CN105274118B - The ZmMs7 gene orders and its encoding proteins of a kind of control corn male fertility - Google Patents

Abstract

A kind of gene of the control corn male fertility of genetic engineering fieldZmMs7And its encoding proteins and promoter.The present invention describes one and regulates and controls the development of microspore cells wall in plant and then influence male fertility abilityZmMs7The protein amino acid sequence of gene nucleotide sequence and its coding.The present invention is also identifiedZmMs7Gene promoter sequence and its essential regions.The nucleotide sequence and protein have the function of regulation and control plant reproductive cell development, the function of the gene, which is lost, specific to cause the male sterility of corn, it is used for producing hybrid seed it is possible thereby to produce new male sterile line of maize, therefore has in agricultural production highly important application value.

Description

The ZmMs7 gene orders and its encoding proteins of a kind of control corn male fertility

Technical field

The present invention relates to a kind of gene order of control corn male fertility and its albumen coded sequence, belong to gene work Journey field.

Background technology

Plants male sterility（male sterility, MS）It is a kind of biological phenomena of generally existing in higher plant, Refer in monoecious plant, stamen development is abnormal, it is impossible to produce functional pollen, but the normal knot that can simultaneously be fertilized of Stamen development It is real, and this male-sterile character can be hereditary in offspring.The male sterility of plant can be divided into cell according to its mode of inheritance Kernel male sterile, cytoplasmic male sterility and nucleo-cytoplasmic interreaction infertility.Wherein, nuclear male sterility shows as nuclear genetic, thus Its sterile sex expression is stable, in production practices there are huge applications to be worth.A kind of guarantor can be formulated by Plant Biotechnology The technical system with propagating corn male sterile line is held, so as to realize the crossbreeding of corn sterilization and the production of hybrid seeds.In hybrid maize During the production of hybrid seeds, it can save a large amount of artificial emasculation costs using male sterile line of maize and ensure seed purity.

The invention provides a kind of gene order of control corn male fertility and its protein sequence of coding, the base Because afunction can caused by corn male flower abortion, it is possible thereby to produce new male sterile material, have in agricultural production Highly important application value.

The content of the invention

The present invention provides a kind of new control corn male fertility geneZmMs7And its protein sequence of coding, it is described Gene is a kind of maize male ears different expression gene, and the missing of the gene function specific can cause the male flower of corn not Educate.

First goal of the invention of the invention be：There is provided a kind of gene of control corn male fertility, it is characterised in that be Selected from following 1）Or 2）Or 3）Or 4）Or 5）Shown DNA molecular：

1）DNA molecular shown in SEQ ID NO. 1（Clone the genomic DNA from corn inbred line B73）；

2）DNA molecular shown in SEQ ID NO. 2（Clone the cDNA from corn inbred line B73）；

3）On the bases of SEQ ID NO. 1 by one to several bases replace and or one to several bases insertion With or missing and large fragment nucleotide sequence insertion missing displacement inversion formed and can influence maize growth ability DNA molecular；

4）In 0.1 × SSPE（Or 0.1 × SSC）, 0.1% SDS（w/v）Solution in, hybridize and wash under the conditions of 65 DEG C Film, DNA molecular hybridization that can be with SEQ ID NO. 2 and the DNA molecular of coded plant pollen development GAP-associated protein GAP；

5）There is more than 85% homology and the related egg of coded plant pollen development to SEQ ID NO. 2 DNA molecular White DNA molecular.

Second goal of the invention of the invention be：The Plant Pollen Development GAP-associated protein GAP of said gene coding is provided.At one In embodiment, the gene code following 1）Or 2）Described protein：

1）The protein of amino acid sequence composition shown in SEQ ID NO. 3；

2）The substitution by one or several amino acid residues and/or missing and/or addition and tool by SEQ ID NO. 3 There is the protein of male plant fertility related activity.

3rd goal of the invention of the invention be：The startup that the gene order transcriptional expression is adjusted in floral organ is provided Son.In one embodiment, promoter sequence DNA sequence dna as shown in SEQ ID NO. 4, the sequence has in floral organ Specifically start the function that the gene order as described in SEQ ID NO. 1,2 is transcribed in official.

4th goal of the invention of the invention be：There is provided the recombinant expression carrier containing the gene, expression cassette, transgenosis thin Born of the same parents system or recombinant bacterium.

5th goal of the invention of the invention be：Said gene is provided in the purposes for transgene improvement crop；

In one embodiment, the gene be used for induce crop plant male sterility, so as to import foreign gene with Obtain the genetically modified crops of high-quality；

In a specific embodiment, the improvement include output increased, it is quality raising, disease and insect resistance, degeneration-resistant, anti-fall The improvement of the growth traits such as volt；

In another embodiment, the crop is self-pollination or cross pollinated plant；

In a more specific embodiment, the crop is corn, wheat, paddy rice.

Compared with prior art, the present invention has following beneficial effect：Gene of the present invention is in maize male ears Middle specific expression gene, the gene plays an important role in control zasiokaurin development, and the missing of the gene function can specificity Cause the male sterility of corn, new male sterile line of maize can be obtained by suppressing the specifically expressing of the gene, it is raw in agricultural There is highly important application potential in production.

Term is defined

Term " gene of regulation and control corn male fertility " refers to one section of nucleotide sequence with encoding proteins ability, the sequence The special coding of row develops the protein active polypeptide of function, such as SEQ ID NO. 2 1-2013 cores with regulation and control zasiokaurin Nucleotide sequence and its degenerate sequence.

Term " degenerate sequence " refers in SEQ ID NO. 2 1-2013 nucleotide sequences of encoder block, have One or more codons are encoded the sequence produced after the degenerate codon of same amino acid replaces.Due to codon Degeneracy, so also can with the degenerate sequence of SEQ ID NO. 2 1-2013 nucleotide sequence homologies as little as about 70% Encode out the amino acid sequence coded by SEQ ID NO. 2.

" gene of regulation and control corn male fertility ", is additionally included under moderate stringency, more preferably tight in height Nucleotide sequence that can be with SEQ ID NO. 2 nucleotide sequence hybridization under the conditions of lattice.Wherein, medium stringency condition can be with It is 0.1 × SSPE（Or 0.1 × SSC）, 0.1% SDS（w/v）Solution in, hybridize and wash the condition of film under the conditions of 65 DEG C.

The gene of corn male fertility " regulation and control ", in addition to in SEQ ID NO. 2 from 1-2013 nucleosides The homology of acid sequence at least 70%, preferably have at least 80%, 82%, 85%, 86%, 88%, 89% homology, more preferably have At least 90%, 91%, 92%, 93%, 94% homology, most preferably with least 95%, 96%, 97%, 98%, the nucleotides of 99% homology Sequence.

The gene of corn male fertility " regulation and control ", in addition to can encode and have and natural regulation and control zasiokaurin hair Educate geneZmMs7Gene identical function albumen, the open reading frame sequences of SEQ ID NO. 2 variant form.These become abnormity Formula includes（But it is not limited to）：1 or missing, insertion and/or the substitution of several nucleotides, and it is several in 5 ' or 3 ' end additions （Usually within 60, within preferably 30, more preferably within 10, most preferably within 5）Nucleotides.

The gene of corn male fertility " regulation and control ", in addition to a class can be translated possess regulation and control zasiokaurin development The amino acid sequence of the amino acid sequence of function, such as SEQ ID NO. 3.Such amino acid sequence also includes having and natural tune Control the SEQ ID NO. 3 of zasiokaurin development albumen identical function variant form.These variant forms include（But do not limit In）：1 or missing, insertion and/or the substitution of several amino acid, and it is one or several in C-terminal and/or N-terminal addition （Usually within 20, within preferably 10, more preferably within 5）Amino acid.In the art, similar nature is used Or similar amino acid is when being replaced, it will not generally change the function of protein；C-terminal and/or N-terminal add one or Several amino acid will not generally also change the function of protein.

In addition, the nucleotides full length sequence or its fragment of described " regulation and control zasiokaurin development gene " can generally be used PCR TRAPs, recombination method or artificial synthesized method are obtained., can be according to disclosed in the present embodiment about core for PCR TRAPs Nucleotide sequence, especially open reading frame sequence design primer, and with commercially available cDNA storehouses or by those skilled in the art oneself CDNA storehouses prepared by the conventional method known are as template, and amplification obtains relevant sequence.When sequence is longer, it is often necessary to carry out PCR is expanded twice or repeatedly, and the fragment for then again amplifying each time is stitched together by proper order.Once obtain relevant Sequence, relevant sequence can be obtained in large quantity with recombination method.Carrier is typically cloned into, then cell transformation etc. Conventional method isolated relevant sequence from the host cell of propagation.Introduce real in addition, be able to will be also mutated by chemical synthesis Apply in a protein sequence.In addition to being produced with recombination method, the fragment of embodiment albumen also can use solid phase technique, by directly closing Produced into polypeptide.Synthetic protein can be carried out manually or automatically in vitro, can distinguish chemical synthesis embodiment Each fragment of albumen, is then chemically connected to produce the protein molecule of total length.

Brief description of the drawings

Fig. 1 is wild type and Maize mutantms7-6007Little Hua tasseling stage morphologic observation schematic diagram：Scheme A, just Normal fertile plant（WT）Little Hua and sterile mutant（ms7-6007）Small floral shape compare；Scheme B, fertile plant（WT）And mutation Body（ms7-6007）Flower pesticide through 1%KI-I₂Coloration result compares.

Fig. 2 is wild type and Maize mutantms7-6007Cytological observation schematic diagram：Scheme A, normal fertile plant （WT）The microspore cells structure of early stage big vacuole microspore phase flower pesticide；Scheme B, sterile mutant（ms7-6007）Early stage big vacuole The microspore cells structure of microspore phase flower pesticide；White triangles type is denoted as germinal aperature, and black shade arrows are cell membrane, White arrow marked position is nucleus, and black scale represents 30 μm.

Fig. 3 isZmMs7The heredity of gene and physical location schematic diagram and gene structure display：Scheme A,ZmMs7Gene Heredity and physical location schematic diagram；Scheme B,ZmMs7Gene is in wild type B73 and Maize mutantms7gl1、ms7-6007In Gene structure（WT：Wild type B73；Sequence in grey rectangle isms7-6007With wild B73'sZmMs7Gene pairs Ying Xu The comparative result of row；Grey straight line and rectangle represent affected sequential structure after mutation occurs；TGA and TAA are end Only codon, represents the translation termination of albumen in this）, wherein：DNA molecular is by 2435 shown in the SEQ ID NO. 1 of sequence table Nucleotides is constituted and had as in Fig. 3 BZmMs7Shown gene structure, it is illustrated that+1 to+2435 corresponding SEQ ID NO. The 1 of 1 is to 2435bp bases.+ 1 to+321 is first extron, and+322 to+636 are First Intron ,+ 637 to+918 are second extron, and+919 to+1025 be second introne, and+1026 to+2435 be the 3rd Extron.+ 1 to+321（321bp）,+637 to+918（282bp）,+1026 to+2435（1410bp）Three outside it is aobvious Son constitutes the gene cDNA sequence as shown in SEQ ID NO. 2（2013bp）.SEQ ID NO. 1 can be encoded in corn Albumen with the amino acid sequence as shown in SEQ ID NO. 3；

After the genome sequence of gene morphs shown in SEQ ID NO. 1, in Maize mutantms7gl1、ms7- 6007Have respectively as in Fig. 3 Bms7gl1、ms7-6007Shown gene structure；

Shown in Fig. 3 .Bms7-6007Form variation gene structure is：The mutant gene structure correspondence diagram+1 to+ 2453 bit bases.+ 1 to+324 is first extron, and+325 to+664 are First Intron ,+665 to+ 953 are second extron, and+954 to+1043 be second introne, and+1044 to+2453 be the 3rd extron. Compared with SEQ ID NO. 1,ms7-6007There are 3 bases at first extron+22 in form variation gene（CGA）Insert Enter, 7 bases are inserted at second extron+814（GCTGCTG）, cause translation to be terminated at+1426；

Shown in Fig. 3 Bms7gl1Form variation gene structure is：+ 1 to+3543 of the mutant gene structural diagrams Base.+ 1 to+321 is first extron, and+322 to+625 are First Intron, and+626 to+907 are Second extron ,+908 to+997 be second introne, and+998 to+3543 be the 3rd extron.With SEQ ID NO. 1 compare, a length of 1136bp transposons is inserted at the 3rd extron+1179（DTA_ZM00068）, this makes ms7gl1Form variation gene translation stops+1225.

Fig. 4 is the sequence alignment schematic diagram of corn ZmMS7 albumen, arabidopsis MS1 albumen and paddy rice PTC1 albumen.

Fig. 5 isZmMs7Gene is in wild type B73 and Maize mutantms7gl1、ms7-6007Middle encoding proteins amino acid The comparative result of sequence and architectural difference, wherein：SEQ ID NO.'s 1ms7gl1、ms7-6007Coded by type mutator Albumen has lacked most of outer by the 3rd compared with the albumen as shown in SEQ ID NO.3 coded by SEQ ID NO. 1 The amino acid of aobvious son coding simultaneously leads to not exercise normal function, so as to cause Maize mutantms7gl1、ms7-6007Male flower The forfeiture of fertility.Therefore SEQ ID NO. 1 have the function of control corn male fertility, when its gene region occurs because of one To several bases replace and or one to several bases insertion and or missing and large fragment nucleotide sequence insertion lack Lose displacement inversion when causing SEQ ID NO. 1 function to change, the forfeiture of corn male fertility will be caused.

Fig. 6 is to carry homozygous recessive using diagnostic flag primer 3 and the screening of primer 4ms7-6007The result in site：Mark F Swimming lane be heterozygous genotypes plant, mark S swimming lane be homozygosis sterile gene typems7-6007Plant.

Fig. 7 isZmMs7The semiquantitive PCR result of gene expression pattern in corn inbred line B73：IM:Prematurity is male Fringe；Q:Meiosis of microspore mother cell tetrad tassel；MV:The big vacuole microspore stage tassel of mid-term；LV:Afterwards Phase big vacuole microspore stage tassel；H:Tasseling stage tassel；L :Blade；E：Female fringe；R：Root.

Fig. 8 isZmMs7The real-time fluorescence quantitative PCR result of gene different development stage tassel in B73：Q:Microspore Mother cell meiosis tetrad tassel；EV:Early stage big vacuole microspore stage tassel；MV:The big vacuole microspore of mid-term Period tassel；LV:Later stage big vacuole microspore stage tassel；H:Tasseling stage tassel.

Fig. 9 is to utilize real-time fluorescence quantitative PCR pairZmMs7Gene is in homozygosis sterile mutantms7-6007/ms7-6007 It is fertile with heterozygosisMs7/ms7-6007The analysis result of expression quantity in the early stage big vacuole microspore phase tassel of plant.

Embodiment

Following examples are easy to be better understood from the present invention, but do not limit the application of the present invention.Following embodiments In all technologies and scientific terminology, be that one skilled in the art of the present invention are generally understood unless otherwise specified Identical meanings.Unless there are conversely indicating, technology that is used herein or referring to is that those of ordinary skill in the art generally acknowledge Standard technique.The experimental method of unreceipted actual conditions in the following example, is standard protocol, such as Sambrook Equimolecular is cloned：Laboratory manual（New York:Cold Spring Harbor Laboratory Press, 1989）Middle institute The condition stated, or the experimental program provided according to reagent manufacturer are tested.

Embodiment 1、Zmms7The acquisition of mutant, phenotype description and cytological observation

The comptibility test of Fertility segregation in the Maize mutant of table 1

Maize mutantms7gl1Withms7-6007All be applicant Beijing head Jia Lihua Science and Technology Ltd.s and The material that inventor herein selects from hybrid maize breeding population, genetic background be respectively corn inbred line head it is good- Gl1 and head good -6007 is the stable height of homozygosis for corn material.The two mutant show as the pollen abortion of tassel, But female fringe development is normal.With the prosperous 7-2 of self-mating system（C7-2）It is that male parent and mutant hybridize, F₁Normal, the F for fertility₂Self progeny goes out Existing Fertility segregation.As shown in table 1, F₂Normal fertile strain in colony（F）With sterile plant（S）Separation meet single-gene 3：1 point From than the male sterility phenotype of that is, two mutant shows as obvious single-gene recessive inheritance.Withms7gl1/+Heterozygosis is fertile Strain pollen is the pure and mild mutant of cornms7-6007Pollination, withms7-6007/+The pollen of heterozygosis fertile plant is Maize mutantms7gl1Pollination, filial generation male sterile plant and the normal fertile equal number of plant meet 1：1, explanationms7gl1Withms7- 6007Mutation occur in same gene.

ZmMs7Gene is relevant with the development of tapetal cell during pollen development and microspore cells wall.By to jade Rice mutantms7-6007And wild type（B73）Corn little Hua shows in the observation and comparing of tasseling stage,ms7-6007Flower pesticide Shrinkage is short and small, because pollen is not formed in flower pesticide causes the transparent shape of flower pesticide, through 1%KI-I₂Normal anther is not presented in dyeing Purple after coloring but KI-I₂Brown（Such as Figure 1A, B）.

Cytological observation discovery, corn sterile mutantms7-6007In the small spore of its flower pesticide of early stage big vacuole microspore phase The relatively normal fertile plant of daughter cell outer wall is more smooth and nonaperturate, shows corn sterile mutantms7-6007It is small The development of spore cell wall is suppressed（Such as Fig. 2A, B）.

Embodiment 2,ZmMs7The positioning of gene

Step one, target group.By Maize mutantms7gl1Hybridize with the prosperous 7-2 of self-mating system, choose F₂It is recessive in colony Sterile individual（154 plants）Carry outZmMs7The Genes location of gene.

Step 2, SSR molecular marker analysis.Existing genetic map（http://www.maizegdb.org）Show,ZmMs7The assignment of genes gene mapping is on chromosome 7.02bin.By screening the SSR marker being located at 7.02bin（SSR primer information sources In http://maizegdb.org）, as shown in Fig. 3 .A, have 9 pairs of SSR markers in 154 plants of recessive infertility individuals withZmMs7 Gene performance is chain, andZmMs7Gene is located atumc2617Withbnlg1808Between.

Table 2 existsumc2617Withbnlg1808Newly-designed molecular labeling and its nucleotide sequence in section

Mark -1, EP222：

Sequence source GRMZM2G050172, restriction endonuclease Hpa II, primer sequence（5’-3’） TACTCGCACTCCCACTCGTCT// GCACTCAGATGGAGGTTGGAA

Mark -2, EP238：

Sequence source GRMZM2G154752, restriction endonuclease Hpa II, primer sequence（5’-3’） GAACGGACACGAACACGATC// GACCTGACATAGTAAGGCCAGTT

Mark -3, EP239：

Sequence source GRMZM5G890224, restriction endonuclease Sau3A I, primer sequence（5’-3’） ATCGCCAATACAATGAACAGC// TGGATAACCAAACGAAACACG

Mark -4, EP259：

Sequence source GRMZM2G141031, restriction endonuclease Sau3A I, primer sequence（5’-3’） CAACCATTGATTTGGGCTCA// TGACCAGGGAGACTTTATTGCA

Mark -5, EP299：

Sequence source MAGIv3.1_19968, primer sequence（5’-3’）CTGGCACGAAGGCTGGTAA// CTCTCGCCGGTCACTTGATA

Mark -6, EP302：

Sequence source MAGIv3.1_90113, primer sequence（5’-3’）GAAGAGGACTTGAACGAGGGAT// AACCTCCATAATGAATTTCACCTC

Step 3, finely positioning.Target group is extended to 611 plants（The i.e. 611 plants male sterile F of performance₂Colony is single Strain）, and devise 6 pairs of polymorphism primers（Such as table 2）, further willZmMs7The assignment of genes gene mapping is between EP299-EP302 marks, about For 180kb interval（Such as Fig. 3 A）, wherein markingEP239Show as isolating with sterile character.In this 180kb section altogether There are 6 candidate genes, wherein gene GRMZM5G890224 isolates markEP239The gene in sequence source, encodes one The albumen of PHD-finger domains, is the MS1 albumen of arabidopsis（AT5G22260）, paddy rice PTC1 albumen（LOC_ Os09g27620）Homologous gene（Such as Fig. 4）.

Embodiment 3,ZmMs7Gene is in wild type B73 and Maize mutantms7gl1、ms7-6007In clone

GRMZM5G890224 only has partial gene sequence in Maize GDB（http://www.maizegdb.org）, + the 1 to+1833 of the B ZmMs7 of corresponding diagram 3..Based on the gene paddy rice homologous genePTC1（LOC_Os09g27620）Base Because group sequence and known to part GRMZM5G890224 gene orders, with primer 1（5’-ATGGCTGCCAATAATAAGACGA- 3’）And primer 2（5’-CTCACCTTCCTTGCAATGGATAAC-3’）It can be isolated from B73 genomic DNA GRZM5G890224 full length gene sequences, are sent to Shanghai Sheng Gong Bioisystech Co., Ltd by amplified production and be sequenced and can obtain Nucleotide sequence as shown in SEQ ID NO. 1.It can be amplified simultaneously from B73 fringe portions cDNA with primer 1 and primer 2ZmMs7The corresponding full-length cDNA of gene, the cDNA sequence as shown in SEQ ID NO. 2 is obtained through sequencing.

With identical primer combination fromms7-6007、ms7gl1The saltant type of GRMZM5G890224 genes is resulted in, is passed through Have respectively as in Fig. 3 B after sequencingms7-6007、ms7gl1Shown gene structure.As shown in Figure 3 B：Normal wild typeZmMs7Gene includes from initiation codon ATG to terminator TGA sequence and amounts to 2435bp, has three extrons, the 3rd The amino acid of exons coding can form conservative PHD-finger domains（Fig. 3 B, Fig. 4）；ZmMs7Mutatorms7- 6007Total length 2453bp, at first extron+22 and wild typeZmMs7Gene is compared to inserting 3 nucleotides, the Two places of extron+814 insert GCTGCTG totally 7 bases, and protein translation occurs frameshit and terminated at+1426；ZmMs7 Mutatorms7gl1Sequence 3543bp, by with Mazie Transposable Element Database （maizetedb.org/~maize/）Carry out blastn analyses find, inserted at the 3rd extron+1,179 one it is a length of 1136bp transposons（DTA_ZM00068）, gene translation stopped at+1225.

Embodiment 4,ZmMs7Gene is in B73 and Maize mutantms7gl1、ms7-6007In translation sequences compare

As shown in Fig. 5 and SEQ ID NO. 3：Normal wild typeZmMs7The albumen of 670 amino acid of gene code, the 3rd The amino acid of individual exons coding can form conservative PHD-finger domains（Fig. 3 B, Fig. 4）；ZmMs7Gene existsms7gl1Withms7-6007The albumen length encoded in mutant is respectively 277 and 332 amino acid（Fig. 5）, nucleotide level Variation makes translation there occurs frameshit and terminate in advance,ZmMs7Both mutains because nucleotides translate termination in advance, Cause the PHD-finger domains for losing the 3rd extron translation, ultimately result in the forfeiture of protein function（Fig. 5）.

ZmMs7The Loss-of-function mutant of genems7gl1Withms7-6007 show male flower abortion, this demonstrate that tool There is DNA sequence dna described in SEQ ID NO. 1ZmMs7Gene has the function of control corn male fertility, when generation such as Fig. 3 In Bms7-6007、ms7gl1Shown sequential structure become XOR other because one to several bases replaces and or one is to several bases Insertion and or missing and large fragment nucleotide sequence insertion missing displacement inversion cause SEQ ID NO. 1 sequence When array structure and function change, the forfeiture of corn male fertility will be caused.

Embodiment 5,ZmMs7The expression pattern analysis of gene

Material：Tassel developmental stage gathers the tassel of wild type B73 self-mating systems, and each complete tassel takes half through liquid nitrogen speed Freezing to preserve is used to extract total serum IgE, and the little Hua of remaining tassel is in Kano fixer（Alcohol：Glacial acetic acid=3:1）In fix 48 hours, Again through 1% aceto-camine（1g fuchsins are dissolved in the acetic acid of 100ml 45%）When dyeing progress Cytogenetic Observation determines accurate development Phase.Choose and be in the prematurity tassel phase（Immature tassels, IM）, meiosis tetrad（Quartets）, it is early The phase big vacuole microspore phase（Early vacuolate microspore, EV）, the mid-term big vacuole microspore phase（Mid Vacuolate microspore, MV）, the big vacuole microspore phase in later stage（Late vacuolate microsoire, LV）、 Tasseling stage（Heading）Six periods of mature pollen phase, for analyzingZmMs7Table of the gene in the tassel of normal fertile plant Up to situation.The young tender female fringe total serum IgE of the another blade, root and tasseling stage for extracting B73 meiophase plant exists for analyzing gene Expression in different tissues.

Use primer 3（5’-GGCCACAAGCTGCTCAACCT-3’）With primer 4（5’- CTACCTTCCTTGCAATGGATAAC-3’）In seedling stage assayms7-6007Recessive infertility individual plant（Fig. 6）, and homozygosis is extracted respectively Recessive sterile plant（Genotypems7-6007/ms7-6007）It is with genotype under identical genetic backgroundMs7/ms7-6007Heterozygosis can The early stage big vacuole microspore phase tassel total serum IgE of plant is educated, for comparingZmMs7Gene is in sterile corn mutant and fertile plant Expression change in strain（All tassels determine accurate developmental stage through Cytogenetic Observation in advance）.

Method 1：Using above-mentioned organization material cDNA as template, with primer 3（5’- GGCCACAAGCTGCTCAACCT -3’） With primer 5（5’- ATGTGGTTGCCCAGGGACTT -3’）The primer pair of composition, is analyzed using semiquantitive PCR methodZmMs7 The expression quantity of gene；With primer 6（5’- GGCCACAAGCTGCTCAACCT -3’）With primer 7（5’- ATGTGGTTGCCCAGGGACTT -3’）The primer pair of composition, utilizes semi-quantitative analysisZmActinGene expression amount （ZmActiN is a kind of encoding gene of constitutive expression cytoskeletal protein, usually as reference gene）.

Method 2：With the wild type B73 tetrad phase, the early stage big vacuole microspore phase, the mid-term big vacuole microspore phase, after Phase big vacuole microspore phase and the tassel of tasseling stage, and Maize mutantms7-6007With identical genetic backgroundMs7/ms7- 6007The early stage big vacuole microspore phase tassel cDNA of heterozygous plant is template, the primer pair constituted respectively with primer 3 and primer 4 And the primer pair that primer 5 and primer 6 are constituted, analyzed using real-time fluorescence quantitative PCRZmMs7Gene is relative to reference geneZmActinExpression quantity.

As a result as shown in fig. 7,ZmMs7Gene has specifically expressing in tassel tissue, and is not all examined in root, leaf and female fringe Measure expression.ZmMs7There is expression top in the tassel of early stage big vacuole microspore phase in gene, and in tasseling stage tassel Rapid drawdown is expressed, the expression of gene is nearly no detectable（Fig. 7, Fig. 8）.

In early stage big vacuole microspore phase, corn sterile mutantms7-6007The performance of microspore cells wall such as Fig. 2 B Shown development suppression.This periodZmMs7Gene is in corn sterile mutantms7-6007Expression it is normal with carryingZmMs7GeneMs7/ms7-6007Plant is compared, expression substantially reduction, i.e., as shown in Figure 9.ShowZmMs7Gene is occurring As in Fig. 3 Bms7-6007、ms7gl1After shown variation, except coded amino acid occur become outside the pale of civilization as shown in Figure 5, gene The expression of early stage big vacuole microspore phase will also change, and then influenceZmMs7The function of gene, and ultimately result in microspore The dysplasia of cell.

Embodiment 6,ZmMs7The promoter clone of gene

Use primer 8（5’-TGCTGAACAGATTCGTTTGACTC-3’）Combination with primer 2 can be from wild type B73 In amplify comprising completeZmMs7The upstream gene group sequence of gene order and one section of gene.RemoveZmMs7Genome sequence Afterwards, the sequence is as shown in SEQ ID NO. 4.Respectively there is the sequence to be at the 939th of the sequence and the 1022nd nucleotides ATATAT promoter element, with the function of starting downstream gene transcription.

Pertinent literature

1、Beadle, GW (1932) Genes in maize for pollen sterility. Genetics, 17: 413-431。

2、Albertsen, MC and Phillips, RL (1981) Developmental cytology of 13 genetic male sterile loci in maize. Can J Genet Cytol, 23: 195-208。

3rd, Li Jingxiong, Zhou Hongsheng, Sun Rongjin etc.（1998）Corn male sterility biology.Scientia Agricultura Sinica publishing house.

4th, Wu Suowei, just now minister, Deng Lianwu, universal member（2012）Corn recessive nucleus male sterility progression and its Breeding Application path analysis, Molecular Plant Breeding (network edition), volume 10, the 1001-1011 pages.

SEQUENCE LISTING

<110>Beijing head Jia Lihua Science and Technology Ltd.s

<120>The ZmMs7 gene orders and its encoding proteins of a kind of control corn male fertility

<130> 2014

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 2435

<212> DNA

<213>Corn（Zea mays）

<400> 1

atggctgcca ataataagac gatggtggtc agcctgggga gctcgcggcg gcggaagcgc 60

ggcgagatgc tgttccggtt cgagtccttc tgccagcccg gctaccccgc tccgctcgcc 120

ggcgggggcg ccttcaggga caacgtcagg gcgctgctcg gcctcgcgca cctggaggcc 180

ggcgcgcatg gcgagaccaa gtgctggtct ttccagctcg agctgcaccg ccacccgccc 240

accgtcgtca ggctcttcgt cgtcgaggaa gtggtcgaca cgtcgccgca gcgccagtgc 300

cacctctgcc gtcacgtcgg tactcaccgc tttgctactg tcttttgtcg atcctataga 360

tgatgctgaa ccttgtgccc tgtacacgag ttatacgtcc taagttacac catggggtcg 420

tgcatgatac atctgacagc cgagtataac tgttagataa agctattaga attgctacta 480

attcgatttt tttttatcgc caatacaatg aacagcggac tcgaactgca ctatgatccg 540

cagaaagaaa actataacga tcgagcaact cggccactgt cagatatatg cgctcactct 600

gccaggaaac ccccgcgtgg tgtttctgtt tcaggttggg gtcggcatct gatctgcagc 660

aagcggttcc acttcgtgct gcccaagagg gagttgtcag tggaagctga cggcctgcac 720

tacgggatca accacagccc ggagaaaccg tccaaaggca cggcgacctc caggggccac 780

ctgctgcacg gcgtggtgca cctcaacggc ttcggccacc tcgttgccct gcacggcttc 840

gagggcggct ccgaattcgt cgccggcgag cagatcatgg acctctggga tcgcatatgc 900

tcctctctga acgtcaggtg tgcaacgcga actactgtgc aacacgttcg ttgtgccccg 960

tgcactgcca ctgcatcata tgagtgcatg acggctcgtg tttcgtttgg ttatccattg1020

caaggaaggt gagcctcgtc gacacggcga ggaaggggca catggagctg cggctgctgc1080

acggcgttgc gtacggcgac acgtggttcg ggcggtgggg ctacaggttc ggccggccca1140

gctacggcgt cgcgctaccg tcctaccagc agtcgctgca cgcgctccag tcggtacctc1200

tctgcgtgct cgtgccgcac ctgtcgtgct tcagccagga cctccccgtg gtggtgacca1260

agtaccaggc catcagcggc cacaagctgc tcaacctcgg cgacctcctc cgcttcatgc1320

tcgagctgcg gacgcgcctc ccggcgacct ccgtcaccgc catggactac cgcggcatca1380

tgtcggaggc ctcgtgccgg tggtcggcca agcgcgtgga catggcggcc cgcgccgtgg1440

tggacgctct ccgccgcacc gagccgcccg cgcggtgggt cacgcggcag gaggtgcgcg1500

acgcggcgcg cgcctacatc ggcgacacgg gcctcctcga cttcgtgctc aagtccctgg1560

gcaaccacat cgtcggcaac tacgtcgtgc gacgcgcgat gaacccggtg accaaggtgc1620

tcgagtactg cctggaggac gtgtccagcg tgctcccggc ggtgggcggc gtgccgagca1680

acggcggcgg caagatgagg gtccggttcc agctcacgcg ggcgcagctc atgagggacc1740

tgatgcacct gtaccgccac gtgctgaagg agccgagcca ggcgctcacc accggcgcct1800

tcggcgcgat ccccgtggcg gcgcggatgg tcttggacac caagcacttc gtcaaagatt1860

accacgaagg tttcgctccg atcaacagtg ttggagttgg gcacgtccac atgaacctgt1920

gttgcacgct gcttctgaag aacgggggtc cggagctggt ggcgccgtac gagacggtca1980

ccctgccggc gcatgcaacg gtgggcgagc tcaaatggga ggtgcagagg ctgttcagtg2040

agatgtacct cggcctaagg accttcacgg ccgagtccgt cgccggggtc ggcgtcagcc2100

aggacgcttg cccggtgctc gggctcatcg acgtgggaag cgtcgtggtg atcgaaggat2160

cagtcgtcga gcagcagcag ctggcggatg aaagcgtaca tacagggagc gaggccgcgt2220

ctgtgagcga gggaggcggc gacagcgaga gggtcgtgga ctgcgcgtgc ggagcggatg2280

acgacgacgg ggagcgcatg gcgtgctgcg acatctgcga ggcgtggcag cacacccggt2340

gcgcggggat caaggacacc gacgacgccc cgcacgtctt cgtctgcaac cgctgcgaca2400

acgacgttct gtcattccct cccttgagct gttag 2435

<210> 2

<211> 2013

<212> DNA

<213>Corn（Zea mays）

<400> 2

atggctgcca ataataagac gatggtggtc agcctgggga gctcgcggcg gcggaagcgc 60

ggcgagatgc tgttccggtt cgagtccttc tgccagcccg gctaccccgc tccgctcgcc 120

ggcgggggcg ccttcaggga caacgtcagg gcgctgctcg gcctcgcgca cctggaggcc 180

ggcgcgcatg gcgagaccaa gtgctggtct ttccagctcg agctgcaccg ccacccgccc 240

accgtcgtca ggctcttcgt cgtcgaggaa gtggtcgaca cgtcgccgca gcgccagtgc 300

cacctctgcc gtcacgtcgg ttggggtcgg catctgatct gcagcaagcg gttccacttc 360

gtgctgccca agagggagtt gtcagtggaa gctgacggcc tgcactacgg gatcaaccac 420

agcccggaga aaccgtccaa aggcacggcg acctccaggg gccacctgct gcacggcgtg 480

gtgcacctca acggcttcgg ccacctcgtt gccctgcacg gcttcgaggg cggctccgaa 540

ttcgtcgccg gcgagcagat catggacctc tgggatcgca tatgctcctc tctgaacgtc 600

aggaaggtga gcctcgtcga cacggcgagg aaggggcaca tggagctgcg gctgctgcac 660

ggcgttgcgt acggcgacac gtggttcggg cggtggggct acaggttcgg ccggcccagc 720

tacggcgtcg cgctaccgtc ctaccagcag tcgctgcacg cgctccagtc ggtacctctc 780

tgcgtgctcg tgccgcacct gtcgtgcttc agccaggacc tccccgtggt ggtgaccaag 840

taccaggcca tcagcggcca caagctgctc aacctcggcg acctcctccg cttcatgctc 900

gagctgcgga cgcgcctccc ggcgacctcc gtcaccgcca tggactaccg cggcatcatg 960

tcggaggcct cgtgccggtg gtcggccaag cgcgtggaca tggcggcccg cgccgtggtg1020

gacgctctcc gccgcaccga gccgcccgcg cggtgggtca cgcggcagga ggtgcgcgac1080

gcggcgcgcg cctacatcgg cgacacgggc ctcctcgact tcgtgctcaa gtccctgggc1140

aaccacatcg tcggcaacta cgtcgtgcga cgcgcgatga acccggtgac caaggtgctc1200

gagtactgcc tggaggacgt gtccagcgtg ctcccggcgg tgggcggcgt gccgagcaac1260

ggcggcggca agatgagggt ccggttccag ctcacgcggg cgcagctcat gagggacctg1320

atgcacctgt accgccacgt gctgaaggag ccgagccagg cgctcaccac cggcgccttc1380

ggcgcgatcc ccgtggcggc gcggatggtc ttggacacca agcacttcgt caaagattac1440

cacgaaggtt tcgctccgat caacagtgtt ggagttgggc acgtccacat gaacctgtgt1500

tgcacgctgc ttctgaagaa cgggggtccg gagctggtgg cgccgtacga gacggtcacc1560

ctgccggcgc atgcaacggt gggcgagctc aaatgggagg tgcagaggct gttcagtgag1620

atgtacctcg gcctaaggac cttcacggcc gagtccgtcg ccggggtcgg cgtcagccag1680

gacgcttgcc cggtgctcgg gctcatcgac gtgggaagcg tcgtggtgat cgaaggatca1740

gtcgtcgagc agcagcagct ggcggatgaa agcgtacata cagggagcga ggccgcgtct1800

gtgagcgagg gaggcggcga cagcgagagg gtcgtggact gcgcgtgcgg agcggatgac1860

gacgacgggg agcgcatggc gtgctgcgac atctgcgagg cgtggcagca cacccggtgc1920

gcggggatca aggacaccga cgacgccccg cacgtcttcg tctgcaaccg ctgcgacaac1980

gacgttctgt cattccctcc cttgagctgt tag 2013

<210> 3

<211> 670

<212> PRT

<213>Corn（Zea mays）

<400> 3

Met Ala Ala Asn Asn Lys Thr Met Val Val Ser Leu Gly Ser Ser Arg

1 5 10 15

Arg Arg Lys Arg Gly Glu Met Leu Phe Arg Phe Glu Ser Phe Cys Gln

20 25 30

Pro Gly Tyr Pro Ala Pro Leu Ala Gly Gly Gly Ala Phe Arg Asp Asn

35 40 45

Val Arg Ala Leu Leu Gly Leu Ala His Leu Glu Ala Gly Ala His Gly

50 55 60

Glu Thr Lys Cys Trp Ser Phe Gln Leu Glu Leu His Arg His Pro Pro

65 70 75 80

Thr Val Val Arg Leu Phe Val Val Glu Glu Val Val Asp Thr Ser Pro

85 90 95

Gln Arg Gln Cys His Leu Cys Arg His Val Gly Trp Gly Arg His Leu

100 105 110

Ile Cys Ser Lys Arg Phe His Phe Val Leu Pro Lys Arg Glu Leu Ser

115 120 125

Val Glu Ala Asp Gly Leu His Tyr Gly Ile Asn His Ser Pro Glu Lys

130 135 140

Pro Ser Lys Gly Thr Ala Thr Ser Arg Gly His Leu Leu His Gly Val

145 150 155 160

Val His Leu Asn Gly Phe Gly His Leu Val Ala Leu His Gly Phe Glu

165 170 175

Gly Gly Ser Glu Phe Val Ala Gly Glu Gln Ile Met Asp Leu Trp Asp

180 185 190

Arg Ile Cys Ser Ser Leu Asn Val Arg Lys Val Ser Leu Val Asp Thr

195 200 205

Ala Arg Lys Gly His Met Glu Leu Arg Leu Leu His Gly Val Ala Tyr

210 215 220

Gly Asp Thr Trp Phe Gly Arg Trp Gly Tyr Arg Phe Gly Arg Pro Ser

225 230 235 240

Tyr Gly Val Ala Leu Pro Ser Tyr Gln Gln Ser Leu His Ala Leu Gln

245 250 255

Ser Val Pro Leu Cys Val Leu Val Pro His Leu Ser Cys Phe Ser Gln

260 265 270

Asp Leu Pro Val Val Val Thr Lys Tyr Gln Ala Ile Ser Gly His Lys

275 280 285

Leu Leu Asn Leu Gly Asp Leu Leu Arg Phe Met Leu Glu Leu Arg Thr

290 295 300

Arg Leu Pro Ala Thr Ser Val Thr Ala Met Asp Tyr Arg Gly Ile Met

305 310 315 320

Ser Glu Ala Ser Cys Arg Trp Ser Ala Lys Arg Val Asp Met Ala Ala

325 330 335

Arg Ala Val Val Asp Ala Leu Arg Arg Thr Glu Pro Pro Ala Arg Trp

340 345 350

Val Thr Arg Gln Glu Val Arg Asp Ala Ala Arg Ala Tyr Ile Gly Asp

355 360 365

Thr Gly Leu Leu Asp Phe Val Leu Lys Ser Leu Gly Asn His Ile Val

370 375 380

Gly Asn Tyr Val Val Arg Arg Ala Met Asn Pro Val Thr Lys Val Leu

385 390 395 400

Glu Tyr Cys Leu Glu Asp Val Ser Ser Val Leu Pro Ala Val Gly Gly

405 410 415

Val Pro Ser Asn Gly Gly Gly Lys Met Arg Val Arg Phe Gln Leu Thr

420 425 430

Arg Ala Gln Leu Met Arg Asp Leu Met His Leu Tyr Arg His Val Leu

435 440 445

Lys Glu Pro Ser Gln Ala Leu Thr Thr Gly Ala Phe Gly Ala Ile Pro

450 455 460

Val Ala Ala Arg Met Val Leu Asp Thr Lys His Phe Val Lys Asp Tyr

465 470 475 480

His Glu Gly Phe Ala Pro Ile Asn Ser Val Gly Val Gly His Val His

485 490 495

Met Asn Leu Cys Cys Thr Leu Leu Leu Lys Asn Gly Gly Pro Glu Leu

500 505 510

Val Ala Pro Tyr Glu Thr Val Thr Leu Pro Ala His Ala Thr Val Gly

515 520 525

Glu Leu Lys Trp Glu Val Gln Arg Leu Phe Ser Glu Met Tyr Leu Gly

530 535 540

Leu Arg Thr Phe Thr Ala Glu Ser Val Ala Gly Val Gly Val Ser Gln

545 550 555 560

Asp Ala Cys Pro Val Leu Gly Leu Ile Asp Val Gly Ser Val Val Val

565 570 575

Ile Glu Gly Ser Val Val Glu Gln Gln Gln Leu Ala Asp Glu Ser Val

580 585 590

His Thr Gly Ser Glu Ala Ala Ser Val Ser Glu Gly Gly Gly Asp Ser

595 600 605

Glu Arg Val Val Asp Cys Ala Cys Gly Ala Asp Asp Asp Asp Gly Glu

610 615 620

Arg Met Ala Cys Cys Asp Ile Cys Glu Ala Trp Gln His Thr Arg Cys

625 630 635 640

Ala Gly Ile Lys Asp Thr Asp Asp Ala Pro His Val Phe Val Cys Asn

645 650 655

Arg Cys Asp Asn Asp Val Leu Ser Phe Pro Pro Leu Ser Cys

660 665 670

<210> 4

<211> 1246

<212> DNA

<213>Corn（Zea mays）

<400> 4

tgctgaacag attcgtttga ctcggacaag ttacgtggaa tctgatggtg aaggaccaga 60

gtaagatcgc tactggacta gcctaactgg cattctgatc taaaagcaac cgtattgtac 120

attctagcca tgaagatcac catctgattc tgcgggttcc agtgcaaata ctccacggga 180

caacgaggtt atagcttcag acttcggagt actgtactgc taatgtgagt gcgtataagt 240

gacagacgag cggtgttaca agacgttggg tcgcagagac agtcatagag cacaacacaa 300

ccggctactc ccctgatcga tgtaaagctt agcaaaaata acctaaccgt gacaatgaaa 360

atatgataca gtaatgttta acaacgagct ccgcaagtgt catttgggcg gcgacctacc 420

ctgtgagcgc ggaagttgtg actgaattta cttgggcgtc acacttccgc gcggggcccg 480

aagttgtaga ccatgcattc tgctctgccc cggttgaata ctgtaaaata ttgctcccct 540

tatcctaaac tattcctcct aacgttcggt taggcaaggc agatctcatt gacacagcct 600

gatgccacaa tctacagtca tgcttgaaca caacacaaca caacagcaca gaatttacgt 660

gtaacaccct gcctgtttcc tgtatatgaa aacactactc tcattcatga tcatcacctg 720

gtgtgaattt tgtcatagtg cctgcttgct ataatgtcca agtctcggag atgtctcaaa 780

atcgtatttt ccatgttttt ttttcgataa cttcaaattc caaatgcgtg ttgctcggcg 840

catgcatgga gctcgatacc tttgtccaac ggaaagacta ggcccaacac gtacaattag 900

cctaacgcca ccgtgaagcg ttagcgttca cggatagcat atatctggaa aaagacgagg 960

ttttggttgc aaactttttc cagaacagag cagaggaacc atgcatgctg cgagcgtcgt1020

catatatgtc tagaaggatg tcgggggccg tattgtttac agcgcctcac agtgatcacg1080

cgcgcacact ccaccaccac cagaccgtcc aagctttcta aatcctgggc acttaccgcg1140

tgagaccaag gcgccgatgg aaccactacg gcgaccctcc ctcgcacact gtacgccata1200

aagcgcgcgc ctgcaccacc agctccgcgg cgtccggtcc ggcgac 1246

Claims (2)

1. a kind of control the gene ZmMs7 of corn male fertility to be used for the purposes for improveing corn, it is characterised in that：

Suppressing the expression of the gene ZmMs7 is used for inducing maize plant male sterility, and the DNA sequence dna of the gene ZmMs7 is such as Shown in SEQ ID NO.1 or SEQ ID NO.2.

2. purposes according to claim 1, wherein suppressing the expression of the gene ZmMs7, with inducing maize plant male Infertility, to obtain male sterile line of maize, for hybrid maize breeding and the production of hybrid seeds and Maize Production.