CN105296539B - The method of silence TNFAIP8 genes and its application in oncotherapy - Google Patents
The method of silence TNFAIP8 genes and its application in oncotherapy Download PDFInfo
- Publication number
- CN105296539B CN105296539B CN201510830193.8A CN201510830193A CN105296539B CN 105296539 B CN105296539 B CN 105296539B CN 201510830193 A CN201510830193 A CN 201510830193A CN 105296539 B CN105296539 B CN 105296539B
- Authority
- CN
- China
- Prior art keywords
- tnfaip8
- gene
- tumour cell
- silence
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The application belongs to biopharmaceutical technology, and in particular to a kind of silenceTNFAIP8The method of gene and its application that cis-platinum (CDDP) therapeutic effect is improved in oncotherapy.The method of silence TNFAIP8 genes specifically includes：Design siRNA target sequences, design and synthesize shRNA gene orders, annealing forms double-strand, is connect with LV10 carriers, converts 293T cells preparation lentiviral particles.It will be in this method silence tumour cellTNFAIP8After gene, sensibility of the tumour cell to CDDP can be improved.The present invention can be reduced targetedly in tumour cellTNFAIP8Gene expression amount；It is further rightTNFAIP8When the tumour cell application CDDP treatments of gene silencing, tumour cell is obviously improved CDDP sensibility.
Description
Technical field
The application belongs to biopharmaceutical technology, and in particular to a kind of silenceTNFAIP8The method of gene and its swollen
The application of cis-platinum (CDDP) therapeutic effect is improved in tumor treatment.
Background technology
Operation, chemotherapy and radiation are still the main means of current kinds of tumors treatment, and wherein chemotherapy is as oncotherapy
One of conventional means have irreplaceable role in the therapeutic process of many malignant tumours.In general, when with chemotherapy
Between extension, tumour cell is inevitable phenomenon to the resistance rising of chemotherapeutics and sensibility decline, thus is also mesh
Urgent problem in pre-neoplastic medicament research and development and oncotherapy.
Cis-platinum (cis-diamine dichloroplatinum, CDDP) is the metal complex of inorganic platinum, structure
In comprising there are one two amino molecules and two chlorine atoms of center divalent platinum and the cis- arrangement of surrounding, be similar to bifunctional alkylating agents
Agent, can form with DNA in chain and interchain cross link, destruction DNA functions prevent DNA replication dna, belong to a kind of cell cycle non-spy
Specific agent.It has the characteristics that antitumor spectra is wide, effect is strong, has synergistic effect with a variety of antineoplastics, thus is clinical tumor
One of most common chemotherapeutics in treatment.
In clinical application, with the chemotherapy time extension and cis-platinum is applied multiple times, tumour cell can be to the sensibility of cis-platinum
Decline and generate cis-platinum and resist so that therapeutic effect substantially reduces.Moreover, cis-platinum also has larger side effect, such as seriously
Nausea and vomiting, renal toxicity, neurotoxicity, bone marrow suppression etc..Thus at present clinically mainly using cis-platinum and other chemotherapeutics
Object use in conjunction come enhance therapeutic effect and reduce drug resistance incidence.
TNFAIP8（Tumor necrosis factor alpha induced protein 8, TIPE）I.e. TNF-α lures
The protein 8 led, also referred to as SCC-C2, NDED, GG2-1 are a kind of plasmosins that molecular weight is 21KD.Existing research table
It is bright,TNFAIP8Include one and Death Effector Domain in gene open reading frameHomologous sequence belongs to Fas phases and shuts
It dies domain protein sample interleukin-1β-converting enzyme and inhibits albumen (Fas associated death domain-like
Interleukin-1 β-converting enzyme-inhibitory protein, FLIP) family member（Kumar
D et.al., Identification of a Novel Tumor Necrosis Factor- α-inducible Gene,
SCC-S2, Containing the Consensus Sequence of a Death Effector Domain of Fas-
associated Death Domain-like Interleukin- 1β-converting Enzyme-inhibitory
Protein, J. Biol. Chem., 2000,275（4）：2973-2978）.Separately some researches show that TNFAIP8 is in kinds of tumors
Expression in tissue is significantly higher than cancer beside organism and normal control tissue.Thus wait about TNFAIP8 and the correlation of tumour
Further research, and more it is a lack of relevant research report about application of the expression quantity of TNFAIP8 in oncotherapy is adjusted.
Invention content
The main purpose of the present invention is to provide a kind of silencesTNFAIP8The method of gene, passes through silenceTNFAIP8Gene is used for
When oncotherapy, the therapeutic effect of cis-platinum (CDDP) can be improved.
Technical scheme of the present invention is described in detail as follows below.
A kind of silenceTNFAIP8The method of gene, technical principle are that the slow virus carrier of shRNA is carried by structure,
Then lentiviral particle infected tumor cell is utilized, is made in tumour cellTNFAIP8Gene silencing；Detailed process is：
（1）Design silenceTNFAIP8The siRNA target sequences of gene
It makes oneTNFAIP8Gene（GenBank：CR457137.1）The siRNA of silence（Small interfering RNA）
Target sequence, specially：
SiRNA target sequences are：5'- GCCACCACCTTAATAGACGAC - 3'；
ShRNA gene orders are designed and synthesized according to siRNA target sequences, detailed sequence is as follows：
Sense strand sequence is： 5'-TGCCACCACCTTAATAGACGACTTCAAGAGAGTCGTCTATTAAGGTGGTGGC
TTTTTTC- 3'；
5 ' ends of positive-sense strand are added to T, with the cohesive end complementation formed after HpaI digestions；
Antisense strand sequence is：
5’-TCGAGAAAAAAGCCACCACCTTAATAGACGACTCTCTTGAAGTCGTCTATTAAGGTGGTGGCA-
3'；
The end of antisense strand 5 ' is added to AGCT, with the cohesive end complementation formed after XhoI digestions；
It should be noted that the loop structures in shRNA sequences have selected TTCAAGAGA to avoid termination signal is formed；
（2）By above-mentioned steps（1）In synthesized shRNA sense strand sequences and antisense strand sequence carry out annealing formation
Double-strand；
（3）Linearization process is carried out using XhoI enzymes and Hpa I enzymes to LV10 carriers；
（4）By step（2）And step（3）Product is attached structure LV10-shRNA carriers；
（5）By step（4）Constructed LV10-shRNA carriers conversion 293T cells prepare lentiviral particle；
It will can make TNFAIP8 gene silencings in tumour cell, institute after prepared lentiviral particle infected tumor cell
State HeLa, H1299, U251 or EC9706 of the specific such as human tumor cell line of tumour cell.
The silenceTNFAIP8Application of the method for gene in tumour, in silence tumour cellTNFAIP8Gene
Afterwards, tumour cell can be improved to cis-platinum（CDDP）Sensibility, improve the therapeutic effect of CDDP.
In existing oncotherapy, since CDDP is using relatively broad, and there is more exact therapeutic effect, thus is suitable
The application of CDDP is answered, while to reduce the side effect of CDDP, needing the sensibility for improving tumour cell to CDDP, while relatively low use
The CDDP of amount can also reduce side effect when CDDP is used.
The present invention is by slow virus carrier of the structure containing specific shRNA sequences and prepares lentiviral particle, uses it for
When tumour cell, can targetedly it reduce in tumour cellTNFAIP8Gene expression amount.It is further rightTNFAIP8Gene
When the tumour cell application CDDP treatments of silence, tumour cell is obviously improved CDDP sensibility.The present invention is tumour
Treatment provide new reference and reference, while the application for being CDDP in oncotherapy provides new foreground and may
Property.
Description of the drawings
Fig. 1 be lentiviral particle infected tumor cell after,TNFAIP8Gene and its protein expression testing result, wherein 1 is
Wild-type cell, 2 be negative control group cell, and 3 be gene silencing group cell；Scheme A to detect for real-time fluorescence quantitative PCRTNFAIP8Relative expression quantities of the mRNA in tumour cell, wherein in wild-type cellTNFAIP8Mrna expression amount assume
It is 1, result isTNFAIP8Gene silencing cell and negative control cell are relative in wild-type cellTNFAIP8Expression times
Number；It is the protein expression level result that Western blot detect TNFAIP8 in tumour cell to scheme B；
When Fig. 2 is that mtt assay detectsTNFAIP8Sensibility when gene silencing tumour cell handles various concentration CDDP is poor
Not, wherein scr is negative control group；SiTIPE is gene silencing group；
When Fig. 3 is flow cytomery,TNFAIP8Gene silencing tumour cell it is sensitive to certain concentration CDDP as a result,
Wherein scr is negative control group；SiTIPE is gene silencing group；
When Fig. 4 is that trypan blue staining detects,TNFAIP8Gene silencing tumour cell is to the sensitive knots of various concentration CDDP
Fruit, wherein scr are negative control group；SiTIPE is gene silencing group.
Specific implementation mode
With reference to embodiment the present invention will be further explained explanation.Before introducing specific embodiment, to institute of the present invention
The key instrument equipment and experiment reagent used are briefly discussed below.
Main agents, drug and sample：
Non-small cell lung carcinoma NCI-H1299, human glioma cells U251, human cervical carcinoma cell HeLa, human esophagus cancer
Cell EC9706,293T cell is purchased from Shanghai Inst. of Life Science, CAS cell resource center；Top10 competence is thin
Born of the same parents are purchased from Tiangeng biochemical technology（Beijing）Co., Ltd.
Puromycin, cis-platinum（CDDP）, MTT be purchased from Sigma Co., USA；
Transfection reagent Fugene 6 is purchased from Promega companies of the U.S.；
Cell apoptosis detection kit（Annexin V-FITC）Purchased from German Mei Tian Ni Bioisystech Co., Ltd；
Total RNA extraction reagent box and reverse transcription reagent box are purchased from the complete biological Co., Ltd of formula gold in Beijing；
Real-time fluorescence quantitative PCR kit is purchased from Beijing CoWin Bioscience Co., Ltd.；
Slow virus carrier LV10, packaging plasmid psPAX2, shuttle plasmid pMD2.G are limited by Shanghai Ji agate pharmaceutical technology
Company provides；
Each gene order is by gold only intelligence biotechnology in embodiment（Beijing）Co., Ltd's synthesis provides；
Remaining undeclared reagent, drug etc. are the common pure based article of analysis in laboratory, are repeated no more.
Key instrument equipment：
Real-time fluorescence quantitative PCR instrument（Model：RG6000）, it is Australia's Corbett Research Products；
Flow cytometer（Model：FACSCalibur）, it is purchased from U.S. company BD.
Embodiment 1
Silence provided by the present inventionTNFAIP8The method of gene, technical principle are to carry shRNA's by structure
Then slow virus carrier prepares lentiviral particle and infected tumor's cell, makes in tumour cellTNFAIP8Gene silencing.By
The structure of shRNA slow virus carriers is depended in this method, thus the present embodiment is detailed with regard to the building process of shRNA slow virus carriers
Carefully it is described below.
Slow virus carrier uses LV10 slow virus carriers in the present embodiment（LV10 slow virus carriers can express red fluorescence egg
In vain）, structure LV10-shRNA viral vectors detailed process be：It designs firstTNFAIP8The siRNA target sequences of gene expression,
Then artificial synthesized corresponding shRNA positive-sense strands and antisense strand sequence after annealing, will be formed after shRNA double-strands and digestion
LV10 linear carriers, connection structure LV10-shRNA viral vectors, detailed process is described below.
（1）It designs and synthesizes in silence human tumor cellsTNFAIP8The siRNA target sequences of gene
To make in tumour cellTNFAIP8Gene silencing, inventor use Oligo Designer3.0（Genepharma）
Software for Design makes oneTNFAIP8Gene（GenBank：CR457137.1）The siRNA of silence（Small interfering
RNA）Target sequence, specially：
SiRNA target sequences are：5'- GCCACCACCTTAATAGACGAC - 3'.
It is to be understood that the present invention is in use, to obtain siRNA target sequences, it is to pass through shRNA（short
Hairpin RNA, short hairpin RNA）Automatically generation, the siRNA obtained by the method are processed after expression in the cell
Sequence is more stable and efficient.
For these reasons, thus the application firstly the need of according to siRNA target sequences design synthesis shRNA gene orders,
Detailed sequence is as follows：
Sense strand sequence is： 5'-TGCCACCACCTTAATAGACGACTTCAAGAGAGTCGTCTATTAAGGTGGTGGC
TTTTTTC- 3'；
5 ' ends of positive-sense strand are added to T, with the cohesive end complementation formed after HpaI digestions；
Antisense strand sequence is：
5’-TCGAGAAAAAAGCCACCACCTTAATAGACGACTCTCTTGAAGTCGTCTATTAAGGTGGTGGCA-
3'；
The end of antisense strand 5 ' is added to AGCT, with the cohesive end complementation formed after XhoI digestions；
It should be noted that the loop structures in shRNA sequences have selected TTCAAGAGA to avoid termination signal is formed.
（2）The annealing of shRNA templates
By above-mentioned steps（1）In synthesized shRNA sense strand sequences and antisense strand sequence anneal, detailed process
For：
By gold only intelligence biotechnology（Beijing）Co., Ltd synthesis provide shRNA gene orders in positive-sense strand template and
Antisense strand template uses TE buffer solutions respectively（pH=8.0）Dissolving, is prepared into a concentration of 100 μM of solution, then carries out PCR annealing
Processing, the design of 50 μ L reaction systems are as follows：
10 × shDNA annealing buffers, 5 μ L；
Positive-sense strand template (100 μM), 5 μ L；
Antisense strand template (100 μM), 5 μ L；
ddH2O adds to 50 μ L；
Cycle of annealing：95 DEG C, 5min, 85 DEG C, 5min, 75 DEG C, 5min, 70 DEG C, 5min；
Simultaneously 4oC is saved backup recycling reaction product.
Gained reaction product is shRNA gene order templates, a concentration of 10 μM；Diluted 50 times, i.e., it is a concentration of
When 200nM, reacted for subsequent connection.
（3）The linearization process of LV10 carriers
Double digestion is carried out to LV10 carriers using Xho I enzymes and Hpa I enzymes, 100 μ L digestion System Designs are as follows：
10 × Buffer R, 10 μ L；
Xho I, 5 μ L（50 U/µL）；
Hpa I, 5 μ L（50 U/µL）；
LV10 carriers, 5 μ g；
ddH2O adds to 100 μ L；
37 DEG C of digestions 2 hours, for digestion products into row agarose gel electrophoresis, blend compounds QIAquick Gel Extraction Kit recycles digestion production
Object；It is finally that recovery product diluted concentration is spare to 50 ng/ μ L.
（4）Connection structure LV10-shRNA carriers
By step（2）The pcr amplification product and step of recycling（3）The digestion products of recycling are connected with T4 DNA ligases
It connects, builds LV10-shRNA carriers, the design of 20 μ L linked systems is as follows：
10 × T4 Ligation Buffer, 2 μ L；
Step（3）The LV10 carrier double digestion products of middle recycling, 1 μ L（50 ng/µL）；
Step（2）The shRNA templates of middle recycling, 1 μ L（200nM）,
T4 DNA ligases, 1 μ L (10U/ μ L)；
ddH2O, 15 μ L；
16 DEG C, connection is overnight.
In general, to constructed LV10-shRNA carriers it is still necessary to further carry out conversion identification and sequence verification after
It can further apply, conversion identification uses Top10 competent cells, detailed process as follows：
Competent cell Top10 is taken out first from -80 DEG C of refrigerators（Contain 100uL competence in each 1.5mL centrifuge tubes
Cell suspension）, place 4 minutes on ice, after competent cell defrosting, the connection product in 10 μ L above-mentioned steps be added, softly
Then mixing is placed 30 minutes in ice；
By centrifuge tube in 42 DEG C of water-baths 90 seconds, it is careful not to shake centrifuge tube；Then it is quickly transferred in ice bath, makes thin
Born of the same parents cool down 3 minutes；
800 μ L LB culture mediums (be free of antibiotic) are added into every centrifuge tube, are transferred to shaking table, 37 DEG C, 250 turns/
Minute, being incubated 45 minutes makes cell recovery；
After incubation, 200 μ L cultures is taken to be spread evenly across on the LB agar plates containing 50 μ g/mL ampicillins, is inverted
In 37 DEG C of incubators, cultivate 16 hours；
From 3 bacterium colonies of picking on every piece of tablet, it is inoculated into respectively in the LB culture mediums containing 50 μ g/mL ampicillins,
37 DEG C are cultivated 16 hours；Alkaline lysis extracts plasmid and carries out sequence verification after culture.
It is converted again into competent cell Top10 to correct plasmid is sequenced, using amount extracting examination in high-purity plasmid
It is spare that agent box extracts plasmid.
Embodiment 2
To the LV10-shRNA carriers containing shRNA sequences constructed by embodiment 1（I.e. in embodiment 1 after sequence verification
The plasmid extracted）Lentiviral particle is prepared into it is still necessary to further converting 293T cells could further to apply, the present embodiment is just
The preparation process of LV10-shRNA carriers conversion process, that is, lentiviral particle is briefly discussed below.
The detailed process that LV10-shRNA carriers convert 293T cells preparation lentiviral particle is as follows：
（1）The previous day digestion 293T cells are carried, 2 × 10 are inoculated in diameter 10cm culture dishes6A cell is added without blueness
The DMEM culture mediums of streptomysin, 37 DEG C, the CO of 5% volume2Under the conditions of overnight incubation；
（2）100 μ L serum-free DMEM are added in a sterile 1.5mL centrifuge tube, by 4:3:1 ratio adds respectively
Enter shRNA-LV10 carriers, 1.5 μ g packaging plasmids psPAX2, the 0.5 μ g shuttle plasmid pMD2.G prepared by 2 μ g embodiments 1,
Mixing；
Another sterile 1.5mL centrifuge tube is separately taken, 500 μ L serum-free DMEM are added, add 20 μ L transfection reagents
Fugene6, mixing are placed at room temperature for 5 minutes；
Above-mentioned two pipes solution is mixed, is placed at room temperature for 20 ~ 30 minutes；
（3）293T cells are taken out, by step（2）Obtained mixed solution is added dropwise to step（1）Tissue Culture Dish
In, culture dish is lightly rocked back and forth to disperse the compound being added, in 37 DEG C, the CO of 5% volume2It is small that 12 are incubated in incubator
When；
The culture solution in 293T cells is discarded after culture, rejoins 15mL DMEM culture solutions, 37 DEG C, 5% volume
CO2Continue culture 48 hours；
（4）By step（3）Cell supernatant is collected into 50mL centrifuge tubes after middle culture, 4 DEG C, 4000rpm from
Heart 4min, takes supernatant；
Supernatant is sucked in 50mL syringes, is filtered with 0.45 μm of filter；
Viral pellet is resuspended 4 DEG C in centrifuge, 20000rpm ultracentrifugation 2h, with cold PBS in filtrate, and packing to EP is managed
In, -80 DEG C save backup.
Prepared lentiviral particle is detected, to determine that virus titer, detailed process are as follows：
293T cells are digested first, by 3 × 104The concentration in a/hole is inoculated in 96 well culture plates, after mixing in 37 DEG C, 5%
The CO of volume2Under the conditions of cultivate for 24 hours；
10 ~ 20 μ L of lentiviral particle prepared in above-mentioned steps are taken, dilute 4 gradients for ten times with DMEM culture mediums, i.e.,
10 times of dilution, 10 successively2Again, 103Again, 104Times；
Culture solution after being cultivated in 96 well culture plates for 24 hours in 293T cells sucks, after 100 μ L dilutions are then added per hole
Virus liquid, while setting up blank control group, 37 DEG C, the CO of 5% volume2Under the conditions of cultivate for 24 hours；
It sucks the virus liquid in 96 well culture plates afterwards for 24 hours, 100 μ L culture mediums is added per hole, 37 DEG C, the CO of 5% volume2
Under the conditions of cultivate 72h；
Fluorescence microscope counts fluorecyte, and virus titer is calculated in conjunction with extension rate.
The result shows that the titre of the lentiviral particle prepared by the present embodiment is 1 × 108TU/mL。
Embodiment 3
By the lentiviral particle infected tumor cell prepared by embodiment 2, you can generate siRNA in tumour cell, most
Whole silenceTNFAIP8Expression, detailed process is described below.
The detailed process of lentiviral particle infected tumor cell is as follows：
（1）Optimal puromycin concentration is determined first, can kill the minimum puromycin concentration of cell completely, specifically
For：
Tumour cell is digested, and is inoculated in 96 well culture plates, inoculum concentration 1.5 × 104A/hole；For research, the present invention is made
Standby lentiviral particle is applicable in range of tumor, and HeLa, H1299, U251, EC9706 of human tumor cell line has been respectively adopted；
Tumor cell inoculation is separately added into the culture that 100 μ L contain puromycin in second day after 96 well culture plates per hole
Base, the setting of puromycin gradient, specially：0µg/mL,1µg/mL,2µg/mL,3µg/mL,4µg/mL,5µg/mL,6µg/mL,7
µg/mL,8µg/mL,9µg/mL；
After the culture medium containing puromycin is added, routine observation cell culture situation, acquisition can kill cell completely
Minimum puromycin concentration；
The result shows that for above-mentioned 4 kinds of tumor cell lines, optimal puromycin concentration is 2 μ g/mL；
（2）Using the lentiviral particle infected tumor cell prepared by embodiment 2, detailed process is：
Above-mentioned 4 kinds of tumor cell lines are digested respectively, and are inoculated with 96 well culture plates, 5000/hole of inoculum concentration, 37 DEG C after inoculation
Overnight；
Second day, 80 μ L are added per hole in the orifice plate containing tumour cell, contain 8 μ g/mL polybrenes
（Polybrene）DMEM culture mediums and 20 μ L embodiments 2 prepared by virion（1×108TU/mL）, while sky is set
White control（Lentiviral particle infection processing is not carried out）, then in incubator 37 DEG C continue to cultivate；
Culture sucks the DMEM culture mediums containing lentiviral particle and containing Polybrene afterwards for 24 hours, while being changed to fresh
Normal incubation medium, continue culture for 24 hours for 37 DEG C in incubator；
After culture for 24 hours, culture medium in culture plate is replaced with into the culture medium containing 2 μ g/mL puromycins, while the moon is set
Property control（Lentiviral particle infection has been carried out, but has not carried out adenine mycin processing）；Carry out culture medium daily simultaneously（Adopt
With the culture medium of 2 μ g/mL puromycins）Replacement, to remove the tumour cell that is killed by puromycin, up to cell expands again
Increasing is paved with entire orifice plate bottom surface.
At this time i.e. it is believed that lentiviral particle is in silence tumour cellTNFAIP8The expression of gene can will be paved with
After the tumour cell digestion of entire orifice plate bottom surface, continue to be cultivated with the culture medium containing 2 μ g/mL puromycins, it is spare.
For in tumour cellTNFAIP8The silencing efficiency of gene carries out objective evaluation, can be in tumour cellTNFAIP8
Gene and its protein expression carry out gene expression dose respectively and protein expression level is examined, and detailed process is briefly discussed below.
TNFAIP8 protein expression levels detect
The wild type of tumour cell is extracted respectively（That is blank control）, negative control and silenceTNFAIP8Tumour after gene
Endochylema total protein in cell after being measured to its concentration, carries out immunoblotting（Western blotting）Detection, with true
Determine the expression of TNFAIP8 albumen in cell.
TNFAIP8 gene expression doses detect
The wild type of tumour cell is extracted respectively（That is blank control）, negative control and silenceTNFAIP8Tumour after gene
Total serum IgE in cell, reverse transcription carry out real-time fluorescence quantitative PCR detection at cDNA, when detection withGAPDHAs with reference to control：
Primer sequence design is as follows when detection：
TNFAIP8Primer (amplified production 115bp)：
Sense primer：TCCATCGCCACCACCTTA,
Downstream primer：CTCTGCCTCCTTCTTGTTTT；
GAPDHPrimer（Amplified production 95bp）：
Sense primer：CCCATCACCATCTTCCAG,
Downstream primer：AATGAGCCCCAGCCTTCT；
The setting of 20 μ L reaction systems is as follows：
2 × SYBR Mixture (withROX), 10 μ L；
Upstream and downstream primer, each 0.5 μ L（10µM）；
CDNA, 2 μ L；
ddH2O adds to 20 μ L；
Reaction condition is as follows in PCR instrument：95℃,10min；95 DEG C, 15s, 60 DEG C, 1min；Totally 40 cycles.
TNFAIP8Gene expression dose and protein expression level detect respectively as shown in Figure 1A, 1B.It can from figure
Go out, in the metainfective tumour cell of lentiviral particleTNFAIP8The mRNA gene expression doses and protein expression level of gene
Have compared to wild type and be significantly substantially reduced, shows the tumour cell of the virion preferably silence prepared by the present invention
InTNFAIP8Gene.
Embodiment 4
To detect silence in above-described embodiment 3TNFAIP8Influence of the tumour cell for CDDP sensibility after gene, invention
People has done further test experience, and correlated process is described below.
（1）Mtt assay is used to determine firstTNFAIP8Tumour cell is to the sensitivity effect of various concentration CDDP after silence,
Detailed process is as follows：
Respectively digestion count embodiment 3 in negative control andTNFAIP8The tumour cell of gene silencing, paving to 96 holes are cultivated
In plate, inoculum concentration：0.6×104100 μ L culture mediums are added per hole for a/hole, are incubated overnight for 37 DEG C in incubator；
Second day, culture medium in culture plate is replaced, is changed to containing various concentration CDDP（0,2.5,5,10,20,
30µg/mL）Culture medium, continue culture for 24 hours for 37 DEG C in incubator；
After culture, it is separately added into the MTT solution of 20 μ L, 5mg/mL per hole, continues to cultivate 4h in incubator；
Cell is then taken out, careful sucks supernatant, and the DMSO of 150 μ L is then added per hole, sets low speed on shaking table and shakes
10min；
The light absorption value that each hole is measured at microplate reader 490nm calculates inhibiting rates of the CDDP to cell growth according to light absorption value.
Inhibitory rate of cell growth calculation formula is：
Inhibitory rate of cell growth（%）=（Control wells OD values-experimental port OD values）/ control wells OD value × 100%.
Experimental result is as shown in Figure 2.From figure 2 it can be seen that under the conditions of the CDDP of same concentrations,TNFAIP8Gene
Tumour cell after silence, cell Proliferation growing state are substantially less than the tumour cell of negative control group, it is also assumed that by heavy
In silent tumour cellTNFAIP8Gene can improve growth inhibition effects of the CDDP to tumour cell, that is, improve controlling for CDDP
Therapeutic effect.
（2）Using flow cytometry analysisTNFAIP8Sensitivity of the tumour cell of gene silencing to the CDDP of certain concentration
Property effect, detailed process are as follows：
Respectively digestion count embodiment 3 in negative control andTNFAIP8The tumour cell of gene silencing is seeded to the training of 24 holes
It supports in plate, inoculum concentration：6×1041mL culture mediums are added per hole for a/hole, are incubated overnight for 37 DEG C in incubator；
Second day, culture medium in culture plate is replaced, is changed to the culture medium containing 10 μ g/mL CDDP, incubator
In 37 DEG C continue culture for 24 hours；
After culture, flow cytometry analysis is carried out according to apoptosis kit specification, steps are as follows：
4 DEG C of the cell obtained after digestion, 2000rpm are centrifuged into 10min, cell 2 is washed with 1 × Binding buffer
It is secondary, 4 DEG C, 2000rpm centrifugations 10min；
After discarding supernatant, often 1 × Binding buffer of 100 μ L are added in pipe, add the Annexin V- of 10 μ L
FITC is incubated 15min after mixing on ice；
1 × Binding buffer wash cell 2 times, 4 DEG C, 2000rpm centrifugations 10min；After discarding supernatant, often pipe is added
1 × Binding buffer of 500 μ L carry out flow cytometry after cell is resuspended.
The results are shown in Figure 3.It can be seen from the figure that the tumour cell of TNFAIP8 gene silencings is in CDDP drug effects
Under, apoptosis rate is significantly higher than control group tumour cell, this is also indicated that by silence tumour cellTNFAIP8Gene,
Sensibility of the tumour cell for CDDP can be improved.
（3）Trypan blue staining is analyzedTNFAIP8The tumour cell of gene silencing is to the sensibility of various concentration CDDP, tool
Body process is as follows：
Respectively digestion count embodiment 3 in negative control andTNFAIP8The tumour cell of gene silencing is seeded to the training of 24 holes
It supports in plate, inoculum concentration：6×1041mL culture mediums are added per hole for a/hole, are incubated overnight for 37 DEG C in incubator；
Second day, culture medium in culture plate is replaced, is changed to containing various concentration CDDP（0,10µg/mL,20µ
g/mL）Culture medium, continue culture for 24 hours for 37 DEG C in incubator；
After culture, in vitellophag to centrifuge tube, Trypan Blue counts cell mortality.
The results are shown in Figure 4.It can be seen from the figure thatTNFAIP8The tumour cell of gene silencing is in CDDP drug effects
Under, cell mortality is significantly higher than control group tumour cell, this shows the silence in tumour cellTNFAIP8Expression, can
To enhance lethal effects of the chemotherapeutics CDDP to tumour cell.
SEQUENCE LISTING
<110>He'nan University
<120>The method of silence TNFAIP8 genes and its application in oncotherapy
<130> none
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213>The siRNA of silence TNFAIP8 genes
<400> 1
gccaccacct taatagacga c 21
<210> 2
<211> 59
<212> DNA
<213>ShRNA sense strand sequences
<400> 2
tgccaccacc ttaatagacg acttcaagag agtcgtctat taaggtggtg gcttttttc 59
<210> 3
<211> 63
<212> DNA
<213>ShRNA antisense strand sequences
<400> 3
tcgagaaaaa agccaccacc ttaatagacg actctcttga agtcgtctat taaggtggtg 60
gca 63
Claims (2)
1. a kind of lentiviral particle of silence TNFAIP8 genes, which is characterized in that structure is as follows：
（1）Design the siRNA target sequences of silence TNFAIP8 genes；
The siRNA target sequences of TNFAIP8 gene silencings are made one, as shown in SEQ ID.1, specially：
SiRNA target sequences are：5'- GCCACCACCTTAATAGACGAC - 3'；
ShRNA gene orders are designed and synthesized according to siRNA target sequences, as shown in SEQ ID.2, particular sequence is as follows：
Sense strand sequence is： 5'-TGCCACCACCTTAATAGACGACTTCAAGAGAGTCGTCTATTAAGGTGGTGGCTTTT
TTC- 3'；
Antisense strand sequence is：
5'-TCGAGAAAAAAGCCACCACCTTAATAGACGACTCTCTTGAAGTCGTCTATTAAGGTGGTGGCA- 3'；
（2）By above-mentioned steps（1）In synthesized shRNA genes sense strand sequence and antisense strand sequence carry out annealing shape
At double-strand；
（3）Linearization process is carried out using XhoI enzymes and Hpa I enzymes to LV10 carriers；
（4）By step（2）And step（3）Product is attached structure LV10-shRNA carriers；
（5）By step（4）Constructed LV10-shRNA carriers conversion 293T cells prepare lentiviral particle.
2. application of the lentiviral particle of silence TNFAIP8 genes in preparing oncology pharmacy, feature described in claim 1 exist
In TNFAIP8 gene silencings in tumour cell will can be made after prepared lentiviral particle infected tumor cell, and then improve swollen
Sensibility of the oncocyte to cis-platinum；The tumour cell is HeLa, H1299, U251 or EC9706 of human tumor cell line.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510830193.8A CN105296539B (en) | 2015-11-25 | 2015-11-25 | The method of silence TNFAIP8 genes and its application in oncotherapy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510830193.8A CN105296539B (en) | 2015-11-25 | 2015-11-25 | The method of silence TNFAIP8 genes and its application in oncotherapy |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105296539A CN105296539A (en) | 2016-02-03 |
| CN105296539B true CN105296539B (en) | 2018-10-30 |
Family
ID=55194364
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510830193.8A Active CN105296539B (en) | 2015-11-25 | 2015-11-25 | The method of silence TNFAIP8 genes and its application in oncotherapy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105296539B (en) |
-
2015
- 2015-11-25 CN CN201510830193.8A patent/CN105296539B/en active Active
Non-Patent Citations (5)
| Title |
|---|
| TNFAIP8 Overexpression: Clinical Relevance to Esophageal Squamous Cell Carcinoma;Yuni Elsa Hadisaputri等;《Annals of Surgical Oncology》;20111004;第19卷(第3期);第S589–S596页 * |
| TNFAIP8干扰质粒的构建及最佳干扰效率质粒的筛选;刘文明等;《中国免疫学杂志》;20150531;第31卷(第5期);第650-654页 * |
| TNF-α介导炎症/凋亡相关基因功能性多态位点与宫颈癌易感性及预后关系的分子流行病学研究;史庭燕;《中国博士学位论文全文数据库 医药卫生科技辑》;20150315(第3期);E072-222 * |
| 刘文明等.TNFAIP8干扰质粒的构建及最佳干扰效率质粒的筛选.《中国免疫学杂志》.2015,第31卷(第5期),第650-654页. * |
| 肿瘤坏死因子α诱导蛋白8家族的研究进展;蒋丽娜等;《中华损伤与修复杂志》;20110430;第6卷(第2期);第268-277页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105296539A (en) | 2016-02-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109837306A (en) | Contain the excretion body and its preparation method and application of miRNA-204-5p | |
| CN105177005B (en) | A kind of long non-coding RNA and its application | |
| CN107847553A (en) | The method for the cancer that semizygote of the treatment with TP53 lacks | |
| CN106222141B (en) | NK cell culture fluids and cell culture processes | |
| CN107760784A (en) | Circular rna circ FOXP1 purposes | |
| CN108004322B (en) | Application of lncRNA in diagnosis and/or treatment of lung adenocarcinoma | |
| CN104593421A (en) | Method for preparing mesenchymal stem cells of overexpressed brain-derived neurotrophic factor (BDNF) for inhibiting growth of glioma | |
| CN104611449B (en) | Application of the WWP1 genes in osteosarcoma diagnostic products and medicine is prepared | |
| CN104208723B (en) | MiR-638 application in anti-acute myeloid leukemia | |
| CN108796029B (en) | Establishment method and application of human esophageal cancer EC9706 cell multidrug resistant cell strain | |
| CN105296539B (en) | The method of silence TNFAIP8 genes and its application in oncotherapy | |
| CN103740722A (en) | shRNA (short hairpin ribonucleic acid) inhibiting retinal pigment epithelium apoptosis and application thereof | |
| CN110317878A (en) | A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring | |
| CN103721268B (en) | The application of miR-150 inhibitor in preparation colorectal cancer drug resistance reversal agent | |
| CN108384757A (en) | A method of preparing Human gallbladder carcinoma oxaliplatin resistant cell line | |
| CN101445534A (en) | Use of high efficiency siRNA for preparing tumor migration inhibition drug | |
| CN109010831A (en) | The application of LncRNA RET modulate tumor cellular radiosensitivity | |
| CN109876144B (en) | Purposes of the EMC8 gene inhibitor in preparation treatment gastric cancer medicament | |
| CN109078188B (en) | Action target of antitumor drug and antitumor drug | |
| CN102031308A (en) | Application of miRNA-29a compound as brain glioma marker | |
| CN101892235B (en) | MicroRNA used for inducing leukemia cell differentiation | |
| CN104745635B (en) | A kind of method of OASL genes in silence DF-1 cell lines | |
| CN104342440A (en) | CDKL1 gene, siRNA thereof, and applications of gene and siRNA | |
| CN106754928A (en) | A kind of RNAi and its application in cancer treatment drug is prepared | |
| CN110151976B (en) | Application of ZNF496 protein in improving sensitivity of cervical cancer chemotherapy drugs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |