CN105274095B - A pair is used for the guide RNA of knock-out pig NFKB1 gene - Google Patents

Abstract

The invention discloses the leading RNA (sgRNA) of a pair of of targeting pig NFKB1 gene, the sgRNA is formed to by sgRNA-F and sgRNA-R, sgRNA-F and sgRNA-R is made of 102 nucleotide respectively, wherein 5 ' end 2-21 RNA segment can identify NFKB1 gene on pig chromosome, and 22-102 RNA segments are can be with the skeleton RNA segment in conjunction with Cas9n nuclease；The sgRNA-F is as shown in the sequence 2 of sequence table, and the sgRNA-R is as shown in the sequence 4 of sequence table.The present invention is knocked out or is modified to pig NFKB1 gene on cell or individual level by Cas9n system, is pig breeding service to parse function, the building pig NFKB1 gene mutation library of pig NFKB1 gene.

Description

A pair is used for the guide RNA of knock-out pig NFKB1 gene

Technical field

The invention belongs to gene engineering technology fields, in particular to the guide of a pair of of targets identification pig NFKB1 gene RNA and its application.

Background technique

ZFN and TALEN Knockout technology is to study two kinds of more mature site-directed mutagenesis techniques at present, but both technologies Construction procedures are relatively complicated, each site needs to construct a pair of corresponding nuclease.And CRISPR/Cas9 system is to special position The guidance of small crRNA is leaned in the identification of point, and the area CRISPR can be made of a series of crRNA, each for specific site CrRNA only has tens bases, and entire carrier is smaller, relative to ZFN and TALEN carrier, is more easier to construct (CRISPR/ Progress Jiangsu's agriculture journal Li Hui of Cas9 novel gene targeting system etc., 2013).

(CRISPR)/CRISPR-associated (Cas) is that bacterium and a kind of the immune of continuous Evolutionary adaptation of archeobacteria are prevented Imperial mechanism.CRISPR/Cas9 identifies and shears DNA using one section of tiny RNA with foreign nucleic acid molecules of degrading.Cong etc. (Multiplex Genome Engineering Using CRISPR/Cas Systems.Science.2013) and Mali etc. (RNA-guided human genome engineering via Cas9.Science.2013) proves that Cas9 system can be In the various kinds of cell such as 293T, K562, iPS, effective targeting digestion, non-homogeneous recombination (NHEJ), homologous recombination (HR) effect are carried out Rate is suitable with TALEN digestion effect between 3-25%.They also confirm that multiple target spots can carry out targeting digestion simultaneously.But It is, it is subsequent studies have shown that Cas9 has more apparent undershooting-effect (High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.Nature Biotechnology.Fu et al, 2013；High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity.Nature Biotechnology.Pattanayak et al, 2013).Feng Zhang team of the Massachusetts Institute of Technology uses double nicking technology The specificity of Cas9 is improved into 50 times or more (Double nicking by RNA-guided CRISPR Cas9 for Enhanced genome editing specificity.Cell.Ran et al, 2013), Cas9 is maintained in gene targeting The status of technical field.By means of this technology, animal-plant gene functional study and breeding research etc. have all obtained swift and violent hair Exhibition.

NFKB1 is NF κ B transcription factor family important member.Resistance of the polymorphic and pig of pig NFKB1 gene to salmonella Ability correlation (http：//www.ncbi.nlm.nih.gov/nuccore/DQ834921.1).It can be seen that pig NFKB1 gene It can be used as an important candidate gene of pig disease resistant breeding.On cell or individual level to pig NFKB1 gene carry out knock out or Modification, can parse the function of pig NFKB1 gene, be the breeding for disease resistance service of pig.

Summary of the invention

The purpose of the present invention is to provide the leading RNA (sgRNA) of a pair of of targeting pig NFKB1 gene.The present invention utilizes volume This short segment DNA construction of expression vector to sgRNA partial sequence of code, the expression vector can give expression to this to sgRNA, this is right SgRNA can specifically identify pig NFKB1 gene.The present invention also utilizes this to guide Cas9n nuclease (i.e. Cas9 to sgRNA Nicking enzyme) accurately and efficiently targeting modification is carried out to pig NFKB1 gene.

Specifically, the object of the present invention is achieved like this：

The sgRNA of a pair of targeting pig NFKB1 gene, is made of sgRNA-F and sgRNA-R；SgRNA-F and sgRNA-R points Be not made of 102 nucleotide, wherein 5 ' end 2-21 RNA segment (20nt, be respectively designated as sgRNA-F20 and SgRNA-R20 it) can identify that the particular sequence of NFKB1 gene on pig chromosome, remaining 82nt are known as skeleton RNA sequence.22- 102 RNA segments can form hairpin structure, in conjunction with Cas9n nuclease, so that Cas9n nuclease be guided to cut target DNA Single-stranded, two single-stranded nicks cause double-strand break (DSB), and cell utilizes itself repair function, so that the sequence near target site Column change；In addition, this is in the arrangement mode (i.e. 5 ' end phases of the two of " head to head " to the DNA target sequence of sgRNA identification It is mutually close), the two has the interval of 6bp at a distance of 6bp.

The sgRNA-F specifically can be as shown in the sequence 2 of sequence table.

The sgRNA-R specifically can be as shown in the sequence 4 of sequence table.

Another object of the present invention is to provide a pair of of DNA and has divided (be named as specific DNA molecular to), as described in coding The DNA molecular first of sgRNA-F and the DNA molecular second composition for encoding the sgRNA-R.

The DNA molecular first is specific as shown in the sequence 1 of sequence table.

The DNA molecular second is specific as shown in the sequence 3 of sequence table.

Third purpose of the present invention is to provide above-mentioned sgRNA in specific recognition and targeting modification pig NFKB1 gene Using.The pig NFKB1 gene, No. GenBank is DQ834921.1.

4th purpose of the invention is to provide above-mentioned sgRNA to the application in building pig NFKB1 gene mutation library.It is described Pig NFKB1 gene, No. GenBank is DQ834921.1.

Compared with prior art, the present invention provides the sgRNA of a pair of of specific recognition pigs NFKB1 gene, and provide one To the coding DNA segment of the sgRNA, to be struck on cell or individual level to pig NFKB1 gene by Cas9 system It removes or modifies, be pig breeding service to parse function, the building pig NFKB1 gene mutation library of pig NFKB1 gene.

Detailed description of the invention

Fig. 1 is sgRNA shot design result schematic diagram, and single strand cutting site (two single-stranded nicks are wherein represented at arrow Generate a double-strand break).

Fig. 2 was plasmid pair pX335-sgRNA-F and pX335-sgRNA-R cotransfection porcine fetus fibroblasts after 72 hours It extracts DNA and carries out PCR amplification, the part sequencing result (mutant nucleotide sequence) after PCR product is cloned.

Specific embodiment

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly What routine biochemistry reagent shop was commercially available.In following embodiment, unless otherwise specified, it is all made of low sugar DMEM culture medium culture Cell.

PX335 carrier is purchased from Addgene, article No. 42335.Bbs I restriction endonuclease is purchased from NEB company, article No. R0539S.DNA Oligonucleotides is synthesized by Beijing Liuhe Huada Genomics Technology Co., Ltd.

The building of embodiment 1, sgRNA expression plasmid pair

1, sgRNA shot design

The 3rd exon sequence (115- of pig NFKB1 gene is extracted in the sequence that NCBI accession number is DQ834921.1 The region 216bp, as follows), use Massachusetts Institute of Technology online software (http：//crispr.mit.edu/) design target Site.

1 cagagaggat ttcgtttccg ttatgtgtgt gaaggcccct cccatggtgg actccctggc

61 gcatctagtg aaaagaacaa gaagtcctac cctcaggtca aa

Positive target sequence is that GAACAAGAAGTCCTACCCTC (75-94), reversed target sequence are TGCGCCAGGGAGTCCACCAT(44-63).Two target sequences are in the arrangement mode of " head to head ", the two has at a distance of 11bp The interval of 11bp.It is respectively designated as positive target T1, reversed target T2.Drone design is as shown in Figure 1.

2, the building of sgRNA expression plasmid pair

Send Beijing Liuhe Huada Genomics Technology Co., Ltd synthesizing single-stranded few nucleosides according to the target sequence of design first Acid, particular sequence are as follows：

T1-F：CACCG GAACAAGAAGTCCTACCCTC

T1-R：AAAC GAGGGTAGGACTTCTTGTTC C

T2-F：CACCG TGCGCCAGGGAGTCCACCAT

T2-R：AAAC ATGGTGGACTCCCTGGCGCA C

Wherein T1-F and T1-R annealing obtains the double chain DNA fragment with cohesive end, through Bbs I digestion, is connected into pX335 load In body, pX335-sgRNA-F carrier is obtained；T2-F and T2-R annealing obtains the double chain DNA fragment with cohesive end, through Bbs I Digestion is connected into pX335 carrier, obtains pX335-sgRNA-R carrier.Two plasmids send Beijing six directions Hua Da Gene science stock Part Co., Ltd sequence verification, the sequence of sequencing primer bbsR are：5′AAAGTCCCTATTGGCGTTAC 3′.

The bioactivity of embodiment 2, the sgRNA expression plasmid pair constructed by sequence verification embodiment 1

PEF cell (porcine fetus fibroblasts)：Isolated PEF cell (separation method ginseng from the aborted pig fetus See document：Li Hong, Wei Hongjiang, Xu Chengsheng, Wang Xia, minister in ancient times's jade wave, Zeng Yangzhi；Banna Minipig Inbred Line fetal fibroblast cell line Foundation and its biological property；Agricultural University Of Hunan's journal (natural science edition)；The 6th phase of volume 36；In December, 2010；678- 682)。

1, by recombinant plasmid pX335-sgRNA-F and each cotransfection 1 by way of electrotransformation 4 μ g pX335-sgRNA-R ×10⁶PEF cell, obtains recombinant cell.Transfection comprises the concrete steps that：Use consideration convey instrument (Amaxa, model：AAD-1001S) and Matched mammalian fibroblasts transfection reagent box (Amaxa, article No.：VPI-1002 it) is transfected.It uses first 0.05% trypsase (Gibco, article No.：Attached cell 610-5300AG) is digested, with fetal calf serum (Gibco, article No.： 16000-044) terminate digestion, phosphate buffer (Gibco, article No.：10010-023) twice, addition transfection tries washing cell Agent transfects cell using program T-016.

2,37 DEG C of recombinant cell for obtaining step 1 are cultivated 72 hours, then collect cell.It comprises the concrete steps that：Make first With 0.05% trypsase (Gibco, article No.：Attached cell 610-5300AG) is digested, with fetal calf serum (Gibco, article No.： 16000-044) terminate digestion, phosphate buffer (Gibco, article No.：10010-023) washing cell twice, adds 200 microlitres Cell pyrolysis liquid GA (component in TIANGEN company DNA extraction kit DP304).

3, the genomic DNA for the cell that extraction step 2 is collected and as template, with the primer pair of PCRF and PCRR composition into Row PCR amplification (PCRF：5′TTAGTCTCCACATGGCACAGC 3′；PCRR：5 ' AGAGCAGTCCTTTCTTCTGCT 3 '), it returns Receive the pcr amplification product of 435bp.DNA extraction comprises the concrete steps that：Use TIANGEN company DNA extraction kit (article No.： DP304 DNA) is extracted.20 microlitres of Proteinase K Solutions are added in the pyrolysis product obtained by previous step, are mixed.200 microlitres are added to delay Fliud flushing GB, is sufficiently mixed by inversion, and 70 DEG C are placed 10 minutes, and solution becomes limpid, and brief centrifugation is to remove the droplet of cap wall.Add Enter 200 microlitres of dehydrated alcohols, sufficiently oscillation mixes 15 seconds, and brief centrifugation is to remove the droplet of cap wall.Above-mentioned solution is added Enter in an adsorption column CB3,12000rpm is centrifuged 30 seconds, outwells waste liquid, adsorption column CB3 is put back in collecting pipe.To adsorption column 500 microlitres of buffers GD, 12000rpm are added in CB3 centrifugation 30 seconds, outwell waste liquid, adsorption column CB3 is put back in collecting pipe.To 700 microlitres of buffers PW, 12000rpm are added in adsorption column CB3 centrifugation 30 seconds, outwell waste liquid, adsorption column CB3 is put back into collection Guan Zhong.500 microlitres of buffers PW, 12000rpm are added into adsorption column CB3 centrifugation 30 seconds, outwell waste liquid.Adsorption column CB3 is put It recycles in collector, 12000rpm is centrifuged 2 minutes.Adsorption column CB3 is placed in and is placed at room temperature for several minutes, thoroughly to dry adsorbent material The rinsing liquid of middle remnants.Adsorption column CB3 is transferred in a clean centrifuge tube, is vacantly added dropwise to the intermediate position of adsorbed film 50-200 microlitres of elution buffer TE is placed at room temperature for 5 minutes, and 12000rpm is centrifuged 2 minutes, and solution is collected into centrifuge tube.

4, pcr amplification product and pMD18-T carrier (precious biology, the article No. obtained step 3：D101A it) connects, is connected It practices midwifery object.Specifically Connection Step is：Following DNA solution is configured in microcentrifugal tube：1 microlitre of pMD18-T carrier, PCR is produced 4 microlitres of object.5 microlitres of Solution I are added.16 DEG C are reacted 60 minutes.

5, it takes 5 microlitres of connection products to be added in 50 microlitres of DH5 α competent cells (precious biology, D9057S), places 30 on ice Minute.42 DEG C are heated 60 seconds, then are placed 5 minutes on ice.Be added 450 microlitres of LB culture mediums, 37 DEG C shaken cultivation 60 minutes.It applies It is distributed in the LB solid medium tablets of amicillin resistance and is cultivated, random picking 20 are cloned and are sequenced, and are counted The clone for calculating mutation accounts for the ratio of overall clone's number, to estimate the efficiency to sgRNA plasmid.As a result, it has been found that 6 clones Occur being mutated (being detailed in Fig. 2) near expected cleavage site, i.e. recombinant plasmid pX335-sgRNA-F and pX335-sgRNA-R group At cutting efficiency of the plasmid pair in PEF cellular genome up to 30%.

Claims (4)

1. the leading RNA of a pair of targeting pig NFKB1 gene, is made of sgRNA-F and sgRNA-R, sgRNA-F and sgRNA-R divide It is not made of 102 nucleotide, wherein the RNA segment of 5 ' end 2-21 can identify NFKB1 gene on pig chromosome, the 22-102 RNA segments are can be with the skeleton RNA segment in conjunction with Cas9n nuclease；The sequence of the sgRNA-F such as sequence table Shown in column 2, the sgRNA-R is as shown in the sequence 4 of sequence table.

2. a pair of of DNA molecular, by encoding the DNA molecular first of the sgRNA-F and encoding the DNA molecular second group of the sgRNA-R At, it is characterised in that：The DNA molecular first is as shown in the sequence 1 of sequence table, the sequence of the DNA molecular second such as sequence table Shown in column 3.

3. application of the sgRNA described in claim 1 in specific recognition and targeting modification pig NFKB1 gene.

4. application of the sgRNA described in claim 1 in building pig NFKB1 gene mutation library.