CN105330731B

CN105330731B - One kind WSP1 albumen relevant to Rice Photosynthesis and its relevant biological material and application

Info

Publication number: CN105330731B
Application number: CN201510741235.0A
Authority: CN
Inventors: 吴金霞; 张治国; 崔学安; 路铁刚
Original assignee: Biotechnology Research Institute of CAAS
Current assignee: Biotechnology Research Institute of CAAS
Priority date: 2015-11-04
Filing date: 2015-11-04
Publication date: 2019-02-01
Anticipated expiration: 2035-11-04
Also published as: CN105330731A

Abstract

The invention discloses a kind of WSP1 albumen relevant to Rice Photosynthesis and its relevant biological material and applications.WSP1 albumen of the invention is following protein a) or b) or c): a) amino acid sequence is protein shown in sequence 2 in sequence table；B) fused protein that the N-terminal of protein shown in sequence 2 and/or C-terminal connection label obtain in sequence table；C) protein with the same function for obtaining amino acid sequence shown in sequence 2 in sequence table by the substitution and/or deletion and/or addition of one or several amino acid residues.The functional gene WSP1 of control rice leaf color and fringe color of the invention is significant to the yield for improving Rice Photosynthesis efficiency and rice, can be applied in stock breeding and crossbreeding as the cue mark of true hybrid during the tracking label and hybrid seeding of genetic transformation progeny of plants.

Description

A kind of WSP1 albumen relevant to Rice Photosynthesis and its relevant biological material and Using

Technical field

Present invention relates particularly to a kind of WSP1 albumen relevant to Rice Photosynthesis and its relevant biological material and application, Belong to field of biotechnology.

Background technique

Photosynthesis provides substance source and energy source for the growth of rice, and chloroplaset is that progress is photosynthetic heavy Place is wanted, while being also the carrier of photosynthetic pigments, is widely distributed in leaf green histocyte.Chlorophyll is that plant carries out light The primary pigments of cooperation participate in the capture of luminous energy on antenna complex, the separation of charge and electron transmission.The conjunction of chlorophyll , to chlorophyll a (Chl a) and chlorophyll b (Chlb) is ultimately formed, 18 kinds of enzymes is needed to urge altogether at since glutamic acid (glutamate) Change and completes.The variation of any inside, external condition can all lead to leaf variegation and show as minus green symptom in the process, such as white The leaf colors abnormal phenotype such as change, yellow, striped, zebra.Multiple genes relevant to Chlorophyll synthesis out separated at present, mainly have OsCHLD, OsCHLH and OsCHLI including coding chlorophyll a oxidizing ferment OsCAO1 and OsCAO2 and coding magnesium ion sequestration enzyme, And the YGL1 gene for the OsDVR gene and coding chlorophyll synthase for encoding bivinyl reductase has also determined that and chlorophyll It synthesizes related.

The development of higher plant chloroplaset need to pass through the change procedure of a series of complex, the egg for needing cell nucleus gene to encode The albumen of white and chloroplaset coding is coordinated to participate in completing.In dark condition, the proplastid of non-photosynthetic effect is developed into blade Etioplast, the former lamella containing lattice-like in etioplast form chloroplaset through the continuous differentiation and development of illumination etioplast.

Summary of the invention

It is an object of the present invention to provide a kind of protein.

Protein provided by the invention is following protein a) or b) or c):

A) amino acid sequence is protein shown in sequence 2 in sequence table；

B) fused protein that the N-terminal of protein shown in sequence 2 and/or C-terminal connection label obtain in sequence table；

C) by amino acid sequence shown in sequence 2 in sequence table by one or several amino acid residues substitution and/or Obtained protein with the same function is deleted and/or added.

It is a further object to provide biomaterials relevant to above-mentioned protein.

Biomaterial relevant to above-mentioned protein provided by the invention is following A 1) any one of to A20):

A1 the nucleic acid molecules of above-mentioned protein) are encoded；

A2) contain A1) expression cassettes of the nucleic acid molecules；

A3) contain A1) recombinant vectors of the nucleic acid molecules；

A4) contain A2) recombinant vector of the expression cassette；

A5) contain A1) recombinant microorganisms of the nucleic acid molecules；

A6) contain A2) recombinant microorganism of the expression cassette；

A7) contain A3) recombinant microorganism of the recombinant vector；

A8) contain A4) recombinant microorganism of the recombinant vector；

A9) contain A1) the transgenic plant cells systems of the nucleic acid molecules；

A10) contain A2) the transgenic plant cells system of the expression cassette；

A11) contain A3) the transgenic plant cells system of the recombinant vector；

A12) contain A4) the transgenic plant cells system of the recombinant vector；

A13) contain A1) Transgenic plant tissues of the nucleic acid molecules；

A14) contain A2) Transgenic plant tissue of the expression cassette；

A15) contain A3) Transgenic plant tissue of the recombinant vector；

A16) contain A4) Transgenic plant tissue of the recombinant vector；

A17) contain A1) the genetically modified plants organs of the nucleic acid molecules；

A18) contain A2) the genetically modified plants organ of the expression cassette；

A19) contain A3) the genetically modified plants organ of the recombinant vector；

A20) contain A4) the genetically modified plants organ of the recombinant vector.

In above-mentioned biomaterial, A1) nucleic acid molecules be it is following 1) or 2) or 3) shown in gene:

1) its coded sequence is the cDNA molecule or DNA molecular of sequence 1 in sequence table；

2) there is 75% or 75% or more identity with the nucleotide sequence 1) limited, and encodes the cDNA of above-mentioned protein Molecule or genomic DNA molecule；

1) or 2) 3) and the cDNA molecule of above-mentioned protein is encoded with the nucleotide sequence hybridization that limits under strict conditions Or genomic DNA molecule.

It is a still further object of the present invention to provide above-mentioned protein or the new applications of above-mentioned relevant biological material.

The present invention provides above-mentioned protein or above-mentioned relevant biological material in regulation plant leaf color and/or fringe color Using；

The regulation plant leaf color and/or fringe color are embodied by regulation chlorophyll content of plant and/or Development of Chloroplasts 's.

In above-mentioned application, the chlorophyll is chlorophyll a and/or chlorophyll b and/or chlorophyll a+b.

The present invention also provides above-mentioned protein or above-mentioned relevant biological material to cultivate what photosynthetic efficiency improved Application in genetically modified plants；

The photosynthetic efficiency improves the leaf color for being embodied in genetically modified plants and/or fringe discoloration is green.

The last one purpose of the invention is to provide a kind of method of genetically modified plants that cultivation photosynthetic efficiency improves.

The method provided by the invention for cultivating the genetically modified plants that photosynthetic efficiency improves includes by above-mentioned protein The step of encoding gene imports in recipient plant, obtains genetically modified plants；The photosynthetic efficiency of the genetically modified plants is higher than The recipient plant.

In the above method, the nucleotide sequence of the encoding gene of the protein is DNA shown in sequence 1 points in sequence table Son；

The photosynthetic efficiency of the genetically modified plants is higher than the recipient plant and is embodied in following 1) -8) at least one Kind:

1) leaf color of the genetically modified plants is greener than the recipient plant；

2) recipient plant described in the fringe color ratio of the genetically modified plants is green；

3) Chlorophyll-a Content of the genetically modified plants is higher than the recipient plant；

4) content of chlorophyll b of the genetically modified plants is higher than the recipient plant；

5) chlorophyll a+b content of the genetically modified plants is higher than the recipient plant；

6) chloroplast quantity in the mesophyll cell of the genetically modified plants is higher than the recipient plant；

7) the basal granule quantity in the mesophyll cell of the genetically modified plants is higher than the recipient plant；

8) the basal granule stacking number in the mesophyll cell of the genetically modified plants is higher than the recipient plant.

In the above method, the recipient plant is monocotyledon or dicotyledon；The monocotyledon is specially Rice.

The present invention using map-based cloning cloned control rice leaf color and fringe color functional gene WSP1 (WHITESTRIPLE LEAF/PANICLES 1), and identify using transgene complementation test the function of WSP1 gene；It also found simultaneously WSP1 gene is by controlling chlorophyll synthesis and Development of Chloroplasts come adjusting and controlling rice leaf color and fringe color change.Control of the invention The functional gene WSP1 of rice leaf color processed and fringe color is significant to the yield for improving Rice Photosynthesis efficiency and rice, also It can be applied to as the cue mark of true hybrid during the tracking label and hybrid seeding of genetic transformation progeny of plants good In kind breeding and crossbreeding.

Detailed description of the invention

Fig. 1 is the morphological feature of dead ears mutant wsp1.Wherein, Figure 1A is dead ears mutant wsp1 and the open country in tri-leaf period The leaf morphology of raw type rice (OryzasativaLcv.Nipponbare)；Figure 1B and Fig. 1 C is the dead ears mutant wsp1 in maturity period and the phenotype of wild type； Fig. 1 D is the dead ears mutant wsp1 in maturity period and the leaf morphology of wild type.

Fig. 2 is Primary Location and finely positioning figure and mutational site analysis and peak of the WSP1 gene on rice chromosome Figure.Fig. 2A is Primary Location and finely positioning figure of the WSP1 gene on rice chromosome；Fig. 2 B is mutational site analysis；Fig. 2 C It is the peak figure in mutational site with Fig. 2 D.

Fig. 3 is T₀In generation, turns the phenotype of WSP1 rice, wild rice and dead ears mutant wsp1 fringe portion and blade.Fig. 3 A is The structure chart of complementing vector pCAMBIA2300-WSP1；Fig. 3 B is T₀In generation, turns WSP1 rice, wild rice and dead ears mutant The phenotype of wsp1 fringe portion；Fig. 3 C is T₀In generation, turns the Molecular Identification of WSP1 rice, wild rice and dead ears mutant wsp1.Its In, WT is wild rice (OryzasativaLcv.Nipponbare)；Wsp1 is dead ears mutant wsp1；Cp is T₀In generation, turns WSP1 rice.

Fig. 4 is the photosynthetic pigments in the seedling stage of dead ears mutant wsp1 and wild rice (OryzasativaLcv.Nipponbare), tillering stage, maturity period Comparision contents.Fig. 4 A is the chlorophyll in the seedling stage of dead ears mutant wsp1 and wild rice (OryzasativaLcv.Nipponbare), tillering stage, maturity period The comparision contents of a；Fig. 4 B is the leaf in the seedling stage of dead ears mutant wsp1 and wild rice (OryzasativaLcv.Nipponbare), tillering stage, maturity period The comparision contents of green element b；Fig. 4 C is seedling stage, tillering stage, the maturity period of dead ears mutant wsp1 and wild rice (OryzasativaLcv.Nipponbare) Chlorophyll a+b comparision contents.

Fig. 5 is dead ears mutant wsp1 compared with the seedling leaf scanning electron microscope of wild rice (OryzasativaLcv.Nipponbare).Fig. 5 A and Fig. 5 B is the seedling leaf scanning electron microscope (SEM) photograph of wild rice (OryzasativaLcv.Nipponbare)；Fig. 5 C and Fig. 5 D are that seedling stage dead ears mutant wsp1 is white The blade scanning electron microscope of color part；Fig. 5 E is the blade scanning electron microscope of seedling stage dead ears mutant wsp1 green portion.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Rice variety Dular in following embodiments is in document " Science.2012Sep 14；337(6100):1336- It is disclosed in 40. ", the public can obtain from Biological Technology institute, Chinese Academy of Agricultural Sciences.

Japonica rice variety " OryzasativaLcv.Nipponbare " in following embodiments is in document " Science.2002；It is disclosed in 7:92-100. ", The public can obtain from Biological Technology institute, Chinese Academy of Agricultural Sciences.

Dead ears mutant wsp1 in following embodiments is in document " Plant Mol Biol.2009Jan；69(1-2):69- 80) it is disclosed in ", the public can obtain from Biological Technology institute, Chinese Academy of Agricultural Sciences.

The acquisition of embodiment 1, dead ears mutant wsp1 and WSP1 gene

One, the discovery of dead ears mutant wsp1 and morphological feature

The original open country of rice (Oryza sativa L.) dead ears mutant wsp1 (white striple/panicle 1) Green material is japonica rice variety " OryzasativaLcv.Nipponbare ", comes from OryzasativaLcv.Nipponbare T-DNA mutant library, is obtained in Langfang in Hebei Province Wanzhuang base.It is white The phenotype of fringe mutant wsp1 appeared in for 3 leaf phases earliest, was in particular in: comparing with wild rice (OryzasativaLcv.Nipponbare), in 3 leaf phases The blade presentation of dead ears mutant wsp1 is white green alternate, and master pulse and great Mai show as albefaction, and middle arteries are especially apparent (Figure 1A), and wild Raw type rice (OryzasativaLcv.Nipponbare) does not have albinism；With the development of plant, the albefaction striped of the blade of dead ears mutant wsp1 increases More, when maturity period, shows as mottle leaf (Fig. 1 D), and most significant feature is that the fringe portion color of dead ears mutant wsp1 shows as white Change, and green (Figure 1B and Fig. 1 C) is presented in wild rice (OryzasativaLcv.Nipponbare).

Two, the acquisition of WSP1 gene

1, genetic development

It is female parent with dead ears mutant wsp1, wild rice (OryzasativaLcv.Nipponbare) is that male parent progress is orthogonal, and obtained F1 generation is planted Strain all shows as normal phenotype, by F₂After sowing four weeks for seed, select 200 single plants at random, the phenotype of 156 plants of discovery and Wild rice (OryzasativaLcv.Nipponbare) phenotype is identical, is normal type plant, it is prominent that 44 plants of phenotypes are identical with dead ears mutant wsp1 phenotype Modification plant.Card square examination result (χ²=0.95 < χ²0.05=3.84) show: the phenotype and mutant plants of normal plant Phenotypic segregation ratio meet 3:1；Further prove that the mutant phenotype is controlled by recessive single recessive nuclear gene.

2, the acquisition of WSP1 gene

(1) analysis and target group

Homozygous wsp1 mutant and rice variety Dular are hybridized, F is obtained₁Generation, F₁Generation selfing, obtains F₂Group, And from F₂The apparent dead ears phenotypic mutation individual of 810 plant mutant phenotypes is selected in group as target group.

(2) tender leaf (every plant takes 1 gram) of the dead ears phenotypic mutation individual in the maturity period for taking step (1) to obtain, and using fast Fast extracting method extracts total DNA.

(3) Primary Location of WSP1 gene

For the genomic DNA obtained using step (2) as template, the Indel primer being respectively adopted in table 1 carries out PCR amplification, obtains To pcr amplification product, pcr amplification product is dyed through the separation of 4% agarose gel electrophoresis and Ethidum Eremide, is produced according to PCR amplification The polymorphism of object, by WSP1 Primary Location between two Indel labels of Indel1 and Indel2 (as shown in Figure 2 A).

(4) finely positioning of WSP1 gene

Choose F₂810 plants of recessive individuals in group, further design Indel label on the basis of first positioning, finally will WSP1 is accurately located within the scope of 30-30123bp, as shown in Figure 2 A.

(5) acquisition of WSP1 gene

According to the Primary Location of above-mentioned steps (4) as a result, according to Rice Automated within the scope of 30-30123bp The prediction of Annotation System (http://RiceGAAS.dna.affrc.go.jp), discovery share 5 in this section A candidate gene and the sequencing primer (table 1) for devising each gene.

Table 1, primer sequence

Respectively using the genomic DNA of dead ears mutant wsp1 and wild rice (OryzasativaLcv.Nipponbare) as template, using in table 2 Primer carries out PCR amplification, obtains pcr amplification product, and carry out sequencing analysis to pcr amplification product.As a result, it has been found that: with wild type Rice (OryzasativaLcv.Nipponbare) is compared, and dead ears mutant wsp1 is only in the 1312nd nucleosides of the 3rd exon of a certain candidate gene Acid (the 479th nucleotide that the mutational site is sequence 1) mutates, and sports A by T, remaining sequence and wild type Japan Fine whole is identical, which makes the 160th L-Leu (Leu) of sequence 2 sport histidine (His).This result is repeated Verifying, it is found that above-mentioned mutation also occurs for other dead ears mutant wsp1.The candidate gene of above-mentioned mutation is named as Sequence 1 (the 479th nucleotide that mutational site is sequence 1) in WSP1 gene, nucleotide sequence such as sequence table, which compiles The amino acid sequence of the protein of code is as shown in sequence 2 in sequence table.

Table 2, primer sequence

Primer	Sequence
		1F	CCTCTCCTCCCCTTCTCTTC
1R	TTGGCACCCATTTATATCCA
		2F	GCATATGTTGAATGCCCGTA
2R	GCATCTAGCCAGTTGCAGGT

The acquisition and phenotypic evaluation of embodiment 2, complementary plant

One, the acquisition of complementary plant

1, the building of complementing vector pCAMBIA2300-WSP1

DNA molecular shown in sequence 3 in sequence table is inserted into pCAMBIA2300 carrier, and (purchase is in pCambia official net Stand, network address are as follows: http://www.cambia.org/daisy/cambia/585) PstI and EcoRI restriction enzyme site between, obtain Complementing vector pCAMBIA2300-WSP1.And complementing vector pCAMBIA2300-WSP1 is sequenced.

Sequencing result shows: complementing vector pCAMBIA2300-WSP1 is to insert DNA molecular shown in sequence 3 in sequence table Enter between PstI the and EcoRI restriction enzyme site of pCAMBIA2300, and the other sequences of pCAMBIA2300 carrier is kept not become The carrier (Fig. 3 A) arrived.

2, the acquisition of recombinant bacterium

The complementing vector pCAMBIA2300-WSP1 that step 1 obtains is transferred to Agrobacterium EHA105 by the method to shock by electricity In (vast spirit biology, article No.: CCell32003), recombinant bacterium pCAMBIA2300-WSP1/EHA105 is obtained, is cured for rice transformation Wound.

3, it converts

By the seed of dead ears mutant wsp1 after induced medium culture 3 weeks (condition of culture: 32 DEG C of intensities of illumination 13230Lx), receptor of the eugonic wsp1 callus as conversion is selected.The recombinant bacterium pCAMBIA2300- obtained with step 2 WSP1/EHA105 infects wsp1 callus, 25 DEG C dark culture 3 days, then in the sieve containing 150mg/LG418 and 400mg/L carboxylic benzyl It selects and is cultivated on culture medium 2 weeks (condition of culture: 32 DEG C, intensity of illumination 13230Lx), will be polluted without Agrobacterium and have fresh callus long For breaking up culture (condition of culture: 32 DEG C, intensity of illumination 13230Lx), seedling to be differentiated is gone to and is taken root individual out After being cultivated 2 weeks or so on strong seedling culture base (condition of culture: 32 DEG C, intensity of illumination 13230Lx) turn field planting, obtain T₀In generation, turns WSP1 rice (complementary plant, cp).With primer SE-F (TTGACAGGGCTACCAGGTGTTCTATTTGAGC) and SE-R (CTCCGTTTCATATTATAAAACTTTC) Molecular Identification is carried out to complementary plant, qualification result is as shown in Figure 3 C: can from figure To find out: band of the wild rice with 230bp, purpose band of the dead ears mutant wsp1 with 201bp, and complementary plant The purpose band for being 201bp and 230bp with size.Illustrate that complementary plant is the dead ears mutant for successfully having imported WSP1 gene wsp1。

Two, the phenotype of complementary plant

The T that step 1 is obtained₀In generation, turns the leaf color of WSP1 rice (complementary plant, cp) and fringe color is observed.With wild Type and dead ears mutant wsp1 are control.

As a result as shown in Figure 3B: compared with dead ears mutant wsp1 of the same period, T₀In generation, turns leaf color, the fringe color of WSP1 rice Revert to normal green, and T₀Generation turn the leaf color of WSP1 rice, the leaf color of fringe color and wild rice (OryzasativaLcv.Nipponbare), fringe color without Significant difference.Illustrate leaf color and fringe color that overexpression of the WSP1 gene in dead ears mutant wsp1 makes dead ears mutant wsp1 Restore normal phenotype, further relating to WSP1 gene of the invention has the function of controlling rice leaf color and fringe color.It is following test into One step research WSP1 gene how adjusting and controlling rice leaf color and fringe color.

Three, the Contents of Photosynthetic Pigments measurement of complementary plant

1, the dead ears mutant of difference seedling taking phase (tri-leaf period (L3), four leaf stage (L4), tillering stage (FL) and maturity period (P)) Wsp1, the same blade tip (pale part) of complementary plant and wild rice (OryzasativaLcv.Nipponbare) and hypophyll (pale green part) Blade removes master pulse, is cut into the segment of 1cm or so, weighs 0.2g and is soaked in 10ml80% acetone soln, dark under the conditions of 26 DEG C Culture 48 hours.

2, using ultraviolet specrophotometer (DU800, BECKMAN COULTER) in tri- kinds of waves of 663nm, 645nm and 470nm The OD value for the chlorophyll a (Chl a) and chlorophyll b (Chl b) in blade that long lower determination step 1 obtains.Test 3 every time Then secondary repetition calculates the content of the chlorophyll a and chlorophyll b in each detection blade according to the method for Amon (1949), presses The content of chlorophyll a and chlorophyll b is calculated according to Wellburn (1994), calculation formula is as follows: chl a=(12.7 × OD₆₆₃? 2.69×OD₆₄₅)×V/W；Chl b=(22.9 × OD₆₄₅- 4.68 × OD₆₆₃)×V/W.Wherein: V is extracting liquid volume (10ml), W are leaf quality 0.2g, OD₆₆₃、OD₆₄₅And OD₄₇₀For the OD value read on spectrophotometer, unit: mg/ g。

As a result as shown in Figure 4: compared with wild rice, dead ears mutant wsp1 in seedling stage (tri-leaf period, four leaf stage), point The total content of the Chlorophyll-a Content in tiller phase and maturity period, content of chlorophyll b and chlorophyll a+b significantly reduces, and mutual after-culture Strain Chlorophyll-a Content, content of chlorophyll b and chlorophyll a+b total content and wild rice no significant difference.Illustrate dead ears The variation of blade and fringe portion caused by the WSP1 gene mutation of mutant wsp1 be due to caused by the missing of chlorophyll content, into And the chlorophyll content of plant can be regulated and controled by illustrating WSP1 gene.

Four, the Development of Chloroplasts of complementary plant

1, sample

Take white portion, pale green color part, complementary plant and the wild rice (day of the dead ears mutant wsp1 in tri-leaf period This is fine) blade, and the fritter for being cut into 0.5~1mm3 or so；

2, fixed

The sample blocks cut are put into 2ml centrifuge tube, 2.5% glutaraldehyde solution (PH=7.2) is added, is vacuumizing It is vacuumized in instrument until blade sinks completely.0.1M phosphoric acid rinses three times, and every 15min is primary, and 1% osmic acid is then added and fixes 2~3 hours, until sample blackening；

3, it is dehydrated

First successively be dehydrated with 50%, 70% and 90% ethanol solution, each concentration is handled 20 minutes, then with ethyl alcohol with Acetone (1:1) solution is handled 20 minutes, above to carry out in 4 degree of refrigerators, and sample pure acetone room temperature is finally handled 20 points Clock；

4, it permeates

Sample is acted on 4 hours in anhydrous propanone and embedding medium (3:1) mixed liquor, then in anhydrous propanone and embedding medium (1:1) mixed liquor is handled 3 hours, is finally acted on 12 hours in pure embedding medium；

5, it embeds

The product of above-mentioned steps 4 is transferred in embedded box, 37 DEG C overnight, then handles 12 hours, last 60 DEG C for 45 DEG C Processing 24 hours obtains embedded samples；

6, it is sliced, takes pictures

Embedded samples that step 5 obtains are cut into the superthin section of 60-70nm or so with ultramicrotome, then use slice Lead citrate solution dyes 10 minutes, then has acetic acid uranium solution to dye 30 minutes, and distilled water cleaning is dried afterwards three times, uses Hitachi H-7650 type transmission electron microscope observing and select clearly multiple take pictures.

As a result as shown in Figure 5: it can be seen from the figure that the mesophyll cell Chloroplast number of wild rice blade compared with More, chloroplast structure is complete, and basal granule arranges close (Fig. 5 A and Fig. 5 B) in chloroplaset, the green portion of dead ears mutant wsp1 Electronic Speculum result is similar to wild rice (Fig. 5 E), and compared with wild rice, the white portion of dead ears mutant wsp1 Only a small number of chloroplasets, basal granule number are reduced in mesophyll cell, and basal granule stacking number is reduced, or even missing (Fig. 5 C and Fig. 5 D), And the chloroplast structure and wild rice no significant difference of complementary plant.Illustrate the WSP1 gene mutation of dead ears mutant wsp1 Dead ears mutant wsp1 Chloroplast structural damage is caused, the chloroplaset hair of plant can be regulated and controled by further relating to WSP1 gene It educates.

It is above-mentioned experiments have shown that: WSP1 gene can regulate and control the development of the chlorophyll content and chloroplaset of plant, and then regulate and control The photosynthetic efficiency of plant.

Claims

1. following any application in regulation plant leaf color and/or fringe color；

1) protein, amino acid sequence are protein shown in sequence 2 in sequence table；

2) coding 1) described in protein nucleic acid molecules, coded sequence is the cDNA molecule or DNA point of sequence 1 in sequence table Son；

3) contain the recombinant vector of the 2) nucleic acid molecules；

The plant is rice dead ears mutantwsp1；

The regulation plant leaf color and/or fringe color are embodied by regulation chlorophyll content of plant and/or Development of Chloroplasts.

2. application according to claim 1, it is characterised in that:

The chlorophyll is chlorophyll a, chlorophyll b, chlorophyll a+b or any of the above combination.

3. protein described in claim 1 is cultivating the application in the genetically modified plants that photosynthetic efficiency improves；

The photosynthetic efficiency improves the leaf color for being embodied in genetically modified plants and/or fringe discoloration is green；

The plant is rice dead ears mutantwsp1。

4. a kind of method for cultivating the genetically modified plants that photosynthetic efficiency improves, including by albumen described in claim 1 The step of encoding gene of matter imports in recipient plant, obtains genetically modified plants；The photosynthetic efficiency of the genetically modified plants Higher than the recipient plant；

The recipient plant is rice dead ears mutantwsp1。

5. according to the method described in claim 4, it is characterized by: the nucleotide sequence of the encoding gene of the protein is sequence DNA molecular shown in sequence 1 in list；

At least one of the photosynthetic efficiency of the genetically modified plants is higher than the recipient plant and is embodied in following 1) -8):