CN105274234B - From sea island cotton molecular labeling related with fiber strength and its application - Google Patents
From sea island cotton molecular labeling related with fiber strength and its application Download PDFInfo
- Publication number
- CN105274234B CN105274234B CN201510753375.XA CN201510753375A CN105274234B CN 105274234 B CN105274234 B CN 105274234B CN 201510753375 A CN201510753375 A CN 201510753375A CN 105274234 B CN105274234 B CN 105274234B
- Authority
- CN
- China
- Prior art keywords
- sea
- cotton
- fiber
- molecular labeling
- fiber strength
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to molecular breeding technology fields, and in particular to from extra large 1 molecular labeling related with fiber strength of sea island cotton and its application.The molecular labeling is HAU0848370 and HAU0120100.The present invention helps that existing breeding technique is overcome to identify existing deficiency to fiber quality, can improve the efficiency of selection of fiber strength, accelerate the cultivation process of new quality variety.
Description
Technical field
The present invention relates to Molecular breeding in upland cotton technical fields, and in particular to has to from sea island cotton sea 1 with fiber strength
The molecular labeling of pass and its application.
Background technology
With the development of textile industry and the raising of living standards of the people, to cotton fiber quality character, especially to fibre
Tie up intensity, more stringent requirements are proposed for fineness, it is desirable that cultivate stronger, thinner and more neat new cotton variety (Xiang Shikang,
Deng 1999).The fiber quality characteristics of cotton belong to the quantitative character of controlled by multiple genes.Majority fibers quality trait with it is yield
There is notable or not notable negative correlation between shape, difficulty is brought to cotton fiber quality improvement synchronous with yield.Currently I
State's self-fertile kind is outstanding the disadvantage is that fibre strength is poor, fineness is partially thick.It is excellent to lack Comprehensive Traits for the narrow scope of variety source
Good ideal kind and breeding technique backwardness are the main reason for causing cotton breeding to fluctuate.Sea island cotton has excellent
Fiber quality, but low output, and Upland Cotton Yield is high, planting range is wide, but fiber quality is general, thus takes effective measures
It excavates the favorable genes of sea island cotton and is transferred in upland cotton, synchronizing improvement to China's upland cotton fiber quality and yield has emphatically
The meaning wanted.Using traditional breeding method, the quality selection of each generation is all needed until collecting cotton progress after cotton boll blowing
It could be determined after fiber quality detection, and fiber quality characteristics are affected by environment larger so that Phenotypic Selection accuracy is poor, all
Phase is long, efficiency is low, and Advances in Breeding is slow.
The cotton fibre quality improvement that develops into of molecular biology and quantitative character gene locus therefor drawing method has provided
Effect means.Using the molecular labeling with target QTL close linkages, objective trait is tracked and is selected, can be reduced in breeding process
The blindness of selection is conducive to break Linkage drag.The genotype of objective trait is directly selected by molecular labeling, no
It must consider plant growth period and developmental condition, can be selected in early days, and can reduce and come from same site difference equipotential base
Interfering with each other between the non-allelic genes of cause or different loci is conducive to quickly build collection target gene, accelerates back cross breeding process,
Overcome the unfavorable linkage of characters, highly shortened breeding time, reduces group's planting scale.Molecular marker assisted selection is to same
Step improvement fiber quality and yield, multiple characters gene pyramiding, quickly breeding new cotton variety etc. have being unsurpassed in excellence property.
Very big progress is achieved in terms of QTL using different mapping population localized fiber quality traits, is fiber
The molecular marker assisted selection of quality trait is laid a good foundation, but applied to QTLs in molecular marker assisted selection breeding
Or chain molecular labeling is seldom therewith.
In the research of forefathers majority be utilize segregating population, or only under single environment detection obtain as a result, therefore lacking
Weary stability and reliability, and some are studied initial purpose and are intended merely to carry out the positioning of target gene, in experiment material
It does not account for being combined with breeding material in selection, is also difficult to be applied in breeding.Introgressed line (or introgressive line, it is called chromosome
Segment substitution line CSSLs), the chromosome segment of a small number of donor parents, most of genetic background and receptor are contained only in genome
Parent is consistent, reduces the interference of genetic background, is the ideal material of QTL Position Research.
The present invention identifies the fiber strength of multi-environment stabilization using the land-sea Introgressed line of upland cotton precocity background as material
QTLs and its close linkage molecular labeling, and go out the strain that fiber strength is improved using these molecular marker screenings
System.
Invention content
In order to overcome in traditional breeding method Phenotypic Selection accuracy is poor, the period is long, efficiency is low, etc. many disadvantages, solve fiber
The problem of quality breeding is made slow progress.The present invention is samsara parent with the Upland Cotton nakamise 36 for producing upper large area plantation
This, sea island cotton strain sea 1 is donor parents, constructs land-sea Introgressed line group, and carried out multi-environment yield and quality characters
Evaluation, to excavate the QTL of Island Cotton Fiber quality trait, directly cultivating and lay a good foundation for the new lines of breeding.
The object of the present invention is to provide from extra large 1 molecular labeling related with fiber strength of sea island cotton.
Another object of the present invention is to provide a kind of upland cotton fiber specific strength auxiliary breeding means.
Another object of the present invention is to provide above-mentioned answering from extra large 1 molecular labeling related with fiber strength of sea island cotton
With.
According to the present invention to come from extra large 1 molecular labeling related with fiber strength of sea island cotton, the molecular labeling is
HAU0848370And HAU0120100,
Wherein, the specific primer sequence of each molecular labeling and the target fragment length of amplification are as follows：
①HAU0848370
Forward primer sequence is AATGAGCTATGGTTGGGGTA,
Reverse primer sequences are AACCACACATGCTCAAACAG, and amplifiable length is the DNA fragmentation in the sea 1 of 370bp；
②HAU0120100
Forward primer sequence is GCTGAGTCCACTGATCTGAA,
Reverse primer sequences are CTTCTTAAATGACGCTGCAA, and amplifiable length is the DNA fragmentation in the sea 1 of 100bp.
According to the present invention and upland cotton fiber specific strength auxiliary breeding means, use SSR marker HAU0848370With
HAU0120100Marker-assisted selection is carried out to fiber strength character in the related breeding population with sea island cotton sea 1 etc., can be carried
The fiber strength of high upland cotton.Molecular labeling HAU0848 used in this method370And HAU0120100Respectively with cotton fiber ratio
2 QTLs of strength behavior：(FS is the English word fiber strength of fiber strength by qFS-11-1 and qFS-16-1
Abbreviation；The name of QTL：The sequence of character QTL is controlled on q+ characters title english abbreviation+chromosome serial number+same chromosome
Number, such as：QFS-11-1 indicates the 1st QTL of the control fiber specific strength on Sub_clause 11 chromosome) close linkage.This 2 fibres
Tie up the QTLs of specific strength character：QFS-11-1 and qFS-16-1 is located on chromosome Chr11 and Chr16, all derives from sea
Island cotton sea 1, the contribution rate to cotton fiber specific strength is respectively 2.79-3.32% and 3.76-5.16%, and additive effect is respectively
0.50-0.61cN/tex and 0.70-0.77cN/tex.
The present invention not only facilitates screening overlength fibrous material, for 1 hybridization of the sea of sea island cotton from now on, backcross progeny and its derivative
The fiber strength character breeding utilization of strain provides a great convenience, while being also the finely positioning and gene cloning of QTL
It lays the foundation.
The height of fiber strength can be predicted in seedling stage using the present invention and is eliminated, and then can quickly screen length
The strain of fiber is used for cotton fiber quality breeding, and assistant breeding selection target is clear, cost-effective.By with fiber strength
QTLs close linkages Marker-assisted selection of the molecular labeling in the related breeding population with sea island cotton sea 1 etc., rapidly
The fiber quality for improving existing Upland Cotton, to overcome deficiencies of the prior art.
To achieve the goals above, the invention is realized by the following technical scheme：
The Marker-assisted selection side according to the present invention improved with 1 relevant upland cotton fiber specific strength character of sea island cotton sea
Method uses the SSR marker HAU0848 with the extra large 1 fiber strength character close linkage of sea island cotton370And HAU0120100With island
Marker-assisted selection is carried out in 1 related breeding population of cotton sea, upland cotton cotton fiber specific strength 0.50-0.61cN/tex can be improved
And 0.70-0.77cN/tex.This approach includes the following steps：Seedling stage single plant extracts DNA；Use molecular labeling HAU0848370With
HAU0120100Molecular Detection is carried out to the genotype of group's single plant；Testing result is analyzed；Selection carries sea island cotton sea 1
The plant of characteristic bands, fiber strength of menu strain obtains different degrees of raising in these.
The Upland Cotton that fiber strength is improved is can get by these Marker-assisted selections, accelerates cotton fiber
The breeding process of quality.
Specific implementation mode according to the present invention, the molecular labeling for improving upland cotton fiber specific strength character pass through with lower section
Method is obtained according to the following steps：
(1) use sea island cotton sea 1 for donor parents, precocious " CCRI 36 is receptor parent, assembles land-sea hybridization
Combination is that recurrent parent is returned using nakamise 36, continuous to be selfed, and constructs a set of land-sea Introgressed line material 408；
(2) to 408 Introgressed lines be arranged 3 years five environment (2010 Anyang, Anyang in 2011, Xinjiang and Liaoning, 2014
Year Xinjiang) experiment, the investigation and fiber quality for carrying out Agronomic characteristic measure, and extract each substitution line DNA, use CTAB
Method ((Paterson et al.1993)) and slightly change extraction DNA.
(3) from nakamise 36 × sea 1BC1F1On the High Density Molecular genetic linkage maps of informative population, every about 5-
10cM selects a SSR marker, finally picks out 530 marker sites that can cover whole 26 chromosomes of cotton, is used in combination
It carries out genotype detection to above-mentioned (2) 408 Introgressed line material DNA.
(4) utilize 3 years five environment (2010 Anyang, Anyang in 2011, Xinjiang and Liaoning, Xinjiang in 2014) fiber
The phenotypic data and genotype data of specific strength character, the QTL IciMapping V4.0 softwares developed using Wang Jiankang
(http://www.isbreeding.net/software/), the multi-environment QTL positioning analysis of fiber strength character is carried out,
The fiber strength character QTLs that three environment above obtained are stablized, wherein 2 QTLs are newfound, this 2 QTL are
QFS-11-1 and qFS-16-1 is located on chromosome Chr11 and Chr16, synergy gene all derives from sea island cotton sea 1, right
The contribution rate of cotton fiber specific strength is respectively 2.79-3.32% and 3.76-5.16%, and additive effect is respectively 0.50-
0.61cN/tex and 0.70-0.77cN/tex；With the SSR molecular marker of the QTLs close linkages of this 2 fiber strength characters
Respectively HAU0848370And HAU0120100。
The primer sequence of each molecular labeling and the target fragment length of amplification are as follows：
①HAU0848370
Forward primer sequence is AATGAGCTATGGTTGGGGTA,
Reverse primer sequences are AACCACACATGCTCAAACAG, and amplifiable length is the DNA fragmentation in the sea 1 of 370bp；
②HAU0120100
Forward primer sequence is GCTGAGTCCACTGATCTGAA,
Reverse primer sequences are CTTCTTAAATGACGCTGCAA, and amplifiable length is the DNA fragmentation in the sea 1 of 100bp.
Beneficial effects of the present invention are as follows：
The present invention provides a kind of method for selecting molecular marker improving upland cotton fiber specific strength character, use molecule mark
Remember HAU0848370And HAU0120100Marker-assisted selection is being carried out with the extra large 1 related breeding population of sea island cotton, fibre can be improved
Tie up specific strength 0.50-0.61cN/tex and 0.70-0.77cN/tex.
It can be selected in cotton in seedling stage using these molecular labelings, improve the efficiency of selection of fiber strength character.
The present invention, which not only helps, solves the problems, such as that Cotton in China fiber strength Advances in Breeding is slow, and helps to overcome existing educate
Kind of the technology of high cost, deficiencies such as the time is long, stability is low, accuracy is poor, efficiency is low existing to fiber quality identification, rapidly
The fiber strength for improving existing Upland Cotton greatly speeds up cultivation and the Seed Industrialization of the high good fiber quality new varieties in China
Process.
Specific implementation mode
Below by specific embodiment mode detailed description come the present invention is furture elucidated, but be not to the present invention
Limitation, only illustrates.
Embodiment 1 screens molecular labeling
(1) acquisition of the structure and phenotypic data of Introgressed line
For donor parents, with nakamise 36 it is recurrent parent with sea island cotton sea 1, constructs the high generation backcrossing of land-sea hybridization gradually
Shen Xi groups.Recurrent parent nakamise 36 (CCRI36) is the excellent of the precocity that the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute cultivates
Upland cotton commercial variety (state examine cotton 990007) and donor parents sea 1 (Hai1) is that having with dominant non-gland gene is excellent
The sea island cotton cultigen of the high resistance to verticillium wilt of fiber quality characteristic.
Summer in 2003 assembles nakamise 36 × sea 1F in Earthquake of Anyang station in Henan1, winter in the same year is with nakamise 36 in Sanya, Hainan
Female parent is returned to obtain BC1F1；2004-2008 is recurrent parent by continuous backcross with nakamise 36, and then continuous selfing, obtains
133 BC5F3Family seed.133 BC of plantation in 20095F3Family (about 20 plants, totally 2660 plants of 1 row of each family), by single plant
Unginned cotton is collected, fiber quality is measured, fiber is measured with HVI1000 by fiber quality inspection and supervision inspection center of the Ministry of Agriculture
Upper half mean length, regularity, specific strength, elongation and strength (abbreviation specific strength).Obtain 2660 BC5F3It is single
Strain fiber quality data selects 408 BC altogether according to each families selecting 2-4 plants of principle5F3Single plant (Zhang Jinfeng, etc.,
2012), 2010 in Earthquake of Anyang station in Henan kind at BC5F3:4Plant, row long 5m, line width 80cm, spacing in the rows 25cm carry out field to plant
Investigation and fiber quality measure.Three environment (Earthquake of Anyang station in Henan, Liaoning, Xinjiang) of setting in 2011 are tested, and field planting is using ground
The mode of film covering is sowed, and the double multiple cropping in Anyang and Liaoning uniline area is planted, row long 5m, line width 80cm, spacing in the rows 25cm, Xinjiang stone river
The sub double multiple cropping in 2 row areas is planted, and the long 3m of row, line-spacing is arranged by Xinjiang locality wide-and narrow-row, spacing in the rows 10cm；2014 in 2 row of Xinjiang
The double multiple cropping in area is planted.Field investigation is carried out according to cell and fiber quality measures.Obtain the fiber quality of 3 years five environment
The performance of the data of character, wherein fiber strength is shown in Table 1.
The performance of 36 fiber strength of Introgressed line and nakamise in 1 three years five environment of table
Remarks：AY：Anyang；LN：Liaoning；XJ：Xinjiang
(2) CTAB methods (Paterson et al.1993) and slightly 408 chromosome segment substitution lines of change extraction are used
DNA and parent dna.
(3) Introgressed line genotype molecule detects
With nakamise 36 × sea 1BC1F1For mapping population, the Molecular Linkage Map containing 2292 SSR marker sites is constructed
Spectrum, covers 26 chromosomes of cotton, and for total figure away from 5115.16cM, average distance 2.23cM between label covers entire cotton gene
Group is most wide SSR Genetic Linkage Map spectrum (Shi YZ, the et al.Journal of current covering genetic distance
ofIntegrative Plant Biology,2015,57(5):450-467).The collection of illustrative plates is to carry out full-length genome QTL positioning to establish
Basis is determined.A label is selected per about 5-10cM from above-mentioned Molecular Linkage Map, 530 marker sites are selected altogether, to 408
Introgressed line carries out genotype molecule detection.
Primer gives birth to work by Shanghai and Beijing three is won company and synthesized.
SSR amplification reaction systems be 10 μ 1, wherein 0.50 μ 1 of forward primer (10 μM), 0.50 μ 1 of reverse primer (10 μM),
0.10 μ 1 of Taq archaeal dna polymerases (5U/ μ 1), ultra-pure water 6.40 μ 1,10 × Buffer 0.50 μ 1 of 1.0 μ 1,10mM dNTPs, mould
1.0 μ 1 of plate DNA (30ng/ μ 1).SSR amplified reaction programs：94 DEG C of pre-degeneration 45s；94 DEG C of denaturation 30s, 57 DEG C of 45s that anneal, 72
DEG C extend 1min, 29 cycle.94 DEG C of denaturation 60s, 57 DEG C of annealing 45s, 72 DEG C of extension 2min.Amplified reaction is in BIOMETRA public affairs
It is carried out on department TGRADIENT and BIO-RAD company PTC-200.Amplified production carries out electrophoresis in 8% polyacrylate hydrogel, presses
Gel silver staining is carried out according to the method for Zhang Jun (2000), records result.
(4) the QTL positioning of fiber strength
Using QTL IciMapping V4.0 softwares, to 408 to 3 years five environment of substitution line group (2010 Anyang,
Anyang in 2011, Xinjiang and Liaoning, Xinjiang in 2014) to carry out QTL fixed for the data of fiber strength data and Markers for Detection
Position analysis detects the QTLs that three environment above are stablized, and 2 QTLs are newfound (tables 2):QFS-C11-1 can be
Anyang in 2010, Anyang in 2011 and 2011 are detected in the environment of three, Liaoning, and qFS-C16-1 can pacify in 2010
Sun and is detected Anyang in 2011 for 2011 in the environment of three, Xinjiang.
The QTLs for 2 fiber strengths that 2 three environment of table can detect
Remarks：AY：Anyang；LN：Liaoning；XJ：Xinjiang
The QTLs of this 2 fiber strength characters：QFS-11-1 and qFS-16-1, be located at chromosome Chr11 and
On Chr16, additive effect is all just, all to derive from sea island cotton sea 1, the contribution rate to cotton fiber specific strength is respectively 2.79-
3.32% and 3.76-5.16%, additive effect are respectively 0.50-0.61cN/tex and 0.70-0.77cN/tex；With this 2 fibres
The SSR molecular marker for tieing up the QTLs close linkages of specific strength character is for HAU0848 respectively370And HAU0120100。
The specific primer sequence of each molecular labeling and the target fragment length of amplification are as follows：
①HAU0848370
Forward primer sequence is AATGAGCTATGGTTGGGGTA,
Reverse primer sequences are AACCACACATGCTCAAACAG, and amplifiable length is the DNA fragmentation in the sea 1 of 370bp；
②HAU0120100
Forward primer sequence is GCTGAGTCCACTGATCTGAA,
Reverse primer sequences are CTTCTTAAATGACGCTGCAA, and amplifiable length is the DNA fragmentation in the sea 1 of 100bp.
The method for selecting molecular marker that 2 upland cotton fiber specific strength character of embodiment improves
The molecular labeling HAU0848 obtained using embodiment 1370And HAU0120100It is educated related with sea island cotton sea 1 etc.
Marker-assisted selection is carried out in kind of groups, is included the following steps：
(1) DNA is extracted：It is donor parents with sea island cotton sea 1, (such as Shandong cotton grinds 28 and nakamise for Upland Cotton or strain
60) it is receptor parent, is hybridized, is returned, obtains segregating population, or with sea island cotton sea 1 be donor parents, Upland Cotton
(such as Shandong cotton grinds 28 and nakamise 60) be the Introgressed line that the high generation backcrossing of receptor parent hybridization obtains and its derivative strain or its gradually
It is the progeny population for hybridizing with Upland Cotton, being returned to ooze, and uses CTAB methods extraction segregating population single plant DNA in seedling stage；
(2) molecular labeling HAU0848 is used370And HAU0120100Molecule is carried out to the genotype of above-mentioned (1) group single plant
Label detection；
(3) testing result is analyzed；
(4) plant of the selection with extra large 1 characteristic bands of sea island cotton, fiber strength of menu strain is likely to be obtained not in these
With the raising (such as table 3) of degree.
The " CCRI 45 of 3 Marker-assisted selection of table is returned the fiber strength of the strain in 4 generations, 5 generations of selfing with sea 1
Performance
| Strain is numbered | HAU0848370 | HAU0120100 | Average fiber specific strength (cN/tex) |
| W-10 | √ | 32.15 | |
| W-62 | √ | 31.50 | |
| W-105 | √ | 32.00 | |
| W-122 | √ | 32.50 | |
| W-124 | √ | 31.75 | |
| W-125 | √ | 32.40 | |
| W-147 | √ | 30.70 | |
| W-159 | √ | 33.00 | |
| W-221 | √ | 33.10 | |
| W-222 | √ | 32.35 | |
| W-259 | √ | 32.70 | |
| W-321 | √ | 31.50 | |
| CK (nakamise 45) | 29.32 |
" √ " indicates to detect the characteristic strip of label
It can get the Upland Cotton (being) that fiber strength is improved through the invention, cotton fiber quality can be accelerated
Breeding process.
Claims (2)
1. the specific fragment in the sea of primer amplification sea island cotton below 1 is as the extra large 1 molecule mark related with fiber strength of sea island cotton
The application of note, which is characterized in that the molecular labeling is HAU0848370And HAU0120100,
Wherein, the specific primer sequence of each molecular labeling and the target fragment length of amplification are as follows：
①HAU0848370
Forward primer sequence is AATGAGCTATGGTTGGGGTA,
Reverse primer sequences are AACCACACATGCTCAAACAG, and amplification length is the DNA fragmentation in the sea 1 of 370bp；
②HAU0120100
Forward primer sequence is GCTGAGTCCACTGATCTGAA,
Reverse primer sequences are CTTCTTAAATGACGCTGCAA, and amplification length is the DNA fragmentation in the sea 1 of 100bp.
2. a kind of upland cotton fiber specific strength auxiliary breeding means, which is characterized in that this approach includes the following steps：
(1) DNA is extracted, and uses the molecular labeling HAU0848 from sea island cotton sea 1 with fiber strength character close linkage370With
HAU0120100Molecular Detection is carried out to the genotype of group's single plant；
(2) testing result is analyzed, plant of the selection with extra large 1 characteristic bands of sea island cotton obtains fiber strength and obtain
The Upland Cotton of raising, wherein the molecular labeling from sea island cotton sea 1 with fiber strength character close linkage
HAU0848370And HAU0120100Specific primer sequence and amplification target fragment length it is as follows：
①HAU0848370
Forward primer sequence is AATGAGCTATGGTTGGGGTA,
Reverse primer sequences are AACCACACATGCTCAAACAG, and amplification length is the DNA fragmentation in the sea 1 of 370bp；
②HAU0120100
Forward primer sequence is GCTGAGTCCACTGATCTGAA,
Reverse primer sequences are CTTCTTAAATGACGCTGCAA, and amplification length is the DNA fragmentation in the sea 1 of 100bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510753375.XA CN105274234B (en) | 2015-11-04 | 2015-11-04 | From sea island cotton molecular labeling related with fiber strength and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510753375.XA CN105274234B (en) | 2015-11-04 | 2015-11-04 | From sea island cotton molecular labeling related with fiber strength and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105274234A CN105274234A (en) | 2016-01-27 |
| CN105274234B true CN105274234B (en) | 2018-09-07 |
Family
ID=55144061
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510753375.XA Active CN105274234B (en) | 2015-11-04 | 2015-11-04 | From sea island cotton molecular labeling related with fiber strength and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105274234B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103497949A (en) * | 2013-10-15 | 2014-01-08 | 中国农业科学院棉花研究所 | Molecular markers from sea island cotton Hai 1 and related to cotton fiber strength and application of molecular markers |
-
2015
- 2015-11-04 CN CN201510753375.XA patent/CN105274234B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103497949A (en) * | 2013-10-15 | 2014-01-08 | 中国农业科学院棉花研究所 | Molecular markers from sea island cotton Hai 1 and related to cotton fiber strength and application of molecular markers |
Non-Patent Citations (5)
| Title |
|---|
| Constructing a high-density linkage map for Gossypium hirsutum×Gossypium barbadense and identifying QTLs for lint percentage;Yuzhen Shi et al;《Journal of Integrative Plant Biology》;20150531;第57卷(第5期);第450-467页 * |
| HAU0120;Anonymous;《互联网文章》;20141231;第1页 * |
| HAU0848;Anonymous;《互联网文章》;20141231;第1页 * |
| Mapping and Validation of Fiber Strength Quantitative Trait Loci on Chromosome 24 in Upland Cotton;Pawan Kumar et al;《CROP SCIENCE》;20120630;第52卷;第1115-1122页 * |
| 利用棉花纤维品质相关QTL评价海陆渐渗品种品质初探;张建宏等;《棉花学报》;20131231;第25卷(第3期);第247-253页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105274234A (en) | 2016-01-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103497949B (en) | The molecule marker relevant with cotton fiber strength from sea island cotton sea 1 and application thereof | |
| CN105524999B (en) | A kind of and chain molecular labeling of cotton Island Cotton Fiber length | |
| CN105200053B (en) | From extra large 1 molecular labeling related with fibre length of sea island cotton and its application | |
| CN104313016B (en) | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| CN105483248B (en) | From sea island cotton molecular labeling related with fibre strength and its application | |
| CN105506102B (en) | From sea island cotton molecular labeling related with fibre strength, length, mic value and its application | |
| CN105524998B (en) | A kind of and chain molecular labeling of cotton Island Cotton Fiber intensity | |
| CN105734057B (en) | With the SSR marker and its application of muskmelon downy mildew resistance main effect QTL linkage | |
| CN108130380B (en) | Molecular breeding method for synchronously improving verticillium wilt resistance and fiber quality of cotton | |
| CN108179214A (en) | A kind of molecular breeding method of synchronous improvement cotton verticillium wilt resistance, fiber quality and yield traits | |
| CN108559787B (en) | Molecular marker related to cotton fiber length and application thereof | |
| CN105177175B (en) | From extra large 1 molecular labeling related with fiber mic value of sea island cotton and its application | |
| CN105274234B (en) | From sea island cotton molecular labeling related with fiber strength and its application | |
| CN105821135B (en) | Molecular labeling and application with muskmelon downy mildew resistance gene close linkage | |
| CN101368181A (en) | Numerator mark concatenated with rice purple pericladium gene PSH1 (t), acquiring method and application thereof | |
| CN110512019A (en) | A kind of molecular labeling and its application with cotton fiber length main effect QTL linkage | |
| CN110616275B (en) | Molecular marker derived from Yttrium okamuni cotton and cotton fiber strength QTL (quantitative trait locus) linkage and application thereof | |
| CN109055591B (en) | Molecular marker linked with major QTL (quantitative trait locus) of cotton fiber length and application thereof | |
| CN108130381B (en) | Molecular marker from sea island cotton Hai 1 and related to verticillium wilt resistance and application thereof | |
| CN102978207B (en) | Molecular marker for raphanus sativus L. downy mildew resistant gene close linkage | |
| CN114958832B (en) | Molecular breeding method for synchronously improving length and strength properties of cotton fiber | |
| CN109880929A (en) | The molecular labeling of the main effect QTL site Apam-1 of adjusting and controlling rice bacterial brown streak resistance and its application | |
| CN104620976A (en) | Muskmelon gummy stem blight polymerization resistant gene material and breeding method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |