinary pharmacopoeia " appendix, should be pure.
1.3.3 the virus liquid that deactivation is up to the standards and bacterium liquid, add formaldehyde solution by 0.4% of total amount of liquid, 37 ℃ of deactivations 48 hours, during every 6 hours, stir 1 time, then sampling is carried out the deactivation check by " Chinese veterinary pharmacopoeia ", should be without bacterial growth.
1.3.4 it is centrifugal to concentrate streptococcus suis 2-type LT strain, haemophilus parasuis 4 type MD0322 strains and haemophilus parasuis 5 type SH0165 strains that deactivation is up to the standards, then with physiological saline, regulates streptococcus suis 2-type bacterial concentration to 1.125 * 10 by the live bacterial count result before deactivation
10CFU/ml, regulate the bacterial concentration of haemophilus parasuis 4 types and 5 types and all adjust to 1.0 * 10
10CFU/ml, regulate every milliliter of viral level of porcine circovirus 2 type WH strain content and answer>=10
7.0TCID50.Steriling test is done in sampling, should be without bacterial growth.Get virus liquid dialysis after deactivation after 24 hours, adopt and in virus liquid and the growth media ratio of 1: 10, be inoculated in 3 bottles, PK-15 cell with footwork, cultivate for 37 ℃ and observed 5, to without pathology person 3 generations of blind passage again, answer acellular pathology appearance.Be provided with simultaneously with batch virus liquid without deactivation in contrast, typical cytopathy should occur.
1.4 join seedling
1.4.1 match northern gram import adjuvant (milliliter of take is unit) is got in the preparation of oil phase, 115 ℃ sterilizing, and to be cooled to room temperature standby.
1.4.2 the preparation of water is by the by volume 1:1:1:1 ratio mixing of four kinds of antigens concentrated, the limit edged stirs, to dissolving fully,
1.4.3 the ratio of emulsification water and oil phase is 3:1.Slowly add the water homogeneous after 3～5 minutes oil phase, stirred 20 minutes, make even emulsion (inconsistent with front).
2 packing quantitative separatings, the sealing of jumping a queue, put 2～8 ℃ of preservations.
Embodiment 5: the triple vaccine effect research
1 testing program:
With 30 of the healthy weanling pigs of 28～35 ages in days, 15 vaccine 2ml that each intramuscular injection embodiment 4 makes wherein,, head exempts to carry out in latter 21 days the immunity of same dose for the second time; Remaining 15 not immune control groups of conduct.After immunity, measure animal heat, observe clinical manifestation.
Two exempted from latter 14 days, and streptococcus suis 2-type adopts vein to attack poison, and haemophilus parasuis adopts abdominal cavity inside fire attack poison, and porcine circovirus 2 type adopts collunarium and intramuscular injection to attack poison.Use respectively 2.0 * 10
6CFU streptococcus suis 2-LT strain, 15.0 * 10
9The haemophilus parasuis 4-MD0322 strain of CFU, 8.0 * 10
9Haemophilus parasuis 5 types (SH0165) and 10 of CFU
7.0TCID
50Porcine circovirus 2 type attack poison, observe its clinical symptom and death condition after attacking poison, calculate the protection ratio of every batch of vaccine.
2 test-results:
2.1 body temperature situation after vaccine inoculation
Vaccinated pig is without obviously body temperature reaction, and normally, without other visible clinical responses appearance, the vaccination part is without Inflammatory responses (table 2) such as swelling for appetite, spirit.
Table 2: the mean body temperature after vaccine inoculation piglet (28～35 age in days) changes
As shown in table 2, the observations of vaccine after to the healthy weanling pig immunization of 28～35 ages in days 2ml show, vaccinated pig only shows a fervescence of crossing property, and mean body temperature raises and is no more than 1 ℃.In addition, after all piglet inoculations, appetite, spirit are all acted normally, without other visible clinical response.
2.2 vaccine immunity efficacy determinations
Piglet two was exempted from latter 14 days, used respectively 2.0 * 10
6CFU streptococcus suis 2-type LT strain, 15.0 * 10
9Haemophilus parasuis 4 types (MD0322) of CFU, 8.0 * 10
9Haemophilus parasuis 5 types (SH0165) and 10 of CFU
7.0Poison is attacked in the porcine circovirus 2 type of TCID50-WH strain, and result is as shown in table 3.
Table 3: vaccine immunity protection result
SEQUENCE LISTING
<110 > Wuhan Keqian Animal Biological Products Co., Ltd.
<120 > Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis triple inactivated vaccine and preparation method and application
<130 > Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis triple inactivated vaccine and preparation method and application
<160> 1
<170> PatentIn version 3.1
<210> 1
<211> 493
<212> DNA
<213> Porcine circovirus 2-WH
<400> 1
cacggatatt gtagtcctgg tcgtatatac tgttttcgaa cgccgtgccg aggcctacgt 60
ggtccacatt tctagaggtt tgtagcctca gccaaagctg attccttttg ttatttggtt 120
ggaagtaatc aatagtggag tcaagaacag gtttgggtgt gaagtaacgg gagtggtagg 180
agaagggttg ggggattgta tggcgggagg agtagtttac atatgggtca taggttaggg 240
ctgtggcctt tgttacaaag ttatcatcta gaataacagc agtggagccc actcccctat 300
caccctgggt gatgggggag cagggccaga attcaacctt aacctttctt attctgtagt 360
attcaaaggg tatggatatt ttgttggtcc cccctcccgg gggaacaaag tcgtcaatat 420
taaatctcat catgtccacc gcccaggagg gcgttctgac tgtggtagcc ttgacagtat 480
atccgaaggt gcg 493
Claims (5)
1. a porcine circovirus 2 type, is characterized in that: pig circular ring virus (Porcine circovirus) 2 types-WH strain, CCTCC NO:V201333.
2. a Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis triple inactivated vaccine, it is characterized in that: this vaccine is by pig circular ring virus (Porcine circovirus) 2 types-WH strain, CCTCC NO:V201333; Swine streptococcus (Streptococcus suis) 2-LT, CCTCC NO:M2011282; Haemophilus parasuis (Haemophilus parasuis) 4-MD0322, CCTCC NO:M2011283 and haemophilus parasuis (Haemophilus parasuis) 5-SH0165, CCTCC NO:M2011284 forms.
3. the preparation method of the described triple inactivated vaccine of claim 2, the steps include:
A. respectively by pig circular ring virus (Porcine circovirus) 2 types-WH strain, CCTCC NO:V201333; Swine streptococcus (Streptococcus suis) 2-LT, CCTCC NO:M2011282; Haemophilus parasuis (Haemophilus parasuis) 4-MD0322, CCTCC NO:M2011283 and and haemophilus parasuis (Haemophilus parasuis) 5-SH0165, CCTCC NO:M2011284 carries out respectively the ordinary method multiplication culture, obtain the porcine circovirus 2 type virus liquid, streptococcus suis 2-LT bacterium liquid, haemophilus parasuis 4-MD0322 bacterium liquid and haemophilus parasuis 5 types-SH0165 bacterium liquid;
B. the porcine circovirus 2 type virus liquid prepared to a step respectively, streptococcus suis 2-LT strain bacterium liquid, in haemophilus parasuis 4-MD0322 strain bacterium liquid, haemophilus parasuis 5 types-SH0165 bacterium liquid, add 0.3%～0.4% formaldehyde solution by total amount, be placed in 37 ℃ of deactivations 48～72 hours, during every 6 hours, stir 1 time;
C. the porcine circovirus 2 type virus liquid that will collect, streptococcus suis 2-LT strain bacterium liquid, haemophilus parasuis 4-MD0322 strain bacterium liquid, 5 types-SH0165 bacterial classification mix according to the volume ratio of 1:1:1:1, make water; White oil is sterilizing, and normal temperature is placed; Water mixes according to 70%～75%:30%～25% volume ratio with oil phase, slowly adds the water homogeneous after 3～5 minutes oil phase, makes even emulsion, is the oil-in-water-type triple inactivated vaccine, and the preservation condition of this triple inactivated vaccine is: 2～8 ℃.
4. the preparation method of triple inactivated vaccine according to claim 2, in its preparation process, the volume ratio of water and oil phase is 3:1.
5. the application of triple inactivated vaccine claimed in claim 2 in preparation treatment Porcine circovirus desease, Streptococcus suis and Haemophilus parasuis vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013103096800A CN103409374A (en) | 2013-07-23 | 2013-07-23 | Trigeminy inactivated vaccine for porcine circovirus disease, porcine streptococcus suis disease and porcine haemophilus parasuis disease, preparation method of the vaccine and applications of the vaccine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013103096800A CN103409374A (en) | 2013-07-23 | 2013-07-23 | Trigeminy inactivated vaccine for porcine circovirus disease, porcine streptococcus suis disease and porcine haemophilus parasuis disease, preparation method of the vaccine and applications of the vaccine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103409374A true CN103409374A (en) | 2013-11-27 |
Family
ID=49602416
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013103096800A Pending CN103409374A (en) | 2013-07-23 | 2013-07-23 | Trigeminy inactivated vaccine for porcine circovirus disease, porcine streptococcus suis disease and porcine haemophilus parasuis disease, preparation method of the vaccine and applications of the vaccine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103409374A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498446A (en) * | 2014-12-15 | 2015-04-08 | 北京科兴生物制品有限公司 | Method for inactivating virus in vaccine production |
| CN106511993A (en) * | 2016-11-08 | 2017-03-22 | 武汉科前生物股份有限公司 | Porcine pseudorabies virus and porcine circovirus type II bivalent vaccine, and applications thereof |
| CN109022368A (en) * | 2017-06-09 | 2018-12-18 | 普莱柯生物工程股份有限公司 | A kind of porcine circovirus type 2 strain, vaccine composition and its preparation method and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102329746A (en) * | 2011-08-16 | 2012-01-25 | 武汉科前动物生物制品有限责任公司 | Porcine streptococcus disease and haemophilus parasuis disease combined inactivate vaccine and preparation method thereof |
| WO2012092226A1 (en) * | 2010-12-27 | 2012-07-05 | Biomune Company | Veterinary vaccine composition against infections caused by salmonella |
| CN103083655A (en) * | 2011-11-02 | 2013-05-08 | 普莱柯生物工程股份有限公司 | Vaccine composition for preventing and treating porcine circovirus type 2, haemophilus parasuis and mycoplasma hyopneumoniae infection and preparation method thereof |
-
2013
- 2013-07-23 CN CN2013103096800A patent/CN103409374A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012092226A1 (en) * | 2010-12-27 | 2012-07-05 | Biomune Company | Veterinary vaccine composition against infections caused by salmonella |
| CN102329746A (en) * | 2011-08-16 | 2012-01-25 | 武汉科前动物生物制品有限责任公司 | Porcine streptococcus disease and haemophilus parasuis disease combined inactivate vaccine and preparation method thereof |
| CN103083655A (en) * | 2011-11-02 | 2013-05-08 | 普莱柯生物工程股份有限公司 | Vaccine composition for preventing and treating porcine circovirus type 2, haemophilus parasuis and mycoplasma hyopneumoniae infection and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| DVORAK,C.M ET AL: "Porcine circovirus 2 strain struve, complete genome", 《GENBANK 登录 KC618389.1》, 13 May 2013 (2013-05-13) * |
| 佚名: "猪圆环病毒2型灭活疫苗(WH)株说明书", 《武汉科前动物生物制品有限公司 网站》, 17 February 2013 (2013-02-17) * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498446A (en) * | 2014-12-15 | 2015-04-08 | 北京科兴生物制品有限公司 | Method for inactivating virus in vaccine production |
| CN104498446B (en) * | 2014-12-15 | 2017-03-15 | 北京科兴生物制品有限公司 | A kind of method of inactivation of viruses in production of vaccine |
| CN106511993A (en) * | 2016-11-08 | 2017-03-22 | 武汉科前生物股份有限公司 | Porcine pseudorabies virus and porcine circovirus type II bivalent vaccine, and applications thereof |
| CN109022368A (en) * | 2017-06-09 | 2018-12-18 | 普莱柯生物工程股份有限公司 | A kind of porcine circovirus type 2 strain, vaccine composition and its preparation method and application |
| CN109022368B (en) * | 2017-06-09 | 2022-05-24 | 普莱柯生物工程股份有限公司 | Porcine circovirus type 2 strain, vaccine composition, preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103263666B (en) | Porcine circovirus 2 type, porcine mycoplasmal pneumonia bivalent inactivated vaccine and preparation method thereof | |
| CN103083655B (en) | Vaccine combination of prevention and therapy porcine circovirus 2 type, haemophilus parasuis and mycoplasma hyopneumoniae infection and preparation method thereof | |
| CN105327344B (en) | Vaccine composition and the preparation method and application thereof containing porcine circovirus 2 type antigen Yu haemophilus parasuis antigen | |
| CN101240264A (en) | Porcine circovirus 2 type inactivated vaccine | |
| CN103305474A (en) | Porcine pseudorabies virus strain as well as inactivated vaccine and applications thereof | |
| CN104498441B (en) | Duck hepatitis A virus (HAV) type III low virulent strain and live vaccine prepared therefrom and application | |
| CN104587460B (en) | Mink viral enteritis, canine distemper bigeminal live vaccine and its preparation method and application | |
| CN102068694A (en) | Method for producing triple inactivated vaccine for newcastle disease, infectious bronchitis and infectious bursal disease | |
| CN102068695B (en) | Method for producing quadruple inactivated vaccine for newcastle disease, infectious bronchitis, avian influenza (H9 subtype) and infectious bursal disease | |
| CN106929451A (en) | One plant of Streptococcus suis and its application | |
| CN113491767A (en) | Triple inactivated vaccine for duck circovirus disease, novel duck reovirus disease and duck viral hepatitis and preparation method thereof | |
| CN103908665B (en) | A kind of vaccine combination and its preparation method and application | |
| CN105802920B (en) | A11 plants of infectious bursal disease virus and its application | |
| CN104087559B (en) | A kind of infectious bursa of Fabricius virus, inactivated vaccine and preparation method thereof | |
| CN104056265B (en) | Porcine circovirus 2 type, Porcine reproductive and respiratory syndrome bigeminy vaccine and preparation method thereof | |
| CN103409374A (en) | Trigeminy inactivated vaccine for porcine circovirus disease, porcine streptococcus suis disease and porcine haemophilus parasuis disease, preparation method of the vaccine and applications of the vaccine | |
| CN105727275B (en) | A kind of duck hepatitis bivalent vaccine and preparation method thereof | |
| CN101235363B (en) | Pig transmissible gastroenteritis virus vaccine strain and application thereof | |
| CN103127497B (en) | Porcine circovirus 2 type, mycoplasma pneumoniae bivalent inactivated vaccine and preparation method thereof | |
| CN106190988B (en) | Inactivated vaccine of feline calicivirus CH-JL5 strain | |
| CN104069489B (en) | Newcastle disease and infectious bursa of Fabricius bivalent inactivated vaccine and preparation method thereof | |
| CN104130981A (en) | Application of avian infectious bronchitis virus vaccine strain in preparation of inactivated vaccine | |
| CN107446859A (en) | One plant of chicken virus mycoplasma and its application | |
| CN104274829B (en) | A kind of vaccine combination and its preparation method and application | |
| CN108939063B (en) | Muscovy duck triple inactivated vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20131127 |