CN105315376B - Single-chain antibody, its encoding gene and the application that collagen specificity combines - Google Patents

Abstract

The invention discloses single-chain antibody, its encoding gene and applications that a kind of collagen specificity combines.In a preferred embodiment, which, which is mainly merged by collagen specificity combination peptide C BD with the functional areas scFv of Cetuximab (cetuximab), forms.Further, the single-chain antibody that the collagen specificity combines is to be encoded to be formed as the gene with sequence shown in SEQ ID NO:1.The present invention is merged collagen combined area CBD polypeptide with the functional areas scFv of Cetuximab by gene engineering method, and preferably by yeast expression system, it is proved through experiment in vitro and experiment in vivo, CBD-scFv can be in conjunction with collagen mechanism characteristics, and maintain the EGFR binding ability of cetuximab and tumor cell surface, there is good fragmentation effect to tumour in vitro, CBD-scFv can be with the tumour happening part aggregation in collagen enrichment of targeting in vivo, and it can be targeted to tumor locus faster relative to full length antibody, there is applications well prospect in neoplasm targeted therapy and load medicine field.

Description

Single-chain antibody, its encoding gene and the application that collagen specificity combines

Technical field

It is the present invention relates to a kind of therapeutic antibodies, in particular to a kind of single-stranded anti-with collagen specificity binding ability Body, preparation method and the application in oncotherapy.

Background technique

Collagen is the main component of extracellular matrix, and about 30% is all collagen component, collagen in animal body Albumen plays an important role during the adherency of cell, migration, differentiation, proliferation etc., a large number of studies show that, in tumour cell The position of generation is overexpressed relative to normal tissue collagen, and collagen is tumour in the generation and transfer process of tumour Cell provides signal transduction, physical support etc..Currently, for tumor cell surface target spot drug be more and more found and Research, and the fragmentation effect of good tumour cell is obtained in vitro experiment, but in vivo since tumour is thin in test The extracellular matrix that cellular surface is overexpressed forms the microenvironment of protection tumour cell, plays protective effect to tumor tissues. Extracellular matrix becomes the obstacle that tumour medicine reaches tumor tissues, greatly reduces antibody drug or chemicals are reached and swollen The speed and concentration of tumor tissue, reduce drug effect.For example, collagen becomes drug as the main component of extracellular matrix A barrier of tumor locus is reached, still, while collagen also becomes neoplasm targeted therapy and prepares targeted delivery medicine The important novel targets of object carrier.

In order to improve drug in the concentration of tumor tissues, two methods are generally used, wherein first method is: logical first The degradation using the drug promotion tumor locus collagen for promoting collagen degradation is crossed, and then is carried out using the drug for tumour Treatment.Although the confirmation of this method be it is effective, targeting is lower, and use scope has limitation；Second method It is to use the antibody and the either medicine of the albumen with oncotherapy effect for extracellular matrix using more method at present Object using gene engineering method be transformed or be chemically crosslinked after, using the specific binding targeted delivery of drugs to tumour of antibody outside Matrix forms the microenvironment of killing tumor cell.But when using antibody molecule targeting therapy on tumor, due to antibody molecule amount Larger, the collagen of overexpression causes tumor tissues internal pressure higher, while solid tumor internal blood vessel is less, and antibody drug compound is worn It is slower that saturating blood vessel reaches inside tumor speed, it is difficult to play the effect of effectively killing tumour；And due to cycle period in vivo It is longer, biggish immune response is easily caused, side effect is obvious.

The appearance of targeted polypeptide compensates for the shortcomings that antibody molecule is as targeted therapy, peptide molecule molecular weight well Smaller, structure is easily obtained simply by chemical synthesis, amino acid sequence is easy to analysis and greatly reduces immunogenicity, and group The albumen or antibody that penetrating power is knitted relative to macromolecule are many fastly.Therefore, targeted polypeptide and therapeutic medicine are utilized Object is combined into the new method of targeting therapy on tumor or cell imaging, in clinic first target polypeptide since the eighties It uses, by the end of having there is more than 50 kinds of target polypeptides to go through clinical use at present, more than 500 kinds of target polypeptides are in preclinical study Stage.Cetuximab (cetuximab, commodity Erbitux) is the mosaic type IgG of anti-human epidermal growth factor (EGFR)₁It is single Clonal antibody is the anti-EFGR antibody of monoclonal that mouse people is fitted into, there are the glycosylation site of two N- connections on two heavy chains, For molecular weight in 152kD or so, it can be in conjunction with EGFR receptor extracellular domain high-affinity, thus competitive antagonism ligand and EGFR Combination, close the combination of receptor and ligand to play the activation for the EGFR tyrosine kinase for inhibiting ligand-mediated, test table Bright, a variety of accesses for having EGFR signal to mediate are blocked in tumour cell or tumor microenvironment, it is in 2004 by the U.S. Food and Drug Admistraton's approval is using the treatment carcinoma of the rectum, and approval is for treating head and neck neoplasm within 2006.But such overall length is anti- Body is larger because of molecular weight, it is more difficult to overcome tumour internal pressure, the speed for penetrating blood vessel arrival tumor locus is slower, simultaneously because overall length is anti- Cycle period is longer in vivo for body, easily causes biggish immune response, and side effect is obvious；These factors greatly reduce entirely The therapeutic effect of long antibody.

Summary of the invention

In view of the deficiencies of the prior art, the main purpose of the present invention is to provide a kind of the single-stranded anti-of collagen specificity combination Body is mainly merged with the functional areas scFv of Cetuximab by collagen specificity combination peptide C BD and is formed.

Among one more specifically embodiment, the single-chain antibody (CBD-scFv) that the collagen specificity combines is by having There is the gene of sequence shown in SEQ ID NO:1 to encode to be formed.

The present invention also provides the genes to encode the single-chain antibody that the collagen specificity combines.

Among one more specifically embodiment, the gene has sequence shown in SEQ ID NO:1.

The purposes of the single-chain antibody and its encoding gene that are combined the present invention also provides the collagen specificity.

For example, the present invention provides one kind containing to encode collagen specificity combination as one of application scheme therein Single-chain antibody gene expression cassette, recombinant vector, recombinant bacterium or transgenic cell line.

In another example the present invention provides the single-chain antibodies that the collagen specificity combines as one of application scheme therein In preparing the application in product, and the product at least has one of following function: detection tumour cell, auxiliary identification Tumour cell, prevention and/or treatment tumour, the disease that prevention and/or treatment are induced by tumour cell.

In another example the present invention provides a kind of drugs, and it includes the collagen specificities as one of application scheme therein In conjunction with single-chain antibody.

In another example the present invention provides a kind of for preventing or treating the medicine of tumour as one of application scheme therein Compositions, it includes single-chain antibodies and pharmaceutically acceptable carrier, diluent or excipient that the collagen specificity combines.

Compared with prior art, the invention has the advantages that using yeast expression system, by gene engineering method by glue The functional areas scFv of former combined area (CBD, Collagen binding domain) polypeptide and Cetuximab (cetuximab) (single-chain antibody fragment) amalgamation and expression, the CBD-scFv of acquisition supernatant table in yeast expression system It reaches, and is proved by experiment in vitro and experiment in vivo, CBD-scFv can be specifically bound with collagen, and be remained The EGFR binding ability of cetuximab and tumor cell surface and inhibiting effect to growth of tumour cell, in vivo CBD- ScFv can be assembled with the tumour happening part in collagen enrichment of targeting, and can be more relative to full length antibody cetuximab Fast is targeted to tumor locus, has applications well prospect in neoplasm targeted therapy and load medicine field.

Detailed description of the invention

Fig. 1 is the gene cloning of CBD-scFv and NAT-scFv and the electrophoretogram of plasmid linearization, wherein 1 is NAT- ScFv, 2 be CBD-scFv, and 3 be pPICZ α-CBD-scFv, and 4 be pPICZ α-NAT-scFv；

Fig. 2 a is the forming types figure of CBD-scFv；

Fig. 2 b is polyacrylamide gel electrophoresis (SDS-PAGE) figure of CBD-scFv and NAT-scFv after purification；

Fig. 2 c is the combination releasing curve diagram of CBD-scFv and NAT-scFv and collagen；

Fig. 3 a is that the fluorescence of the specific binding of the EGFR receptor of CBD-scFv and NAT-scFv and A431 cell surface is aobvious Micro mirror photo；

Fig. 3 b is the flow cytomery curve graph of the combination of CBD-scFv and NAT-scFv and EGFR, wherein solid line generation Table negative control, dotted line represent test group；

Fig. 4 is the curve graph that mtt assay detection CBD-scFv and NAT-scFv influences A431 tumor cell proliferation；

Fig. 5 a is the flow cytomery figure of CBD-scFv and NAT-scFv to A431 apoptosis of tumor cells；

Fig. 5 b is the statistical chart of CBD-scFv and NAT-scFv to the flow cytomery of A431 apoptosis of tumor cells；

Fig. 6 a Fig. 6 b is H&E the and Masson stained photographs of tumor tissues respectively；

Fig. 7 is the song retained with flow cytometry analysis CBD-scFv, NAT-scFv and western appropriate former times in A431 tumor locus Line chart；

Fig. 8 a is CBD-scFv, NAT-scFv and the immunofluorescence photograph that western appropriate former times retains in A431 tumor locus；

The fluorescence for the immunofluorescence photograph that Fig. 8 b is CBD-scFv, NAT-scFv and western appropriate former times retains in A431 tumor locus Average optical density value/area statistics figure；

Fig. 9 a is tumor Volume Changes figure after CBD-scFv, NAT-scFv and western appropriate former times treatment four weeks；

Fig. 9 b is the final knurl weight figure of tumour after CBD-scFv, NAT-scFv and western appropriate former times treatment four weeks；

Figure 10 a is that the immunofluorescence dyeing of the tumor tissues after CBD-scFv, NAT-scFv and western appropriate former times treatment four weeks shines Piece；

Figure 10 b is the immunofluorescence dyeing of the tumor tissues after CBD-scFv, NAT-scFv and western appropriate former times treatment four weeks Average optical density value/area statistical chart.

Specific embodiment

As previously mentioned, inventor is studied for a long period of time and largely practiced in view of the prior art there are many defects, prepare A kind of single-chain antibody (CBD-scFv) combined with collagen specificity, wherein using collagen specificity combination peptide C BD with treat Property antibody functional areas, such as the functional areas the scFv amalgamation and expression of cetuximab, and preferably successfully being obtained using yeast expression system CBD-scFv fusion antibody segment was obtained, which all has good collagen specificity binding ability in vitro and in vivo, And maintain with the binding ability of EGFR and antitumor activity, CBD-scFv can be cracking rich in tumour happening part Collection plays lethal effect to tumour cell.

More detailed explanation is made to technical solution of the present invention below in conjunction with attached drawing and preferred embodiment.

1, high efficient expression and purifying of the CBD-scFv in saccharomycete

I, the building of CBD-scFv expression vector

The V of CBD-scFv antibody_LAnd V_HChain is synthesized by Suzhou Jin Wei intelligence Biotechnology Co., Ltd.Then, it utilizes Overlap PCR is by CBD (TKKTLRT), V_LAnd V_HIt is spliced into CBD-scFv chain, the order of connection is as follows: XhoI+CBD+linker+ V_L+linker+V_H+NotI.Further, the coding gene sequence (SEQ ID NO:1) of CBD-scFv is as follows:

CTCGAGAAGAGAGAGGCTGAAGCAACCAAGAAGACCTTACGCACAAGCGGTGGCGGTGGCAGCGGCGG CGGCGGCAGTGGTGGTGGCGGTGATATCTTACTGACACAGAGCCCGGTGATCCTGAGCGTTAGTCCTGGTGAGCGC GTGAGCTTCAGCTGCCGTGCCAGCCAGAGCATCGGCACCAACATCCACTGGTACCAACAGCGCACAAACGGCAGTC CGCGCCTGCTGATCAAGTATGCAAGCGAGAGCATCAGCGGCATCCCGAGCCGTTTTAGCGGTAGCGGCAGCGGCAC CGACTTTACCCTGAGCATCAACAGCGTGGAGAGCGAGGACATCGCCGACTACTACTGCCAGCAGAACAATAACTGG CCGACCACCTTCGGTGCGGGCACCAAACTGGAGCTGAAAAGTGGCGGTGGTGGTAGTGGCGGTGGCGGTAGCGGTG GCGGCGGTCAGGTGCAGCTGAAACAGAGCGGTCCGGGTCTGGTGCAGCCGAGTCAGAGTCTGAGCATCACCTGCAC CGTTAGCGGCTTCAGCCTGACCAACTATGGTGTGCACTGGGTTCGCCAGAGTCCTGGCAAAGGCCTGGAGTGGCTG GGCGTTATCTGGAGCGGCGGTAACACCGACTACAACACCCCGTTCACCAGCCGCCTGAGTATCAACAAGGACAACA GCAAAAGTCAAGTGTTTTTCAAGATGAACAGCCTGCAGAGCAACGACACCGCAATCTACTATTGTGCCCGCGCACT GACCTACTACGACTACGAGTTCGCCTACTGGGGTCAGGGTACACTGGTGACCGTGAGTGCAGCGGCCGC。

CBD-scFv is put into pPICZ α-B (Invitrogen) by double digestion, connection product converts Escherichia coli, applies The positive bacterium colony for being distributed in LB less salt plate (50 μ g/mL Zeocin) acquisition is correct by sequencing confirmation clone, identifies correct matter Grain extracting plasmid (refering to fig. 1).

Conversion, identification and the screening of ii, CBD-scFv expression vector

According to the operation manual (Invitrogen, Catalog no.V175-20) of Invitrogen, prepare saccharomycete GS115 is linearized 10 μ g pPICZ α-B-CBD-scFv (please continue to refer to Fig. 1), according to Yeast expression using SacI Operation manual (Invitrogen) prepares the saccharomycete GS115 of logarithmic phase growth, will using the method (Bio-Rad) of electrotransformation PPICZ α-the B-CBD-scFv of linearisation is transformed into saccharomycete, and conversion fluid is laid on YPDS agar plate culture medium (1% ferment Female extract, 2% peptone, 2% glucose, 1M sorbierite, 2% agar, 100 μ g/mL Zeocin antibiotic), pPICZ α-B Empty plasmid is linearized using same procedure, and transformed yeast bacterium is as empty map.30 DEG C of inversions are cultivated 5-6 days, until long on plate The visible colony clone of size out, by the bacterium colony of normal growth on YPDS plate, using universal primer:

5 ' AOX1 (5 '-GACTGGTTCCAATTGACAAGC), and,

3 ' AOX1 (5 '-GCAAATGGCATTCTGACATCC) are identified, in the YPDS plate containing Zeocin antibiotic Upper normal growth simultaneously identifies the bacterium colony for determining the positive labeled as Mut+ by PCR.

Iii, CBD-scFv antibody fragment are expressed and are purified in saccharomycete

Picking be labeled as Mut+ single colonie, be placed in equipped with 50mL BMGY proliferated culture medium (1% yeast extract, 2% Peptone, 100mM kaliumphosphate buffer pH 6.0,1.34% yeast is without nitrogen source medium, and 4 × 10^-5% biotin, 1% glycerol) 500mL shaking flask in, cultivate in 28-30 DEG C/250-300rpm to OD₆₀₀=2-6 (16-18h), 1500g is centrifuged at room temperature 5min collects thallus, and thallus is resuspended with BMMY induced medium (BMGY is added 0.5% methanol and substitutes glycerol), makes OD₆₀₀=1.0 Left and right (about 100-200mL)；Resulting bacterium solution is placed in the shaking flask of 1L, is sealed with double gauze or garrha, is placed in 28- Continue to cultivate on the shaking table of 30 DEG C/250-300rpm, every anhydrous methanol that adds into culture medium for 24 hours is to final concentration 0.5%.Often 1mL is taken to be placed in 1.5mL EP pipe for 24 hours, maximum (top) speed is centrifuged 2~3min, collects supernatant thallus respectively, and SDS-PAGE is determined The best harvest time of expression quantity and bacterium solution of destination protein.Molecular weight of albumen: 30kD or so determines the higher strain-of expression quantity 80 DEG C of preservation strains, using above method great expression, bacterium solution 8000g after expression, 4 DEG C of high speed centrifugation 20min, the bacterium solution of collection After 0.22 μm of membrane filtration of supernatant, suitable volumes are concentrated to molecular weight 10kD Millipore Pellicon ultrafiltration membrane stack, it will Supernatant of bacteria solution carries out dialysis in 20mM sodium phosphate buffer (PH=8.0) plus 0.5M NaCl, passes through AKTA prime plus 5.0 System is purified using nickel column affinity column (His-Trap affinity columns, GE).Using SDS-PAGE to the antibody of purifying Purity analysis, 0.22 μm of filter membrane degerming after protein concentration are carried out, packing freezes -80 DEG C, and (the green skies are public using BCA kit Department) to antibody determination concentration after purification.It can know, expressing quantity is 2mg/L or so.It is prepared simultaneously using same method ScFv fragment label without containing CBD is NAT-scFv.The antibody purity prepared as shown in Figure 2 b is 90% or more.

2, the external Function Identification of CBD-scFv antibody fragment

1., the specific binding of CBD-scFv and collagen

Firstly, being coated with 96 orifice plates using 100 μ L collagens (100 μ g/mL), 4 DEG C overnight, are absorbed extra collagen solution, in advance Cold PBS is washed 3 times, is then dried in super-clean bench.CBD-scFv and NAT-scFv is added according to 0 μM to 10 μM of the every hole of concentration gradient Enter 100 μ L, 4 DEG C of overnight incubations, next day sucks excess protein, using pre-cooling PBS lotion 5 times, washes away the albumen being not bound with, so Anti-polyhistidine antibody (1:2000, Sigma) 100 μ L is added afterwards, 4 DEG C of incubation 2h, then PBS is added after washing 5 times Anti-mouse IgG-HRP (1:2000, Sigma), which is protected from light, is incubated for 30min, and after PBS washes 5 times, 100 μ L TMB reaction is added 30min is eventually adding 1M H₂SO₄Reaction is terminated, detects absorbance using spectrophotometer 450nm.As a result GraphPad is used The analysis of 5.0 software of Prism, draws and combines dissociation curve.The Kd value of the binding ability of NAT-scFv and CBD-scFv and collagen is 1.58 μM and 0.21 μM (Fig. 2 c), Kd value is inversely proportional with binding ability, therefore the ability of CBD-scFv and collagen ratio NAT-scFv It is eager to excel, the specific bond ability with collagen, test result shows that the amalgamation and expression mode of CBD polypeptide and scFv do not influence The specific bond of CBD and collagen binding site.

2., the specific bond of the EGFR receptor of CBD-scFv antibody fragment and A431 cell surface

By 1 × 10⁵A431 cell inoculation is in 48 orifice plates, 37 DEG C, 5%CO₂It is incubated overnight, after cell is adherent, discards supernatant Culture medium, PBS are washed 3 times, are added each 100 μ L of CBD-scFv and NAT-scFv (1 μ g/mL), and 4 DEG C of incubation 1h, PBS wash 5 times, then Anti-His mAb (1:2000, Sigma) 100 μ L is added, 4 DEG C of incubation 2h, then anti-mouse is added after washing 5 times in PBS IgG₁- FITC (1:2000, Sigma), which is protected from light, is incubated for 30min.Then after PBS washes 5 times, it is anti-that the western appropriate former times (1 μ g/mL) of 100 μ L is added For body as positive control, it is negative control that scFv group, which is not added, and fluorescence combination situation is observed at fluorescence microscope (NIKON).Knot Fruit shows, 1 μ g/mL CBD-scFv and NAT-scFv can in conjunction with the EGFR receptor of cell surface, fluorescence intensity with it is western appropriate Former times is similar (Fig. 3 a).

Further, the special knot of the EGFR receptor of CBD-scFv antibody and cell surface is analyzed by Flow Cytometry It closes, using 0.25% pancreatin by A431 cell dissociation, PBS is washed 3 times, and cell counting board counts, and then takes 1 × 10⁶A431 cell Respectively with 4 DEG C of incubation 1h of CBD-scFv and NAT-scFv of 100 μ L (1 μ g/mL), then be added anti-His mAb (1: 2000, Sigma) anti-mouse IgG is added in 100 μ L, 4 DEG C of incubation 2h after then PBS washes 5 times₁-FITC(1:2000, Sigma it) is protected from light and is incubated for 30min, after then PBS washes 5 times, 100 μ L western appropriate former times (1 μ g/mL) is added, and antibody is as positive control, no Adding scFv group is negative control, is analyzed using flow cytometer (C6, BD biosciences) the cell of processing.As a result Display: 1 μ g CBD-scFv and NAT-scFv can be completely combined with the EGFR receptor of cell surface, positive rate 100%, with sun Property the western appropriate former times Percentage bound of control it is similar (Fig. 3 b).

By fluorescence microscope and flow cytometry analysis it is found that CBD-scFv, NAT-scFv and western appropriate former times can be with The EGFR of A431 cell surface is combined, and after CBD-scFv amalgamation and expression, does not influence the position EGFR of scFv Yu A431 cell surface The binding function of point.

3., influence of the mtt assay detection CBD-scFv to A431 tumor cell proliferation

Influence using mtt assay detection CBD-scFv to A431 cell Proliferation, A431 cell is according to 1 × 10⁵It is seeded in 96 In orifice plate, after 2h, after cell is adherent, former culture medium is inhaled and is abandoned, fresh culture medium is added, is separately added into containing 0 μM, 10^-5μ M,10^-4μM,10^-3μM,10^-2μM,10^-1The culture medium of the CBD-scFv and NAT-scFv of μM various concentration, western appropriate former times group are made respectively For positive control, 5 repetitions of each concentration after culture 48 hours, are added 20 according to the every hole of MTT kit specification (the green skies) μ L 5mg/mL MTT, 37 DEG C are continued to cultivate 4h, discard culture medium, 200 μ L DMSO, shaking table 100rpm are added concussion 10 minutes, Using spectrophotometer detect 490nm absorbance, as a result using 5.0 software of GraphPad Prism analyze, MTT the results show that CBD-scFv and NAT-scFv can inhibit the proliferation of A431 tumour cell in vitro, and inhibiting rate is similar with western appropriate former times.IC₅₀About It is 10^-3μM (Fig. 4)

4., analysis of the CBD-scFv to A431 apoptosis of tumor cells

CBD-scFv uses Annexin V-FITC Apoptosis Detection Kit to A431 apoptosis of tumor cells (Cat.No556571) it is analyzed, is operated to specifications as follows: by cell according to 5 × 10⁵The density of a cell/mL is planted In the culture dish of 10-cm, 37 DEG C, 5%CO₂It is incubated overnight, after cell is adherent, is added and contains 0.1 μM of CBD-scFv and NAT- The culture medium of scFv continues culture 48 hours, then digests cell using 0.25% pancreatin, the PBS of pre-cooling washes 3 times, cell After counting, cell density is adjusted are as follows: 1 × 10⁶Cell/mL takes 100 μ L to be transferred in 5mL centrifuge tube, and 5 μ L Annexin are added V and 10 μ L PI mediates and mixes, and room temperature, which is protected from light, is incubated for 15min, 400 μ L 1 × Binding Buffer is then added, streaming is thin Born of the same parents' instrument is analyzed as a result, western appropriate former times group is as positive control, and all processing are repeated 5 times.The results show that CBD-scFv and NAT- ScFv can cause Apoptosis, and based on early apoptosis, apoptosis rate is slightly weaker than western appropriate former times.It is respectively as follows: 28.9% ± 10.1% and 29.5% ± 12.3% (Fig. 5 a- Fig. 5 b).

3, Function Identification of the CBD-scFv antibody fragment in A431 animal model for tumour

I, the foundation of A431 tumour cell animal model

Nude BALB/c mice (nu/nu) is bought from Nanjing Si Kerui Company of Animals Ltd., and all animals are all made of 6-8 The female mice of week old, original body mass 18-20g, all animals propose the last week order, and raising under new environment makes it suitable for one week Feeding environment is answered, the A431 cell of culture is digested in convergence degree 80% or so using 0.25% pancreatin, and PBS washes 3 times, finally It is resuspended using PBS, cell counting board counts, and every nude mice plants 5 × 10 at the back of right lower extremity using subcutaneous injection⁶A A431 Cell/200 μ L starts GP TH after 10 days when tumor size diameter 8mm or so.

II, the Masson dyeing of the collagen enrichment of tumor locus

4% paraformaldehyde fixes 30min after tumor tissues are drawn materials, and then by organization embedding in paraffin, 4 μm of slices make Tissue staining is carried out with Masson ' s staining kit (Beijing Suo Laibao Science and Technology Ltd), tissue section strain is as the result is shown There are a large amount of collagens (Fig. 6 a- Fig. 6 b) in tumor extracellular matrix.The growth of tumour is characterized using H&E normal dyeing simultaneously State and extracellular matrix.

III, CBD-scFv is detected in the sustained release ability of tumour happening part

Reference literature reports that the dosage of western appropriate former times is once 1mg/450 μ L, is converted into same molar concentration, adopts respectively With intraperitoneal injection every group of same volume of injection 15 μM of CBD-scFv, NAT-scFv and PBS, then respectively in 2h, 12h, for 24 hours, The tumour of 5 mouse is removed and uses enzyme-free cell after shredding by 48h, 72h and 96h, 5 mouse of every group of materials Dissociation buffer (Life Technologies) and 0.03%collagenase (Life Technologies) Digestion, after the cell of digestion crosses 100 mesh filter screens, cell counting board is counted, and every group 1 × 10⁶A cell is immunized according to the following steps Fluorescent staining: being added anti-His mAb (1:2000, Sigma) 100 μ L, and 4 DEG C of incubation 2h, then PBS is washed 5 times, and anti-is added mouse IgG₁- FITC (1:2000, Sigma), which is protected from light, is incubated for 30min, and then PBS is washed 5 times, and 200 μ L PBS are added, and streaming is thin Born of the same parents' instrument is analyzed as a result, as the result is shown (Fig. 7), CBD-scFv and NAT-scFv can reach tumour than western appropriate former times faster Position, still, CBD-scFv are longer in tumor locus residence time since there are the structures of CBD, after 48h, NAT-scFv's Percentage bound only has 18.4%, and CBD-scFv group still has 56.8% in 48h, and positive rate and full length antibody western appropriate former times are closely similar, Meanwhile the tumour for selecting same time carries out frozen section, determines CBD-scFv, NAT-scFv and western appropriate former times by immunostaining It in whether retaining for tumor locus, is detected using the HIS label of albumen end, immunofluorescence dyeing CBD- as the result is shown The scFv retention time ratio NAT-scFv time is longer, similar (Fig. 8 a- Fig. 8 b) with western appropriate former times.Test result shows: CBD-scFv Target tumor tissue that can be special, and penetration power appropriate former times more western than full length antibody is fast, CBD increase scFv depositing in vivo The time is stayed, the targeting of scFv is effectively increased.

IV, CBD-scFv is evaluated in animal model for tumour Long-term therapy

In A431 animal model for tumour, when tumor size is in 8mm or so, by 15 μM of CBD-scFv, NAT-scFv, PBS and western appropriate former times treated mouse by the way of intraperitoneal injection every 2 days, and treatment cycle is 4 weeks, used every 2 days Vernier caliper records the diameter of tumour, according to: V=1/6 × long diameter × (short diameter)²Gross tumor volume is calculated, and is weighed most Whole tumor weight (Fig. 9 a- Fig. 9 b), CBD-scFv final tumor size are as follows: 1231.67 ± 46.59mm³, NAT-scFv is final Tumor size are as follows: 2033.58 ± 39.17mm³, and the final tumor size of control group are as follows: 2490.49 ± 99.67mm³；To corresponding Tumor tissues carry out frozen section, using CD31 (sc-53411, SANTA CRUZ), MIB-1 (sc-101861, SANTA CRUZ) and TUNEL (the green skies) carries out immunofluorescence colour developing respectively, evaluates CBD-scFv, NAT-scFv, PBS and western appropriate former times pair The therapeutic effect of tumour.Test result shows (Figure 10 a- Figure 10 b): for tumour after treatment in 4 weeks, CBD-scFv can obviously inhibit swollen The growth of tumor, blood vessel CD31 dyeing and cell Proliferation original Ki67 dyeing show that CBD-scFv is substantially less than NAT-scFv group, TUNEL Dyeing display CBD-scFv group apoptosis rate is significantly higher than NAT-scFv.Test result shows: CBD-scFv in vivo can be effective It is targeted to tumour happening part, inhibits tumor proliferation, causes the apoptosis of tumour cell, and similar with western appropriate former times function.

In conclusion the present invention is a kind of with collagen specificity binding ability using yeast expression system successful expression CBD-EGFR-scFv antibody fragment shows higher collagen specificity binding ability in test in vitro and in vivo, and More stronger than the penetration capacity of full length antibody in vivo experiment since molecular weight is smaller, targeting is more preferable, in animal model for tumour In show good antitumous effect, neoplasm targeted therapy and carry medicine field have applications well prospect.

It should be noted that, in this document, the terms "include", "comprise" or its any other variant are intended to non-row His property includes, so that the process, method, article or equipment for including a series of elements not only includes those elements, and And further include other elements that are not explicitly listed, or further include for this process, method, article or equipment intrinsic want Element.

It should be pointed out that the above is only a specific embodiment of the invention, for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.

<110>Suzhou Institute of Nano-tech. and Nano-bionics, Chinese Academy of Sciences

<120>single-chain antibody, its encoding gene and application that collagen specificity combines

<160> 3

<210> 1

<211> 821

<212> DNA

<213>artificial sequence

<400> 1

CTCGAGAAGAGAGAGGCTGAAGCAACCAAGAAGACCTTACGCACAAGCGGTGGCGGTGGCAGCGGCGGC GGCGGCAGTGGTGGTGGCGGTGATATCTTACTGACACAGAGCCCGGTGATCCTGAGCGTTAGTCCTGGTGAGCGCGT GAGCTTCAGCTGCCGTGCCAGCCAGAGCATCGGCACCAACATCCACTGGTACCAACAGCGCACAAACGGCAGTCCGC GCCTGCTGATCAAGTATGCAAGCGAGAGCATCAGCGGCATCCCGAGCCGTTTTAGCGGTAGCGGCAGCGGCACCGAC TTTACCCTGAGCATCAACAGCGTGGAGAGCGAGGACATCGCCGACTACTACTGCCAGCAGAACAATAACTGGCCGAC CACCTTCGGTGCGGGCACCAAACTGGAGCTGAAAAGTGGCGGTGGTGGTAGTGGCGGTGGCGGTAGCGGTGGCGGCG GTCAGGTGCAGCTGAAACAGAGCGGTCCGGGTCTGGTGCAGCCGAGTCAGAGTCTGAGCATCACCTGCACCGTTAGC GGCTTCAGCCTGACCAACTATGGTGTGCACTGGGTTCGCCAGAGTCCTGGCAAAGGCCTGGAGTGGCTGGGCGTTAT CTGGAGCGGCGGTAACACCGACTACAACACCCCGTTCACCAGCCGCCTGAGTATCAACAAGGACAACAGCAAAAGTC AAGTGTTTTTCAAGATGAACAGCCTGCAGAGCAACGACACCGCAATCTACTATTGTGCCCGCGCACTGACCTACTAC GACTACGAGTTCGCCTACTGGGGTCAGGGTACACTGGTGACCGTGAGTGCAGCGGCCGC

<210> 2

<211> 21

<212> DNA

<213>artificial sequence

<400> 2

GACTGGTTCCAATTGACAAGC

<210> 3

<211> 21

<212> DNA

<213>artificial sequence

<400> 3

GCAAATGGCATTCTGACATCC

Claims (8)

1. the single-chain antibody that a kind of collagen specificity combines, it is characterised in that mainly by collagen specificity combination polypeptide and Cetuximab The functional areas scFv merge to be formed, the collagen specificity combination polypeptide have collagen combined area.

2. the single-chain antibody that collagen specificity according to claim 1 combines, it is characterised in that: what the collagen specificity combined Single-chain antibody is to be encoded to be formed as sequence gene as shown in SEQ ID NO:1.

3. the gene to the single-chain antibody for encoding the combination of collagen specificity described in any one of claim 1-2.

4. gene according to claim 3, it is characterised in that: the sequence of the gene is as shown in SEQ ID NO:1.

5. a kind of expression cassette containing gene described in any one of claim 3-4, recombinant vector, recombinant bacterium or transgenic cell System.

6. the single-chain antibody that collagen specificity described in any one of claim 1-2 combines is in preparing the application in product, the production Product at least have one of following function: detection tumour cell, auxiliary identification tumour cell, prevention and/or treatment tumour, in advance The disease that anti-and/or treatment is induced by tumour cell.

7. a kind of drug, it is characterised in that the single-chain antibody combined comprising collagen specificity described in any one of claim 1-2.

8. a kind of for preventing or treating the pharmaceutical composition of tumour, it is characterised in that include any one of claim 1-2 institute State the single-chain antibody and pharmaceutically acceptable carrier, diluent or excipient of collagen specificity combination.