CN105296451B - Method for obtaining high-activity trichoderma reesei fusion cellulase and recombinant strain - Google Patents
Method for obtaining high-activity trichoderma reesei fusion cellulase and recombinant strain Download PDFInfo
- Publication number
- CN105296451B CN105296451B CN201510895568.9A CN201510895568A CN105296451B CN 105296451 B CN105296451 B CN 105296451B CN 201510895568 A CN201510895568 A CN 201510895568A CN 105296451 B CN105296451 B CN 105296451B
- Authority
- CN
- China
- Prior art keywords
- cbhi
- egii
- gene fragment
- cellulase
- mol
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Botany (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Molecular Biology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the field of genetic engineering, in particular to a method for obtaining high-activity trichoderma reesei fusion cellulase and a recombinant strain. The method comprises the step of fusion expressing a cellulase cbhI gene fragment and an eg1 gene fragment, or a cellulase cbhI gene fragment and an eg ii gene fragment from trichoderma reesei in a host cell. After transformants expressing the fusion cellulase CBHI-EGI and CBHI-EGII are induced and cultured in a BMMY culture medium for 2 days, the filter paper enzyme activities of the cellulases are 5583U/mu mol and 8405U/mu mol respectively; the PASC enzyme activity is 5053U/mu mol and 14272U/mu mol respectively; the CMC enzyme activity is respectively as follows: 11939U/μmol and 18594U/μmol; the enzyme activity of the barley glucan is respectively as follows: 14023U/. mu.mol and 29783U/. mu.mol; the activity of the enzyme is improved by about 1 to 3 times compared with the enzyme activity of the synergistic action of two single enzymes.
Description
Technical Field
The invention relates to the field of genetic engineering, in particular to a method for obtaining high-activity trichoderma reesei fusion cellulase and a recombinant strain.
Background
The biomass from plant has high yield, rich species and regeneration, is widely applied in agriculture and industry for a long time, and is an ideal raw material for producing biofuel and high-value chemicals by biorefinery which is rising and developing rapidly in recent years. Polysaccharides-cellulose and hemicellulose-in plant biomass need to be degraded first to form simple oligosaccharides or monosaccharides that can be fermented, utilized and converted into target molecules by various engineering microorganisms (e.g., escherichia coli, saccharomyces cerevisiae, pseudomonas mobilis, etc.). Various methods, such as physical (e.g., high temperature, high pressure), chemical (e.g., ionic liquid), and biological (enzymatic) methods, are often used in combination to treat plant biomass and efficiently degrade cellulose and hemicellulose. The synergistic effect of cellulase and hemicellulase is required for the biodegradation of cellulose and hemicellulose. In recent years, although many new enzymes for degrading cellulose have been discovered, the cellulase used in many industries such as feed, textile and biorefinery is still mainly derived from the filamentous fungus Trichoderma reesei.
The cellulase of the trichoderma reesei has the optimal action pH of 5.0 and the optimal temperature of 50 ℃. The trichoderma reesei cellulase domains are organized as "1 catalytic domain +1 cellulose binding domain" and a single, free enzyme strategy is adopted to hydrolyze cellulose.
The invention carries out engineering transformation on a cellulase system of the trichoderma reesei so as to improve the efficiency of degrading cellulose and carry out fusion expression on the exo-cellulase and the endo-cellulase of the trichoderma reesei.
Disclosure of Invention
The invention aims to provide a method for obtaining high-activity trichoderma reesei fusion cellulase.
It is still another object of the present invention to provide a recombinant strain expressing a high-activity trichoderma reesei fusion cellulase.
The method for obtaining high-activity trichoderma reesei fusion cellulase according to the present invention comprises the step of fusion expressing fusion cellulase genes (cbhI-eg1 and cbhI-eg ii) derived from trichoderma reesei in a suitable host cell.
According to the method for improving the cellulose degrading capacity of the cellulase, the cbhI gene fragment, the eg1 gene fragment, the cbhI gene fragment and the egII gene fragment are spliced in series to construct a recombinant plasmid for over-expressing cbhI-eg1 and cbhI-egII fusion genes, and the recombinant plasmid is transferred into a proper microbial host cell for expression.
Wherein, the nucleotide sequence of the cbhI gene segment is shown as SEQ ID No. 1:
CAGTCGGCCTGCACTCTCCAATCGGAGACTCACCCGCCTCTGACATGGCAGAAATGCTCGTCTGGTGGCACGTGCACTCAACAGACAGGCTCCGTGGTCATCGACGCCAACTGGCGCTGGACTCACGCTACGAACAGCAGCACGAACTGCTACGATGGCAACACTTGGAGCTCGACCCTATGTCCTGACAACGAGACCTGCGCGAAGAACTGCTGTCTGGACGGTGCCGCCTACGCGTCCACGTACGGAGTTACCACGAGCGGTAACAGCCTCTCCATTGGCTTTGTCACCCAGTCTGCGCAGAAGAACGTTGGCGCTCGCCTTTACCTTATGGCGAGCGACACGACCTACCAGGAATTCACCCTGCTTGGCAACGAGTTCTCTTTCGATGTTGATGTTTCGCAGCTGCCGTGCGGCTTGAACGGAGCTCTCTACTTCGTGTCCATGGACGCGGATGGTGGCGTGAGCAAGTATCCCACCAACACCGCTGGCGCCAAGTACGGCACGGGGTACTGTGACAGCCAGTGTCCCCGCGATCTGAAGTTCATCAATGGCCAGGCCAACGTTGAGGGCTGGGAGCCGTCATCCAACAACGCGAACACGGGCATTGGAGGACACGGAAGCTGCTGCTCTGAGATGGATATCTGGGAGGCCAACTCCATCTCCGAGGCTCTTACCCCCCACCCTTGCACGACTGTCGGCCAGGAGATCTGCGAGGGTGATGGGTGCGGCGGAACTTACTCCGATAACAGATATGGCGGCACTTGCGATCCCGATGGCTGCGACTGGAACCCATACCGCCTGGGCAACACCAGCTTCTACGGCCCTGGCTCAAGCTTTACCCTCGATACCACCAAGAAATTGACCGTTGTCACCCAGTTCGAGACGTCGGGTGCCATCAACCGATACTATGTCCAGAATGGCGTCACTTTCCAGCAGCCCAACGCCGAGCTTGGTAGTTACTCTGGCAACGAGCTCAACGATGATTACTGCACAGCTGAGGAGGCAGAATTCGGCGGATCCTCTTTCTCAGACAAGGGCGGCCTGACTCAGTTCAAGAAGGCTACCTCTGGCGGCATGGTTCTGGTCATGAGTCTGTGGGATGATTACTACGCCAACATGCTGTGGCTGGACTCCACCTACCCGACAAACGAGACCTCCTCCACACCCGGTGCCGTGCGCGGAAGCTGCTCCACCAGCTCCGGTGTCCCTGCTCAGGTCGAATCTCAGTCTCCCAACGCCAAGGTCACCTTCTCCAACATCAAGTTCGGACCCATTGGCAGCACCGGCAACCCTAGCGGCGGCAACCCTCCCGGCGGAAACCCGCCTGGCACCACCACCACCCGCCGCCCAGCCACTACCACTGGAAGCTCTCCCGGACCTACCCAGTCTCACTACGGCCAGTGCGGCGGTATTGGCTACAGCGGCCCCACGGTCTGCGCCAGCGGCACAACTTGCCAGGTCCTGAACCCTTACTACTCTCAGTGCCTGTAG
the nucleotide sequence of the eg1 gene fragment is shown as SEQ ID No. 2:
CAGCAACCGGGTACCAGCACCCCCGAGGTCCATCCCAAGTTGACAACCTACAAGTGTACAAAGTCCGGGGGGTGCGTGGCCCAGGACACCTCGGTGGTCCTTGACTGGAACTACCGCTGGATGCACGACGCAAACTACAACTCGTGCACCGTCAACGGCGGCGTCAACACCACGCTCTGCCCTGACGAGGCGACCTGTGGCAAGAACTGCTTCATCGAGGGCGTCGACTACGCCGCCTCGGGCGTCACGACCTCGGGCAGCAGCCTCACCATGAACCAGTACATGCCCAGCAGCTCTGGCGGCTACAGCAGCGTCTCTCCTCGGCTGTATCTCCTGGACTCTGACGGTGAGTACGTGATGCTGAAGCTCAACGGCCAGGAGCTGAGCTTCGACGTCGACCTCTCTGCTCTGCCGTGTGGAGAGAACGGCTCGCTCTACCTGTCTCAGATGGACGAGAACGGGGGCGCCAACCAGTATAACACGGCCGGTGCCAACTACGGGAGCGGCTACTGCGATGCTCAGTGCCCCGTCCAGACATGGAGGAACGGCACCCTCAACACTAGCCACCAGGGCTTCTGCTGCAACGAGATGGATATCCTGGAGGGCAACTCGAGGGCGAATGCCTTGACCCCTCACTCTTGCACGGCCACGGCCTGCGACTCTGCCGGTTGCGGCTTCAACCCCTATGGCAGCGGCTACAAAAGCTACTACGGCCCCGGAGATACCGTTGACACCTCCAAGACCTTCACCATCATCACCCAGTTCAACACGGACAACGGCTCGCCCTCGGGCAACCTTGTGAGCATCACCCGCAAGTACCAGCAAAACGGCGTCGACATCCCCAGCGCCCAGCCCGGCGGCGACACCATCTCGTCCTGCCCGTCCGCCTCAGCCTACGGCGGCCTCGCCACCATGGGCAAGGCCCTGAGCAGCGGCATGGTGCTCGTGTTCAGCATTTGGAACGACAACAGCCAGTACATGAACTGGCTCGACAGCGGCAACGCCGGCCCCTGCAGCAGCACCGAGGGCAACCCATCCAACATCCTGGCCAACAACCCCAACACGCACGTCGTCTTCTCCAACATCCGCTGGGGAGACATTGGGTCTACTACGAACTCGACTGCGCCCCCGCCCCCGCCTGCGTCCAGCACGACGTTTTCGACTACACGGAGGAGCTCGACGACTTCGAGCAGCCCGAGCTGCACGCAGACTCACTGGGGGCAGTGCGGTGGCATTGGGTACAGCGGGTGCAAGACGTGCACGTCGGGCACTACGTGCCAGTATAGCAACGACTACTACTCGCAATGCCTTTAG
the nucleotide sequence of the egII gene fragment is shown as SEQ ID No. 3:
CAGCAGACTGTCTGGGGCCAGTGTGGAGGTATTGGTTGGAGCGGACCTACGAATTGTGCTCCTGGCTCAGCTTGTTCGACCCTCAATCCTTATTATGCGCAATGTATTCCGGGAGCCACTACTATCACCACTTCGACCCGGCCACCATCCGGTCCAACCACCACCACCAGGGCTACCTCAACAAGCTCATCAACTCCACCCACGAGCTCTGGGGTCCGATTTGCCGGCGTTAACATCGCGGGTTTTGACTTTGGCTGTACCACAGATGGCACTTGCGTTACCTCGAAGGTTTATCCTCCGTTGAAGAACTTCACCGGCTCAAACAACTACCCCGATGGCATCGGCCAGATGCAGCACTTCGTCAACGACGACGGGATGACTATTTTCCGCTTACCTGTCGGATGGCAGTACCTCGTCAACAACAATTTGGGCGGCAATCTTGATTCCACGAGCATTTCCAAGTATGATCAGCTTGTTCAGGGGTGCCTGTCTCTGGGCGCATACTGCATCGTCGACATCCACAATTATGCTCGATGGAACGGTGGGATCATTGGTCAGGGCGGCCCTACTAATGCTCAATTCACGAGCCTTTGGTCGCAGTTGGCATCAAAGTACGCATCTCAGTCGAGGGTGTGGTTCGGCATCATGAATGAGCCCCACGACGTGAACATCAACACCTGGGCTGCCACGGTCCAAGAGGTTGTAACCGCAATCCGCAACGCTGGTGCTACGTCGCAATTCATCTCTTTGCCTGGAAATGATTGGCAATCTGCTGGGGCTTTCATATCCGATGGCAGTGCAGCCGCCCTGTCTCAAGTCACGAACCCGGATGGGTCAACAACGAATCTGATTTTTGACGTGCACAAATACTTGGACTCAGACAACTCCGGTACTCACGCCGAATGTACTACAAATAACATTGACGGCGCCTTTTCTCCGCTTGCCACTTGGCTCCGACAGAACAATCGCCAGGCTATCCTGACAGAAACCGGTGGTGGCAACGTTCAGTCCTGCATACAAGACATGTGCCAGCAAATCCAATATCTCAACCAGAACTCAGATGTCTATCTTGGCTATGTTGGTTGGGGTGCCGGATCATTTGATAGCACGTATGTCCTGACGGAAACACCGACTGGCAGTGGTAACTCATGGACGGACACATCCTTGGTCAGCTCGTGTCTCGCAAGAAAGTAG
according to the specific embodiment of the invention, primers are designed, a cbh1 gene fragment, a egI gene fragment and an egII gene fragment are amplified from the cDNA of Trichoderma reesei TU-6, and then a cbh1 gene fragment, a egI gene fragment and an egII gene fragment are respectively connected by an Over-lap PCR method to obtain a cbhI-egI and a cbhI-egII fusion fragment. At the same time, the fusion fragment and pPIC9 gamma plasmid vector are respectively subjected to double enzyme digestion of SnaB I and Not I, and the three fragments are recovered by electrophoresis. The recovered fragment pPIC9 gamma was ligated with cbhI-egI and cbhI-egII recovered fragment, respectively, by DNA ligase, followed by transformation of E.coli Trans1 competent. Transformants on the screening plate are picked, and the cbhI-egI and cbhI-egII are verified to be successfully recombined on the pPIC9 gamma plasmid respectively by a PCR (polymerase chain reaction) and plasmid sequencing method. The transformant containing the recombinant plasmid was inoculated, recombinant plasmids pPIC9 γ -cbhI-egI and pPIC9 γ -cbhI-egII were extracted, and then the Pichia pastoris GS115 strain was transformed. Screening positive transformants successfully expressing the CBHI-EGI and CBHI-EGII fusion proteins by a method for measuring enzyme activity. After transformants expressing the fusion cellulase CBHI-EGI and CBHI-EGII are induced and cultured in a BMMY culture medium for 2 days, the filter paper enzyme activities of the cellulases are 5583U/mu mol and 8405U/mu mol respectively; the PASC enzyme activity is 5053U/mu mol and 14272U/mu mol respectively; the CMC enzyme activity is respectively as follows: 11939U/μmol and 18594U/μmol; the enzyme activity of the barley glucan is respectively as follows: 14023U/. mu.mol and 29783U/. mu.mol; the activity of the enzyme is improved by about 1 to 3 times compared with the enzyme activity of the synergistic action of two single enzymes.
Drawings
FIG. 1 shows the pPIC9 gamma-cbhI-egI and pPIC9 gamma-cbhI-egII recombinant plasmid constructs;
FIG. 2 shows pPIC9 γ -cbhI-egI and pPIC9 γ -cbhI-egII recombinant plasmid restriction enzyme validation, M: molecular weight of DNA; 1, 3 and 5 are respectively an uncleaved enzyme plasmid pPIC9 gamma, a recombinant plasmid pPIC9 gamma-cbhI-egI and a recombinant plasmid pPIC9 gamma-cbhI-egII; 2, 4 and 6 are plasmids pPIC9 gamma, pPIC9 gamma-cbhI-egI and pPIC9 gamma-cbhI-egII which are subjected to double enzyme digestion respectively;
FIG. 3 shows cellulase enzyme activity assay of transformant shake flask fermentation broth, A: activating the filter paper enzyme; b: PASC enzyme activity; c: CMC-Na enzyme activity; d: barley glucanase activity.
Detailed Description
Example 1 construction of recombinant plasmids pPIC9 γ -cbhI-egI and pPIC9 γ -cbhI-egII expressing cellulase derived from Trichoderma reesei
pPIC9 gamma-cbhI-egI and pPIC9 gamma-cbhI-egII were constructed, transferred into Pichia pastoris GS115 strain, transcribed mRNA and translated into CBHI-EGI and CBHI-EGII fusion proteins under the drive of AOX1 promoter.
A schematic diagram of the plasmid construction of pPIC9 γ -cbhI-egI is shown in FIG. 1.
Amplification of cbhI Gene fragment
Using cDNA of Trichoderma reesei Tu-6 as template, and Trcbh1(SnaBI) F (5'-GGTACGTACAGTCGGCCTGCACTCTCCAATCGGAG-3') and Trcbh1-eg1R (5'-GGTACCCGGTTGCTGCAGGCACTGAGAGTAGTAAGGGT-3') or Trcbh1-eg2R (5' -CCAGACAGTCTGCTGCAGGCACTGAGAGTAGTAAGGGT-3') as primers to amplify the cbhI gene segment.
The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; 94 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 1min, 32 cycles; multiplying by 72 ℃ for 10 min; storing at 4 ℃. The DNA was purified by electrophoresis on a 1% agarose gel and the band of interest in the PCR product was excised.
egI amplification of Gene fragment
In Lee's diseaseThe cDNA of Trichoderma Tu-6 as template and Treg1F (5'-TACTCTCAGTGCCTGCAGCAACCGGGTACCAGCACCCC-3') and Treg1(NotI) R (5-GGGCGGCCGCTTAGTGGTGGTGGTGGTGGTGAAGGCATTGCGAGTAGTAGTCGTTGC-3') is used as a primer pair for amplifying the egI gene fragment.
The PCR reaction conditions are as follows: multiplying at 95 ℃ for 5 min; 94 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 1min, 32 cycles; multiplying by 72 ℃ for 10 min; storing at 4 ℃. The DNA was purified by electrophoresis on a 1% agarose gel and the band of interest in the PCR product was excised.
Amplification of egII Gene fragments
Using cDNA of Trichoderma reesei Tu-6 as template and Treg2F (5-TACTCTCAGTGCCTGCAGCAGACTGTCTG GGGCCAGTGT-3') and Treg2(NotI) R (5-GGGCGGCCGCTTAGTGGTGGTGGTGGTGGTGCTTTCTTGCGAGA CACGAGCTGACC-3') is used as a primer pair for amplifying egI gene fragments.
The PCR reaction conditions are as follows: x 5min at 95 ℃; 94 ℃ multiplied by 30s, 55C multiplied by 30s, 72 ℃ multiplied by 1min, 32 cycles; multiplying by 72 ℃ for 10 min; storing at 4 ℃. The DNA was purified by electrophoresis on a 1% agarose gel and the band of interest in the PCR product was excised.
Construction of pPIC9 gamma-cbhI-egI and pPIC9 gamma-cbhI-egII plasmids
The cbh1 gene fragment and the egI gene fragment or the egII gene fragment obtained by amplification from the cDNA of Trichoderma reesei TU-6 are spliced with the egI gene fragment and the egII gene fragment respectively by an Over-lap PCR method to obtain cbhI-egI and cbhI-egII fusion fragments. And simultaneously carrying out double enzyme digestion on the fusion fragment and the pPIC9 gamma plasmid vector to obtain SnaB I and Not I, and recovering the three fragments by electrophoresis. The recovered fragment pPIC9 gamma was ligated with cbhI-egI and cbhI-egII fragments at a molar ratio of 3:1, respectively, by DNA ligase, and transformed into E.coli Trans1 competent. Transformants on the screening plate are picked, and the cbhI-egI and cbhI-egII are verified to be recombined on the pPIC9 gamma plasmid respectively by a PCR (polymerase chain reaction) and plasmid sequencing method, so that the recombinant plasmids pPIC9 gamma-cbhI-egI and pPIC9 gamma-cbhI-egII (shown in figure 1) are successfully obtained. The transformant containing the recombinant plasmid was inoculated into 50ml of LB medium containing ampicillin and cultured at 37 ℃ and 180rpm for 16 hours. The recombinant plasmid is extracted for transformation.
Example 2 double restriction enzyme validation of the recombinant plasmids pPIC9 gamma-cbhI-egI and pPIC9 gamma-cbhI-egII
Carrying out double enzyme digestion on the pPIC9 gamma plasmid, the pPIC9 gamma-cbhI-egI recombinant plasmid and the pPIC9 gamma-cbhI-egII recombinant plasmid respectively; 20 μ l reaction: mu.l of SnaB I, 1. mu.l of Not I, 2. mu.l of 10 XBuffer, 10. mu.l of plasmid and 6. mu.l of ddH 2 O, reacting for 3 hours in a water area at 30 ℃. Mu.l of the digested product and the plasmid not digested were electrophoresed on a 1% agarose gel, and DNA bands of the same size as expected were present on the digested plasmid (FIG. 2).
EXAMPLE 3 transformation of Pichia pastoris GS115 Strain with pPIC9 γ -cbhI-egI and pPIC9 γ -cbhI-egII plasmids and screening of Positive transformants
Transformation of Pichia pastoris GS115 strain
The pPIC9 gamma-cbhI-egI and pPIC9 gamma-cbhI-egII plasmids were transformed into the Pichia pastoris GS115 strain.
Induction culture of transformants
Picking the transformant on the MD plate by using the sterilized toothpicks, sequentially placing the toothpicks with the bacteria into a centrifuge tube of 3ml BMGY culture medium, and carrying out shake culture in a shaking table at 30 ℃ and 220rpm for 48 h; centrifuging the bacterial solution cultured in the centrifuge tube at 4,500rpm for 5min, gently discarding the supernatant, adding 1ml BMMY culture medium into the thallus, and performing induced culture in a shaking table at 30 ℃ and 220rpm for 48 h; transferring the culture solution of the induced transformant into a 2mL Eppendorf tube, centrifuging at 12,000rpm for 2min, collecting the supernatant (namely fermentation liquor) for enzyme activity detection of cellulase, and screening out the expression strain with enzyme activity.
The MD medium comprises the following components: 2% glucose, 20% agarose, sterilized at 115 ℃ for 30min, cooled and added with the corresponding volumes of filtered 10 XYNB (13.4mg/ml) and 1000 Xbiotin (0.4 mg/ml);
the BMGY medium comprises the following components: 2% peptone, 1% yeast powder, 1% glycerol, sterilized at 121 ℃ for 20min, cooled and added with filtered 10 XYNB (13.4mg/ml) and 1000 Xbiotin (0.4mg/ml) in the corresponding volumes;
the BMMY culture medium comprises the following components: 2% peptone, 1% yeast powder, sterilized at 121 ℃ for 20min, after cooling, the corresponding volumes of filtered 10 XYNB (13.4mg/ml) and 1000 Xbiotin (0.4mg/ml) and 0.5% methanol were added.
Screening for Positive transformants
Mu.l of the fermentation broth was taken and reacted in 900. mu.l of 10mg/ml barley glucan substrate at pH 5.0 and 50 ℃ for 10min, 1.5ml DNS was added, boiled in boiling water for 10min, immediately cooled to room temperature in ice water, and the absorbance was measured at 540 nm. And comparing the absorbance values of different transformants, thereby screening the expression strains (CBHI-EGI and CBHI-EGII) with higher enzyme activity.
Example 4 Induction culture of transformants and cellulase Activity measurement
Induction culture of transformants
Positive transformants encoding CBHI-EGI and CBHI-EGII with higher enzyme activities were cultured in 50ml YPD medium at 30 ℃ and 180rpm for 2 days. Mu.l of the culture medium was transferred to 300ml of BMGY medium and cultured at 30 ℃ and 180rpm for 2 days. Mu.l of BMGY culture medium was transferred to 100ml of BMMY medium and further cultured at 30 ℃ and 180rpm for 2 days under methanol induction. Transferring the culture solution of the induced transformant into a 250mL centrifuge tube, centrifuging at 12,000rpm for 10min, and collecting the supernatant (namely fermentation liquor) for enzyme activity detection of the cellulase.
The YPD medium comprises the following components: 2% peptone, 2% glucose, 1% yeast powder, sterilizing at 115 deg.C for 30 min.
Cellulase Activity assay
The cellulase activity was determined on the fermentation broth of the positive transformants having higher enzyme activity (CBHI-EGI and CBHI-EGII). Respectively measuring the enzyme activity of the cellulase filter paper, the enzyme activity of PASC, the enzyme activity of CMC-Na and the enzyme activity of barley glucan.
Determination of cellulase filter paper enzyme activity: the filter paper enzyme activity (FPase activity) of the cellulase was determined using Whatman filter paper according to IUPAC standard method. Whatman No.1 filter paper was made into a shape of 6cm long and 1cm wide (about 50 mg), and folded 4-fold to form an M-shape. Placing the filter paper strip at the bottom of the test tube, adding 1.5ml of citric acid-disodium hydrogen phosphate buffer (0.05M, pH 5.0.0) containing 0.05% sodium benzoate, balancing in a water bath at 50 deg.C, adding 0.5ml of diluted enzyme solution (blank is not added), mixing, and soaking the filter paper in the solution in the tube. Keeping the temperature in a water bath at 50 ℃ for 1 hour, and rapidly cooling. 3ml DNS reagent is added into each test tube, 0.5ml enzyme solution is added into blank, and the mixture is mixed evenly. Decocting in boiling water for 10min, rapidly cooling, and diluting with distilled water to 25 ml. Absorbance at 540nm was measured with reference to a 0-tube. The amount of enzyme required to hydrolyze the filter paper substrate per hour at 50 ℃ and pH 5.0 with 1. mu. mol of liquid enzyme to produce 1. mu. mol of reducing sugar (in terms of glucose) is defined as one enzyme activity unit (U). The results of the enzyme activity measurement are shown in FIG. 3 (A). The results show that the specific activities of the CBHI, EgI, EgII, CBHI-EgI, CBHI + EgII and CBHI-EgII degraded filter paper are respectively: 1396U/. mu.mol, 4795U/. mu.mol, 1578U/. mu.mol, 5582U/. mu.mol, 3320U/. mu.mol, and 8405U/. mu.mol. As can be seen from the results, the specific activities of CBHI-EgI and CBHI-EgII were both significantly improved compared to CBHI, EgI and EgII, and the specific activities of CBHI-EgII were 2.5 times higher than CBHI + EgII.
Determination of enzymatic activity of cellulase PASC: the measurement was carried out using swelling cellulose (PASC) as a substrate. 10g of microcrystalline cellulose Avicel were added to 250ml of 85% H 3 PO 4 Stirring the solution for 1h at 4 ℃; adding into 4L of precooled water, and standing at 4 deg.C for 30 min; obliquely pouring into a centrifuge tube, removing large-block precipitates, centrifuging at 4 ℃ and 2000rpm for 10min, and discarding the supernatant; with 1% NaHCO 3 Centrifuging at 4 deg.C and 2000rpm for 10min, and removing supernatant; the final concentration was determined by suspending 100ml of citric acid-disodium hydrogen phosphate buffer (0.05M, pH 5.0.0) containing 0.05% sodium benzoate and taking 1ml of sample, 3 replicates. After equilibrating 0.9ml of PASC solution in each tube in a 50 ℃ water bath, 0.5ml of diluted enzyme solution (blank was not added first) was added and mixed well. Keeping the temperature in 50 deg.C water bath for 60min, and rapidly cooling. 1.5ml DNS reagent is added into each test tube, 0.1ml enzyme solution is added into blank, and the mixture is mixed evenly. Decocting in boiling water for 10min, and rapidly cooling. Measuring absorbance at 540nm with 0 # tube as reference. The amount of enzyme required to hydrolyze sodium carboxymethylcellulose per hour at 50 ℃ and pH 5.0 with 1. mu. mol of liquid enzyme to produce 1. mu. mol of reducing sugar (in terms of glucose) is defined as one enzyme activity unit (U). The results of the enzyme activity measurement are shown in FIG. 3 (B). The results show that the specific activities of the CBHI, EgI, EgII, CBHI-EgI, CBHI + EgII and CBHI-EgII degraded filter papers are respectively as follows: 1853U/. mu.mol, 3372U/. mu.mol, 2934U/. mu.mol, 5052U/. mu.mol, 5719U/. mu.mol, and 14272U/. mu.mol. As can be seen from the results, the specific activities of CBHI-EgI and CBHI-EgII were both significantly improved compared to CBHI, EgI and EgII, and the specific activities of CBHI-EgII were 2.5 times higher than CBHI + EgII.
And (3) enzyme activity determination of cellulose CMC-Na: the assay was performed using sodium carboxymethylcellulose (CMC-Na) as substrate. 1000mg of sodium carboxymethylcellulose was taken, and the volume was adjusted to 50ml with a citric acid-disodium hydrogenphosphate buffer (0.05M, pH 5.0.0) to obtain a 2% sodium carboxymethylcellulose solution. The sodium carboxymethyl cellulose solution should be used immediately and shaken well before use. Storing at 4 deg.C in dark place with a shelf life of 3 days. Mu.l of the enzyme solution was taken and added to 10ml of citric acid-disodium hydrogenphosphate buffer (0.05M, pH 5.0.0) to obtain an enzyme solution diluted 101 times. 0.45ml of each of a 2% sodium carboxymethylcellulose solution and a citric acid-disodium hydrogenphosphate buffer (0.05M, pH 5.0.0) was added to each test tube, and after equilibration in a water bath at 50 ℃, 0.1ml of the diluted enzyme solution (blank was not added) was added thereto, followed by shaking and mixing. Keeping the temperature in 50 ℃ water bath for 30min, and rapidly cooling. 1.5ml DNS reagent is added into each test tube, 0.1ml enzyme solution is added into blank, and the mixture is mixed evenly. Decocting in boiling water for 10min, and rapidly cooling. Absorbance at 540nm was measured with reference to a 0-tube. The amount of enzyme required to hydrolyze sodium carboxymethylcellulose per hour at 50 ℃ and pH 5.0 with 1. mu. mol of liquid enzyme to produce 1. mu. mol of reducing sugar (in terms of glucose) is defined as one enzyme activity unit (U). The results of the enzyme activity measurement are shown in FIG. 3 (C). The results show that the specific activities of the CBHI, EgI, EgII, CBHI-EgI, CBHI + EgII and CBHI-EgII degraded filter paper are respectively: 4936U/. mu.mol, 5379U/. mu.mol, 4236U/. mu.mol, 11939U/. mu.mol, 10082U/. mu.mol and 18594U/. mu.mol. As can be seen from the results, the specific activities of CBHI-EgI and CBHI-EgII were both significantly improved compared to CBHI, EgI and EgII, and the specific activities of CBHI-EgII were 1.8 times higher than CBHI + EgII.
Determination of cellulase barley glucanase activity: the assay was performed using Barley glucan (Barley glucan) as a substrate. The specific method comprises the following steps: weighing 1g of barley dextran, dissolving with 100ml of citric acid-disodium hydrogen phosphate buffer (0.05M, pH 5.0), decocting in boiling water for 2min to ensure complete dissolution, cooling immediately, and diluting to 100ml to obtain 1% barley dextran solution. Adding diluted 100 μ L enzyme solution into 900 μ L1% barley dextran substrate, adding 100 μ L inactivated enzyme solution into control group, placing in 50 deg.C water bath, maintaining temperature for 10min, adding 1.5mL DNS to terminate reaction, boiling for 5min, cooling to room temperature, and measuring OD value at 540 nm. The amount of enzyme required to hydrolyze sodium carboxymethylcellulose per hour at 50 ℃ and pH 5.0 with 1. mu. mol of liquid enzyme to produce 1. mu. mol of reducing sugar (in terms of glucose) is defined as one enzyme activity unit (U). The results of the enzyme activity measurement are shown in FIG. 3 (D). The results show that the specific activities of the CBHI, EgI, EgII, CBHI-EgI, CBHI + EgII and CBHI-EgII degraded filter paper are respectively: 3458U/. mu.mol, 8041U/. mu.mol, 6438U/. mu.mol, 14023U/. mu.mol, 13674U/. mu.mol and 29783U/. mu.mol. As can be seen from the results, the specific activities of CBHI-EgI and CBHI-EgII were both significantly improved compared to CBHI, EgI and EgII, and the specific activities of CBHI-EgII were 2.2 times higher than CBHI + EgII.
Claims (4)
1. A method for obtaining a high-activity Trichoderma reesei fusion cellulase, comprising the step of fusion expressing a cellulase cbhI gene fragment and an egII gene fragment from Trichoderma reesei in a host cell,
the cbh1 gene fragment and the egII gene fragment are directly spliced to obtain a cbhI-egII fusion fragment, the nucleotide sequence of the cellulase cbhI gene fragment is shown as SEQ ID NO.1, and the nucleotide sequence of the eg1I gene fragment is shown as SEQ ID NO. 3.
2. The method for obtaining high-activity trichoderma reesei fusion cellulase according to claim 1, wherein the host cell is pichia pastoris, trichoderma reesei, aspergillus niger or aspergillus oryzae.
3. A recombinant strain expressing a high-activity Trichoderma reesei cellulase fusion enzyme, characterized in that, the step of fusion expressing a cellulase cbhI gene fragment and eg1I gene fragment from Trichoderma reesei in the recombinant cell,
the cbh1 gene fragment and the egII gene fragment are directly spliced to obtain a cbhI-egII fusion fragment, the nucleotide sequence of the cellulase cbhI gene fragment is shown as SEQ ID NO.1, and the nucleotide sequence of the egII gene fragment is shown as SEQ ID NO. 3.
4. The recombinant strain expressing high-activity trichoderma reesei fusion cellulase according to claim 3, wherein the recombinant strain is recombinant pichia pastoris, recombinant trichoderma reesei, recombinant aspergillus niger or recombinant aspergillus oryzae.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510895568.9A CN105296451B (en) | 2015-12-08 | 2015-12-08 | Method for obtaining high-activity trichoderma reesei fusion cellulase and recombinant strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510895568.9A CN105296451B (en) | 2015-12-08 | 2015-12-08 | Method for obtaining high-activity trichoderma reesei fusion cellulase and recombinant strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105296451A CN105296451A (en) | 2016-02-03 |
| CN105296451B true CN105296451B (en) | 2022-08-05 |
Family
ID=55194283
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510895568.9A Active CN105296451B (en) | 2015-12-08 | 2015-12-08 | Method for obtaining high-activity trichoderma reesei fusion cellulase and recombinant strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105296451B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868034B (en) * | 2017-04-17 | 2019-09-10 | 湖北工业大学 | A kind of method that large fragment gene integration improves trichoderma reesei cellulase enzyme activity |
| CN107022560B (en) * | 2017-04-17 | 2019-09-10 | 湖北工业大学 | A kind of method that large fragment gene integration improves aspergillus niger cellulose enzyme activity |
| CN109971784A (en) * | 2018-09-26 | 2019-07-05 | 天津科技大学 | Heterogenous expression endoglucanase EG II in a kind of Pichia pastoris, the construction method of EG IV, EG V |
| CN110981965B (en) * | 2019-11-06 | 2022-11-15 | 天津科技大学 | Fusion protein for improving lignocellulose hydrolysis rate, construction method, expression and application |
-
2015
- 2015-12-08 CN CN201510895568.9A patent/CN105296451B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| CBHⅡ和EGⅣ的重构基因在里氏木霉中的组成型表达;曾敏等;《食品研究与开发》;20150731;全文，特别是摘要 * |
| 里氏木霉纤维二糖水解酶基因cbhl的分子改造;陈小玲等;《南方农业学报》;20141231;1739—1743 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105296451A (en) | 2016-02-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chadha et al. | Thermostable xylanases from thermophilic fungi and bacteria: current perspective | |
| Zhang et al. | Improvement of cellulase production in Trichoderma reesei Rut-C30 by overexpression of a novel regulatory gene Trvib-1 | |
| Zhang et al. | Development of the cellulolytic fungus Trichoderma reesei strain with enhanced β-glucosidase and filter paper activity using strong artifical cellobiohydrolase 1 promoter | |
| CN105296451B (en) | Method for obtaining high-activity trichoderma reesei fusion cellulase and recombinant strain | |
| CN105238704A (en) | Method for rapidly improving enzyme activity of Trichoderma reesei cellulase | |
| US10457925B2 (en) | Process for the production of cellulolytic and/or hemicellulolytic enzymes | |
| Long et al. | Enhancing cellulase and hemicellulase production in Trichoderma orientalis EU7-22 via knockout of the creA | |
| CN104975039A (en) | Recombinant plasmid and application of recombinant plasmid to degrading cellulose raw material | |
| CN104046605A (en) | Mesophile ethanol-tolerant beta-glucosidase, and coding gene and application thereof | |
| CN107129976A (en) | A kind of neutral high-temperature xylanase and its encoding gene and its application | |
| CN101955952B (en) | Bacterial laccase gene and expression and application thereof | |
| CN103614354B (en) | A kind of saccharifying enzyme and recombinant strains thereof | |
| CN102994476B (en) | Saccharifying enzyme | |
| CN105602919A (en) | Method for improving capacity of Trichoderma reesei in producing cellulase by using RNA interference technology | |
| CN111117986B (en) | Encoding gene of calcium-dependent heat-resistant alpha-L-arabinofuranosidase, preparation technology and application | |
| CN114107360B (en) | Method for improving cellulase expression of trichoderma reesei by interfering phosphatase gene | |
| CN114107359B (en) | Method for improving cellulase expression capability of trichoderma reesei by regulating cell metabolism | |
| CN107236680B (en) | Pichia pastoris recombinant bacterium for expressing Streptomyces sp.FA1-derived xylanase | |
| CN111733169B (en) | Element for regulating and controlling fungal lignocellulose degradation enzyme system expression and application thereof | |
| CN102952790B (en) | Multifunctional cellulose as well as expression gene and application thereof | |
| CN113980939B (en) | Glucose-resistant beta-glucosidase, and expression gene and application thereof | |
| CN102392003B (en) | Application of EDTA (ethylene diamine tetraacetic acid) in improving exocytosis volume and expression volume of escherichia coli recombinant protein | |
| CN101503660B (en) | Engineering bacteria expressing thermophilic saccharifying enzyme and use thereof | |
| KR101350955B1 (en) | Novel exoglucanase and the Use thereof | |
| CN111088244B (en) | Application of protease gene in promotion of cellulase production and complex nitrogen source utilization |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200819 Address after: 100193 Beijing Old Summer Palace West Road, Haidian District, No. 2 Applicant after: INSTITUTE OF ANIMAL SCIENCES, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Address before: 100081 Beijing, Zhongguancun, South Street, No. 12, No. Applicant before: FEED Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |