CN105296632A - Method for detecting EGFRvIII in tumor tissues - Google Patents

Abstract

The invention discloses a method for detecting EGFRvIII in tumor tissues. According to the method, a target gene sequence needing to be detected first undergoes sequence scanning by utilizing a written sequence analysis program, primer selection is performed, so as to design and obtain a nested PCR primer, then tumor tissue RNA extraction and cDNA acquisition are performed, finally a nested PCR method is adopted to perform continuous two-round PCR amplification and then sequencing is performed on an amplification product, and the result is verified through sequence analysis. According to the method, the existence of the EGFRvIII in the malignant tumor tissues can be detected sensitively in a short time, and the good premise and basis are provided for targeted therapy. By adopting the nested PCR method, gene expression signals are amplified through two-round PCR amplification, so that the observed result is simpler, and the applicability of the method is further improved. The amplification product has specificity and guarantees high accuracy and sensitivity in PCR detection.

Description

A kind of method detecting EGFRvIII in tumor tissues

Technical field

The invention belongs to technical field of molecular biology, specifically, relate to a kind of method detecting EGFRvIII in tumor tissues.

Background technology

The health of the mankind in malignant tumour serious threat, and be one of focal disease of China and even whole world public relations, its sickness rate has the trend increased gradually.Oncology studies in recent years and clinical observation, find that environmental factors and personal behavior have important impact to the generation of human tumor and development.Increasing research shows: the environmental factors that nearly all malignant tumour all suffers with the external world is relevant.Various environmental factors causes the damage of organism genetic material in a different manner, the sudden change, restructuring etc. of such as gene, thus direct or indirect cause the activation of proto-oncogene or the inactivation of cancer suppressor gene, make cytopathy, immortalization, then create the generation of tumour.After all, tumour is a genoid disease.The immunotherapy that development in recent years is got up and cell therapy for be exactly the specific gene causing tumour to produce, carry out target and kill tumour cell.

Malignant tumour such as: the cell surface of glioma, mammary cancer, ovarian cancer, nonsmall-cell lung cancer etc. has the process LAN of EGF-R ELISA (EGFR) and the sudden change of gene or restructuring, and EGFRvIII(EGF-R ELISA type III mutant) be EGF-R ELISA (EGFR) modal mutant forms.EGFRvIII is the 2-7 exon part (801bp) that EGFR has lacked extracellular fragment, and 1 is directly connected with 8 exons, and defines a new glycine in junction.Comparatively EGFR wild-type, EGFRvIII has lacked the 6-273 amino-acid residue of extracellular fragment, i.e. the ligand binding domain of EGFR, and ligand binding of itself getting along well, can produce lasting phosphorylation, makes acceptor produce the stimulus signal continued.Research report in recent years, EGFRvIII is by promoting propagation, the migration and invasion of cell, and the death reducing cell promotes generation and the development of tumour.Meanwhile, EGFRvIII is only expressed in tumour cell, and does not report in normal cell, and this is also increasing immunotherapy in recent years take EGFRvIII as the major cause of target.

How to detect that the expression of each tumor tissues EGFRvIII is the key factor of target immunotherapy accurately and rapidly, Urogastron (EGF) is found so far from people such as Montalcini and Cohen in 1962, research about its Receptor EGFR and related mutation achieves important progress, and the qualification for EGFR and related mutants also continues into the present with the research of EGF.The method of main employing has the method for direct sequencing, real-time quantitative PCR and histogenic immunity group etc.These methods respectively have superiority, but complicated operation, length consuming time, cost are relatively large limits promoting the use of of these methods to a certain extent.

Summary of the invention

For the above-mentioned technical problem in correlation technique, the present invention proposes a kind of method detecting EGFRvIII in tumor tissues.

For realizing above-mentioned technical purpose, technical scheme of the present invention is achieved in that

Detect a method of EGFRvIII in tumor tissues, comprise the following steps:

1. pair EGFR, EGFRvIII gene order is analyzed: adopt the sequence analysis programs write to carry out base scanning one by one to the gene order before saltation zone, obtain the low repeatability region of 56-70 bit base;

2. design two specific forward primers for the low repeat region before saltation zone, sequence analysis software is utilized to carry out specific reverse primers design, and mated with the forward primer before saltation zone, the first round and second designed respectively across saltation zone takes turns specificity amplification primer;

3. the acquisition of detection template: adopt the method for RT-PCR to detect EGFRvIII expression conditions, sensitiveer, find out the change of EGFRvIII at expression level accurately, be conducive to carrying out specific targeted therapy to it, comprise:

1) extraction of tissue sample RNA: get the tissue sample that appropriate RNAlater preserves, extracts tissue sample RNA with reference to TRIzol cracking process;

2) obtain template cDNA: with tissue sample RNA for template, oligodT is that the reverse transcription that primer carries out RNA obtains tissue sample cDNA;

The detection of 4.EGFRvIII

Adopt the method for nest-type PRC to carry out continuous print two-wheeled PCR, specific detection EGFRvIII, at the expression of tissue sample, comprising:

1) with step 3 obtain cDNA for template (with water belongs with yin contrast, blank is set, positive control), carry out first round amplification; With first round PCR primer for template, carry out second and take turns pcr amplification;

2) 1% sepharose direct-detection two-wheeled pcr amplification situation, and according to the tissue expression situation of EGFRvIII object fragment compared with the little 801bp of EGFR wild-type, direct vision EGFRvIII;

5. the sequence verification of detected result: cut glue and reclaim EGFRvIII object fragment, gene sequencing checking nest-type PRC detected result.

The present invention adopts the method for nest-type PRC to carry out the expression of EGFRvIII in test set tissue samples on the basis of RT-PCR and Standard PCR, nest-type PRC is based on Standard PCR, adopt first pair of primer amplification goal gene fragment, the product of second couple of primer specificity amplification first round PCR.Because second pair of primer is positioned at the inside of first round PCR primer, and the probability that non-specific object fragment comprises the binding site of two pairs of primers is minimum, therefore, second pair of primer can not amplify non-specific object fragment, ensure that the second accuracy of taking turns PCR primer.Through the pcr amplification of two-wheeled, the low expressing gene in tissue sample amplifies through the signal of twice, directly can be separated intuitively by sepharose completely, further increase the suitability of method

Beneficial effect of the present invention: there is highly sensitive, that accuracy is high advantage for detection tumour cell EGFRvIII, and it is consuming time short, visual result, Sensitive Detection can go out the existence of EGFRvIII in malignant tumor tissue, at short notice for targeted therapy provides good prerequisite and basis.

Accompanying drawing explanation

In order to be illustrated more clearly in the embodiment of the present invention or technical scheme of the prior art, be briefly described to the accompanying drawing used required in embodiment below, apparently, accompanying drawing in the following describes is only some embodiments of the present invention, for those of ordinary skill in the art, under the prerequisite not paying creative work, other accompanying drawing can also be obtained according to these accompanying drawings.

Fig. 1 is that the GAPDH according to the embodiment of the present invention increases each tissue sample, and by 1% gel detection result, wherein, sample is from left to right followed successively by: the reference of Dl2000 standard and 1-21 sample;

Fig. 2 second takes turns pcr amplification product 1% gel detection result, and wherein, sample is from left to right followed successively by: the reference of Dl2000 standard, 1-21 sample, negative control sample and positive control sample;

Fig. 3 is the second backward sequencing analytical results of taking turns pcr amplification product, and wherein, F66-496.seq second takes turns pcr amplification product sequence, and EGFR-vIII.seq is EGFRvIII sequence, and Consensus.seq is consensus sequence.

Embodiment

Below in conjunction with accompanying drawing, be clearly and completely described the technical scheme of the embodiment of the present invention, obviously, described embodiment is only the present invention's part embodiment, instead of whole embodiments.

A kind of method detecting EGFRvIII in tumor tissues according to the embodiment of the present invention, comprises the following steps:

1.EGFRvIII gene sequencing and design of primers

Utilize the sequence analysis programs write to gene order (the GC content 71.6% before saltation zone, repetition rate is high) carry out base scanning one by one, obtain the low repeatability region of 56-70 bit base, sequence analysis software is utilized to design specific reverse primers, and with the forward primer F56(SEQIDNO:1 before saltation zone) and F66(SEQIDNO:3) to mate, NCBI primer search software is utilized to detect the specificity of each pairing primer in human genome, design show that the first round and second across saltation zone takes turns the reverse amplimer R796(SEQIDNO:2 of specificity respectively) and R496(SEQIDNO:4),

Table 1:PCR detects primer

2. the acquisition of detection template

The method many employings DNA having been reported PCR detection EGFR and mutant thereof directly increases, and owing to containing many introns, all can have a greatly reduced quality in specificity or accuracy.And genomic level cannot embody the expression of EGFRvIII, therefore, the EGFRvIII that we take expression level detects, and the expression of EGFRvIII in more intuitive and accurate detection tumor tissues, for the targeted therapy of malignant tumour lays the first stone.

1) extraction of tissue sample RNA, comprises the steps:

1.1) the choosing and prepare of tissue sample: the tumor tissues cut of performing the operation, margins of excision, chooses middle intact tissue block and is positioned within the shortest time in RNAlater and preserves at-80 DEG C, prevent RNA from degrading;

1.2) get 30mgRNAlater and preserve sample, add 1mlTRIzol and fully grind, make the abundant cracking of tissue block, add chloroform in the ratio of 200 μ l/mlTRIzol, fully shake mixing, 4 DEG C, centrifugal 15 minutes of 12000rpm;

1.3) upper strata aqueous phase is got centrifugal in another EP() in pipe, add equal-volume isopropanol precipitating RNA, 4 DEG C, centrifugal 10 minutes of 12000rpm, the RNA of collecting precipitation;

1.4) RNA obtained is precipitated with 75% ethanol purge, 4 DEG C, centrifugal 10 minutes of 12000rpm;

1.5) discard ethanol, treat ethanol volatilization totally, appropriate DEPC water dissolution tissue sample RNA;

2) acquisition of template cDNA, comprising:

2.1) tissue sample RNA concentration is accurately recorded;

2.2) heavy body cDNA Reverse Transcription box specification sheets strictly configures reversion system on ice;

Table 2:cDNA obtains reaction system

The above reaction system of soft mixing, and utilize whizzer of short duration centrifugal, obtain template cDNA;

Table 3:cDNA obtains response procedures

2.3) by Taq high-fidelity DNA polymerase configuration reaction system, primer is F(SEQIDNO:5) and R(SEQIDNO:6), employment reference gene (GAPDH) carries out each tissue sample of pcr amplification, product 1% gel detection, with the cDNA quality of the extraction quality and acquisition of guaranteeing RNA;

Table 4:GAPDH amplification system

Table 5:GAPDH amplification program

The PCR of 3.EGFRvIII detects

By in gene sequencing, we can obtain clearly: EGFRvIII is Wild type EGFR disappearance 801bp comparatively, the PCR primer of each tissue sample can be obtained by the method for PCR, by gel detection, observe the catastrophe of EGFRvIII and rough expression intuitively.

The method of nest-type PRC is exaggerated the expression signal of gene by two-wheeled PCR, and due to the singularity of design of primers, fully ensure that the specificity of amplified production, to guarantee the split hair caccuracy that PCR detects and sensitivity;

3.1) to obtain cDNA chain in step 2 for template, with reference to GAPDH amplification system preparation first round reaction system, following program carries out first round pcr amplification:

Table 6: first round pcr amplification program

3.2) get first round PCR primer 1 μ l, sterilized water fully mixes after diluting 10 times, obtains second and takes turns pcr template, and PCR amplification system is taken turns in the amplification system preparation second with reference to GAPDH, and carry out second and take turns pcr amplification, amplification program is as follows:

Table 7: second takes turns pcr amplification program

3.3) 1% sepharose detects and second takes turns amplification, due to EGFRvIII comparatively Wild type EGFR disappearance 801bp, whether can observe the expression of EGFRvIII intuitively from result taken pictures by gel.

As shown in Figure 1, be the reference of DL2000 standard from left to right successively, 1-21 sample, each testing sample all can amplify the band of 582bp;

As shown in Figure 2, utilize 1% agarose gel electrophoresis to detect second and take turns nested PCR amplification product wherein, sample is from left to right followed successively by: the reference of Dl2000 standard, 1-21 sample, negative control sample (water) and positive control sample; 23rd swimming lane is negative control, utilizes water not amplify band for template; 24th swimming lane is the EGFRvIII gene that increases in known cancer cell, and template size is the band of 431bp; 1-4 sample, 6,7,11,16,19,20,21 samples all can amplify the band of 431bp.

4. the sequence verification of detected result, comprises step:

4.1) sample that checks order obtains: accurately cut glue and reclaim EGFRvIII band, and the gene fragment of carrying out EGFRvIII reclaims; Accurately record and reclaim gene fragment concentration, guarantee to reach order-checking desired concn;

4.2) PCR result is determined in order-checking;

4.3) according to sequencing result, and EGFR, EGFRvIII sequence carries out overall sequential analysis, to determine the accuracy of pcr amplification.

As shown in Figure 3, take turns nested PCR product sequencing analysis to second, and utilize sequence analysis software comparison sequencing result.Wherein, F66-496 is the second sequencing result sequence of taking turns nested PCR product, and suspension points represents compared with EGFRvIII gene order, and the sequence measured is shorter than EGFRvIII a bit of, because the sequence measured is a part for EGFRvIII gene order; Second row is the sequence of target EGFRvIII gene, and blue portion represents that the two sequence is mated completely, and cyan portion represents that the two sequence is not mated; The third line is the consensus sequence of the first two sequence; Front end is the sequence (88-89 bit base) across saltation zone.Result shows, the sequence checked order out and goal gene sequence completely the same, namely nested PCR product is exactly one section of EGFRvIII gene, illustrate that the specificity of primer is good, and pcr amplification product is exactly EGFRvIII sequence.

The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.

Sequence table

Tylenol enlightening bio tech ltd, <110> Beijing

<120> mono-kind detects the method for tumour cell EGFRvIII

<160>6

<210>1

<211>17

<212>DNA

<213> artificial sequence

<220>

<223> primer

<400>1

GCCCGGCGAGTCGGGCT17

<210>2

<211>16

<212>DNA

<213> artificial sequence

<220>

<223> primer

<400>2

TGCCTCGGCTGACATT16

<210>3

<211>19

<212>DNA

<213> artificial sequence

<220>

<223> primer

<400>3

TCGGGCTCTGGAGGAAAAG19

<210>4

<211>24

<212>DNA

<213> artificial sequence

<220>

<223> primer

<400>4

CTTGAGGGAGCGTAATCCCAAGGA24

<210>5

<211>21

<212>DNA

<213> artificial sequence

<220>

<223> primer

<400>5

AGGTCGGAGTCAACGGATTTG21

<210>6

<211>20

<212>DNA

<213> artificial sequence

<220>

<223> primer

<400>6

GTGATGGCATGGACTGTGGT20

Claims (7)

1. detect a method of EGFRvIII in tumor tissues, it is characterized in that, comprise the following steps:

1) EGFR, EGFRvIII gene order is analyzed: adopt the sequence analysis programs write to carry out base scanning one by one to the gene order before saltation zone, obtain the low repeatability region of 56-70 bit base;

2) two specific forward primers are designed for the low repeat region before saltation zone, sequence analysis software is utilized to carry out specific reverse primers design, and mated with the forward primer before saltation zone, the first round and second designed respectively across saltation zone takes turns specificity amplification primer;

3) acquisition of detection template, comprises the following steps:

3.1) extraction of tissue sample RNA: get the tissue sample that appropriate RNAlater preserves, extracts tissue sample RNA;

3.2) obtain template cDNA: with tissue sample RNA for template, oligodT is that the reverse transcription that primer carries out RNA obtains tissue sample cDNA;

4) detection of EGFRvIII, comprises the following steps:

4.1) with step 3) obtain cDNA for template, with water belongs with yin contrast, blank is set, positive control, carries out first round amplification; With first round PCR primer for template, carry out second and take turns pcr amplification; And

4.2) 1% sepharose direct-detection two-wheeled pcr amplification situation, and according to EGFRvIII object fragment compared with the little 801bp of EGFR wild-type, observe the tissue expression situation of EGFRvIII intuitively; And

5) sequence verification of detected result: cut glue and reclaim EGFRvIII object fragment, gene sequencing checking nest-type PRC detected result.

2. the method for EGFRvIII in detection tumor tissues according to claim 1, is characterized in that: in step 2) in, it is SEQIDNO:1 and SEQIDNO:3 respectively that the low repeat region before saltation zone designs two specific forward primers.

3. the method for EGFRvIII in detection tumor tissues according to claim 1, is characterized in that: in step 2) in, it is SEQIDNO:2 and SEQIDNO:4 respectively that the first round and second across saltation zone takes turns specificity amplification primer.

4. the method for EGFRvIII in detection tumor tissues according to claim 1, is characterized in that, in step 3.1) in, the extraction of tissue sample RNA comprises the following steps:

3.1.1) the choosing and prepare of tissue sample: the tumor tissues cut of performing the operation, margins of excision, chooses middle intact tissue block and is positioned within the shortest time in RNAlater and preserves at-80 DEG C, prevent RNA from degrading;

3.1.2) get 30mgRNAlater and preserve sample, add 1mlTRIzol and fully grind, make the abundant cracking of tissue block, add chloroform in the ratio of 200 μ l/mlTRIzol, fully shake mixing, 4 DEG C, centrifugal 15 minutes of 12000rpm;

3.1.3) get upper strata aqueous phase in another EP pipe, add equal-volume isopropanol precipitating RNA, 4 DEG C, centrifugal 10 minutes of 12000rpm, the RNA of collecting precipitation;

3.1.4) RNA obtained is precipitated with 75% ethanol purge, 4 DEG C, centrifugal 10 minutes of 12000rpm; With

3.1.5) discard ethanol, treat ethanol volatilization totally, appropriate DEPC water dissolution tissue sample RNA.

5. the method for EGFRvIII in detection tumor tissues according to claim 1, is characterized in that, in step 3.2) in, obtain template cDNA and comprise the following steps:

3.2.1) ultramicrospectrophotometer is utilized accurately to record the RNA concentration of tissue sample;

3.2.2) preparing 0.2ml on ice without enzyme PCR reaction tubes sets up reverse transcription reaction system 20 μ l, and wherein, RNA is 1 μ g; 10X RT Buffer is 2.0 μ l; 25mM deoxyribonucleoside triphosphate mixed solution is 0.8 μ l; 10mM poly thymidylic acid chain is 2.0 μ l; Reversed transcriptive enzyme is 1.0 μ l; RNA hydrolase inhibitor is 1.0 μ l; Surplus is nuclease free water; And

3.2.3) the above reaction system of soft mixing, and utilize whizzer of short duration centrifugal, then react under being placed in following condition successively, obtain template cDNA:25 DEG C of reaction 10 minutes; 37 DEG C are reacted 120 minutes; 85 DEG C are reacted 5 minutes; CDNA4 DEG C that obtains stores for future use.

6. the method for EGFRvIII in detection tumor tissues according to claim 1, is characterized in that, in step 4.1) in, cDNA carries out pcr amplification and comprises step:

4.1.1) first round pcr amplification: with reference to GAPDH amplification system preparation first round reaction system, it is as follows that cDNA carries out pcr amplification program: denaturation 94 DEG C, and duration is 5 minutes; Sex change 94 DEG C, duration is 30 seconds; Anneal 58 DEG C, duration is 30 seconds; Extend 72 DEG C, duration is 30 seconds; Totally 35 circulations, eventually extend 10 minutes, and it is for subsequent use that synthetic product is placed in the refrigerator storage of 4 DEG C; And

4.1.2) second pcr amplification is taken turns: get first round PCR primer 1 μ l, after diluting 10 times with sterilized water, abundant mixing, obtain second and take turns pcr template, PCR amplification system is taken turns in amplification system preparation second with reference to GAPDH, carry out second and take turns pcr amplification, amplification program is as follows: denaturation 94 DEG C, and duration is 5 minutes; Sex change 94 DEG C, duration is 30 seconds; Anneal 58 DEG C, duration is 30 seconds; Extend 72 DEG C, duration is 30 seconds; Totally 35 circulations, eventually extend 10 minutes, and it is for subsequent use that synthetic product is placed in the refrigerator storage of 4 DEG C.

7. in the detection tumor tissues according to any one of claim 1-6, the method for EGFRvIII, is characterized in that, in step 5), checking nest-type PRC detected result comprises step:

5.1) accurately cut glue recovery EGFRvIII band, the gene fragment of carrying out EGFRvIII reclaims; Utilize ultramicrospectrophotometer instrument to record the gene fragment concentration of recovery, guarantee to reach the required concentration of order-checking;

5.2) sample send biotech firm's order-checking to determine PCR result; And

5.3) according to sequencing result, and EGFR, EGFRvIII sequence carries out overall sequential analysis, to determine the accuracy of pcr amplification.