CN104560995B - SgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and coding DNA (deoxyribonucleic acid) and application thereof - Google Patents
SgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and coding DNA (deoxyribonucleic acid) and application thereof Download PDFInfo
- Publication number
- CN104560995B CN104560995B CN201410699674.5A CN201410699674A CN104560995B CN 104560995 B CN104560995 B CN 104560995B CN 201410699674 A CN201410699674 A CN 201410699674A CN 104560995 B CN104560995 B CN 104560995B
- Authority
- CN
- China
- Prior art keywords
- sgrna
- sequence
- nucleotide sequence
- pair
- pig
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an sgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and a coding DNA (deoxyribonucleic acid) and application thereof. The sgRNA pair is composed of sgRNA-F and sgRNA-R, wherein the nucleotide sequence of the sgRNA-L is 1) or 2): 1) nucleotide sequence disclosed as Sequence 1 in the sequence table, and 2) nucleotide sequence with the same functions as the nucleotide sequence disclosed as 1) subjected to substitution and/or deletion and/or addition of one or more bases on the nucleotide sequence disclosed as 1); and the nucleotide sequence of the sgRNA-R is 3) or 4): 3) nucleotide sequence disclosed as Sequence 2 in the sequence table, and 4) nucleotide sequence with the same functions as the nucleotide sequence disclosed as 3) subjected to substitution and/or deletion and/or addition of one or more bases on the nucleotide sequence disclosed as 3). The sgRNA pair can greatly increase the fixed point insertion efficiency of the exogenous gene, and provides a stable platform for preparation of transgenic pigs.
Description
Technical field
The invention belongs to gene engineering technology field, and in particular to the sgRNA and its volume in two specific recognition pig H11 sites
Code DNA and application.
Background technology
2010, the o.11 chromosome of the Simon Hippenmeyer of Stanford University and its research team in mice
Upper separation simultaneously identifies a good gene insertion site, is named as hipp11 sites, abbreviation H11 sites.H11 sites position
In Eif4enif1 and the gap of two genes of Drg1,19 exons and 9 extras of Drg1 genes with Eif4enif1 genes
Adjacent, the size about 5kb of aobvious son.H11 sites are due to being located between two genes, therefore safety is higher, without gene silencing effect,
Cell expression activity with wide spectrum.Experiment confirms that the mice of Hipp11 sites fixed point genetic modification and wild-type mice growth are sent out
Educate indistinction.Similar at present also has Ros26 sites, but the site is a gene, and its promoter is general wide spectrum table
Reach, it is difficult to accomplish tissue specific expression, but then there is no similar difficulty in H11 sites, because it is located between two genes,
And there is no promoter, it is possible to which the promoter needed for choice experiment completes the Space-time speciality expression of genes of interest, more
Good reaches task object.If positioning the so safely and effectively genetic modification sites of hipp11 in the genome of pig, will have
Beneficial to the technical system for stablizing transgenic pig cultivation.
ZFN and TALEN Knockout technologies are two kinds of site-directed mutagenesis techniques of the more maturation of research at present, but both technologies
Construction procedures are relatively complicated, and each site needs to build a pair corresponding nucleases, and CRISPR/Cas9 systems are to special position
The identification of point leans on the guiding of little crRNA, CRISPR areas to be made up of a series of crRNA, and each is for specific site
CrRNA only has tens bases, and whole carrier is less, relative to ZFN and TALEN carriers, is more prone to build.
(CRISPR)/CRISPR-associated (Cas) is that antibacterial and a kind of immunity of continuous Evolutionary adaptation of archeobacteria are anti-
Imperial mechanism.CRISPR/Cas9 is recognized using one section of tiny RNA and is sheared DNA with foreign nucleic acid molecules of degrading.Cong etc. and Mali
Effective targeting enzyme action, non-homogeneous restructuring can be carried out Deng proof Cas9 systems in the various kinds of cell such as 293T, K562, iPS
(NHEJ), homologous recombination (HR) efficiency is suitable with TALEN enzyme action effects between 3-25%.They also confirm that multiple target spots can
To carry out targeting enzyme action simultaneously.But, subsequent research shows, Cas9 has effect of more significantly missing the target, Massachusetts science and engineering
The specificity of Cas9 is improve more than 50 times (Double nicking by by Feng Zhang team of institute using double nicking technology
RNA-guided CRISPR Cas9for enhanced genome editing specificity.Cell.Ran et al,
2013) status of the Cas9 in gene targeting field, is maintained.By means of this technology, animal-plant gene functional study and
Breeding etc. will all obtain swift and violent development.
The content of the invention
The present invention devises the sgRNA in a pair of specific recognition pig H11 sites for the H11 sites of pig, and the present invention is also carried
Its corresponding coding DNA and application are supplied.The present invention is using this short segment DNA structure table to sgRNA partial sequences of coding
Up to carrier, the expression vector can give expression to this to sgRNA, and this can specifically recognize pig H11 sites to sgRNA.This
It is bright also accurately and efficiently targeting to be carried out to pig H11 sites to sgRNA guiding Cas9n nucleases (i.e. Cas9 nickings enzyme) using this
Modification.
For achieving the above object, the present invention is adopted the following technical scheme that：
The sgRNA of a pair of specific recognition pig H11 locus genes, is made up of sgRNA-L and sgRNA-R；SgRNA-L and
SgRNA-R is made up of respectively 101 nucleotide, wherein 5 ' end 20nt RNA fragments (be respectively designated as sgRNA-L20 and
SgRNA-R20 specific DNA sequence on chromosome) can be recognized, remaining 81nt is referred to as skeleton RNA fragments.Skeleton RNA fragments can
Hairpin structure is formed, is combined with Cas9n nucleases, so as to guide Cas9n nucleic acid cleavage target DNA single-stranded, two single-stranded to cut
Mouth causes double-strand break (DSB), cell to utilize itself repair function so that the sequence near target site changes；In addition,
, in arrangement mode (i.e. the two 5 ' ends close to each other) " head to head ", the two is apart for this DNA target sequence to sgRNA identifications
4bp, that is, the interval for having 4bp.
The nucleotide sequence of specific DNA sequencing fragment is following 1) or 2) on the identification chromosome of sgRNA-L：
1) nucleotide sequence shown in the sequence 1 in sequence table；
2) by the nucleotide sequence 1) is through the replacement of one or several bases and/or disappearance and/or adds and has
Have with 1) in nucleotide sequence there is the nucleotide sequence of said function；
The nucleotide sequence of specific DNA sequencing fragment is following 3) or 4) on the identification chromosome of sgRNA-R：
3) nucleotide sequence shown in the sequence 2 in sequence table；
4) by the nucleotide sequence 3) is through the replacement of one or several bases and/or disappearance and/or adds and has
Have with 3) in nucleotide sequence there is the nucleotide sequence of said function；
Present invention also offers encoding the DNA molecular of the sgRNA in above-mentioned specific recognition pig H11 sites.
Above-mentioned DNA molecular is made up of the DNA molecular of the DNA molecular and coding sgRNA-R that encode sgRNA-L.
Further, above-mentioned DNA molecular is by the DNA molecular first for encoding sgRNA-L and the DNA molecular of coding sgRNA-R
Second is constituted.
Wherein, the nucleotide sequence of above-mentioned DNA molecular first is by shown in the sequence 3 in sequence table.
Wherein, the nucleotide sequence of above-mentioned DNA molecular second is as shown in the sequence 4 in sequence table.
It is a further object to provide this couple of sgRNA answering in specific recognition and targeting modification pig H11 genes
With.Described pig H11 genes, its nucleotide sequence is as shown in the sequence 5 in sequence table.
Another object of the present invention is applications of this couple of special sgRNA in pig H11 gene mutation storehouse is built.Described
Pig H11 genes, its nucleotide sequence is as shown in the sequence 5 in sequence table.
The sgRNA of a pair of specific recognition pig H11 genes that the present invention is provided, high specificity can effectively reduce CRISPR/
The phenomenon of missing the target that Cas9 systems are present, can greatly increase the efficiency of exogenous gene fixed point insertion, and then reduce Non-specific cleavage
The impact that the mutation in the non-targeted site of caused genome brings.And the coding DNA piece of a pair sgRNA of present invention offer
Section, can be knocked out or be modified, to parse pig H111 genes on cell or individual level by Cas9 systems to pig H11 genes
Function, build pig H11 gene mutation storehouse, the pig to cultivate excellent strain provides prior art support, is the system of transgenic pig
It is standby to provide stabilised platform.
Description of the drawings
Fig. 1 is that detected through gel electrophoresis analyze enzyme action carrier result figure.
Specific embodiment
Following examples are used to further illustrate the present invention, but should not be construed as limiting the invention.Without departing substantially from this
On the premise of spirit and essence, modification made for the present invention or replacement belong to scope of the invention.
The structure of the sgRNA expression plasmids pair of embodiment 1
1st, sgRNA shot designs
According to the H11 sites of mice, Eif4 the and Drg genes (site of mice is located in the middle of two gene) of pig are found,
Zone line is recalled in NCBI and finds out pig H11 sites, its nucleotide sequence as shown in the sequence 5 in sequence table,
The sgRNA target spots of gene knockout are used for according to PAM sequence selections, PAM sequences are NGG：
SgRNA-L target sites position 1 (being named as H11-sgL2):
AGATCAGGGTGGGCAGCTCTGGG
, recognize the nucleotide sequence of the target spot as shown in the sequence 1 in sequence table in corresponding sgRNA-L sequences；Compile
Code the above-mentioned sequence DNA sequence as shown in the sequence 3 in sequence table.
SgRNA-R target sites position 2 (being named as H11-sgR1):TTCCAGGAACATAAGAAAGTAGG, it is corresponding
Recognize in sgRNA sequences in the target spot nucleotide sequence such as sequence table shown in sequence 2；Encode the DNA sequence of the above-mentioned sequence such as
Shown in sequence 4 in sequence table.In arrangement mode " head to head ", the two have the interval of 4bp to two target sequences at a distance of 4bp.
2nd, the structure of sgRNA expression plasmids pair
First primer sequence is designed according to target sequence, after to deliver to Beijing Tian Yihuiyuan bio tech ltd synthesizing single-stranded
Oligonucleotide, particular sequence is as follows：
(1)H11-sgL2:
H11-sgL2-F：CACCGAGATCAGGGTGGGCAGCTCT
H11-sgL2-R:AAACAGAGCTGCCCACCCTGATCTC
(2)H11-sgR1:
H11-sgR1-F:CACCGTTCCAGGAACATAAGAAAGT
H11-sgR1-R:AAACACTTTCTTATGTTCCTGGAAC
Wherein H11-sgL2-F and H11-sgL2-R annealing obtains the double chain DNA fragment H11-sgL2 with sticky end, will
PX335 (addgene, Plasmid 42335) carrier (its nucleotide sequence is as shown in the sequence 6 in the sequence table) enzyme action of Jing Bbs I
Fragment is reclaimed, gL2 is connected in the fragment, obtain pX335-sgRNA-H11-L carriers；H11-sgR1-F is moved back with H11-sgR1-R
Fire obtains the double chain DNA fragment H11-gR1 with sticky end, and the enzyme action of pX335 carrier Jing Bbs I is reclaimed into fragment, and gR1 is connected into
In the fragment, pX335-sgRNA-H11-R carriers are obtained.Two plasmids send Beijing Tian Yihuiyuan bio tech ltd to survey
Sequence verifies that the sequence of sequencing primer bbsR is：5'-GACTATCATATGCTTACCGT-3', sequencing result is respectively as in sequence table
Sequence 7 and sequence 8 shown in.The result shows, can smoothly by the target site 1 of sgRNA and the sequence of target site 2 by aforesaid operations
Row are inserted in pX335 carrier frameworks.
The efficiency checking of the sgRNA expression plasmids pair of embodiment 2
1st, porcine fetus fibroblastses are separated.
From isolated PEF cells in the pig fetus of miscarriage, concrete operations are referring to document：Li Hong, Wei Hongjiang, Xu Chengsheng,
Wang Xia, minister in ancient times's jade ripple, Zeng Yangzhi；The foundation of Banna Minipig Inbred Line fetal fibroblast cell line and its biological property.
2nd, consideration convey dye
The each 2 μ g of recombiant plasmid pX335-sgRNA-H11-L and pX335-sgRNA-H11-R are total to by way of electricity conversion
With transfection PEF cells, reconstitution cell is obtained.What is transfected comprises the concrete steps that：Using consideration convey instrument (Amaxa, model：AAD-1001S)
And supporting mammalian fibroblasts transfection reagent box (Amaxa, article No.：VPI-1002) transfected.First by
0.1% trypsin Gibco, article No.：610-5300AG) attached cell is digested, with hyclone (Gibco, article No.：16000-
044) digestion, phosphate buffer (Gibco, article No. are terminated：10010-023) washed cell twice, adds transfection reagent, uses
Program T-016 transfectional cell.
3rd, the extraction of DNA
37 DEG C of the reconstitution cell that step 2 is obtained is cultivated 48 hours, then collects cell.Comprise the concrete steps that：First by
0.1% trypsin Gibco, article No.：610-5300AG) attached cell is digested, with hyclone (Gibco, article No.：16000-
044) digestion, phosphate buffer (Gibco, article No. are terminated：10010-023) twice, 200 microlitres of cells of addition split washed cell
Solution liquid GA (component in TIANGEN companies DNA extraction kit DP304).Reference reagent box description step extracts the restructuring
The STb gene of cell.
4th, PCR digesting efficiencies checking
(1) primer is utilized
H11-F：5'-GCGAGAATTCTAAACTGGAG-3'；
H11-R：5'-GATCTGAGGTGACAGTCTCAA-3'
Respectively with the cell DNA in step 3 as template, enter performing PCR amplification, reclaim 387bp fragments.It is public using only Shang Lide
Department's T7 Cobra venom endonuclease I (T7endonuclease I, T7E1) (article No.：#E001L) carry out enzyme action identification.Concretely comprise the following steps：
(2) mutant DNA is mixed with the PCR primer of wild type DNA by following system, carries out heat denatured, annealing
Renaturation process (95 DEG C of 5min, naturally cool to room temperature).
(3) above-mentioned reaction system is separately added into 0.5ul T7E1 enzymes, after 37 DEG C of reaction 30min, runs 2% agarose gel
Electrophoresis detection analyzes enzyme action result, and the enzyme action result of target spot is shown in Fig. 1：If sgRNA is effective, target position 1 will cut out 160bp+
230bp bands, target position 2 will cut out 170bp+220bp bands, and 1 can see fuzzy endonuclease bamhi, therefore this pair from figure
GRNA has certain activity.The sgRNA of this pair of specificity specificitys when H11 target sites are cut are very strong, can effectively reduce
The phenomenon of missing the target that CRISPR/Cas9 systems are present, can greatly increase the efficiency of exogenous gene fixed point insertion, and then reduce non-specific
Property the caused non-targeted site of genome of cutting the impact that brings of mutation.
Claims (5)
1. the sgRNA in a pair of specific recognition pig H11 sites, it is characterised in that be made up of sgRNA-L and sgRNA-R, sgRNA-L
Its sequence is made up of respectively specific DNA sequencing fragment and skeleton RNA fragments on identification chromosome with sgRNA-R；
The nucleotides sequence of specific DNA sequencing fragment is classified as shown in the sequence 1 in sequence table on the identification chromosome of sgRNA-L
Nucleotide sequence；
The nucleotides sequence of specific DNA sequencing fragment is classified as shown in the sequence 2 in sequence table on the identification chromosome of sgRNA-R
Nucleotide sequence.
2. encode claim 1 described in specific recognition pig H11 sites sgRNA DNA molecular.
3. DNA molecular according to claim 2, it is characterised in that by the DNA molecular and coding that encode the sgRNA-L
The DNA molecular composition of the sgRNA-R.
4. applications of the sgRNA described in claim 1 in specific recognition and targeting modification pig H11 genes.
5. applications of the sgRNA described in claim 1 in pig H11 gene mutation storehouse is built.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410699674.5A CN104560995B (en) | 2014-11-27 | 2014-11-27 | SgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and coding DNA (deoxyribonucleic acid) and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410699674.5A CN104560995B (en) | 2014-11-27 | 2014-11-27 | SgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and coding DNA (deoxyribonucleic acid) and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104560995A CN104560995A (en) | 2015-04-29 |
| CN104560995B true CN104560995B (en) | 2017-04-26 |
Family
ID=53078074
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410699674.5A Active CN104560995B (en) | 2014-11-27 | 2014-11-27 | SgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and coding DNA (deoxyribonucleic acid) and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104560995B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016082135A1 (en) * | 2014-11-27 | 2016-06-02 | 中国农业科学院北京畜牧兽医研究所 | Method for porcine h11 site-specific insertion by using site-specific cleavage system |
| CN105255886B (en) * | 2015-07-09 | 2018-09-14 | 青岛市畜牧兽医研究所 | The sgRNA of a pair of targeting pig RelA genes |
| CN105274095B (en) * | 2015-07-09 | 2018-11-30 | 青岛市畜牧兽医研究所 | A pair is used for the guide RNA of knock-out pig NFKB1 gene |
| CN105462970B (en) * | 2015-12-17 | 2020-03-31 | 中国农业大学 | Pig specific friendly site Pifs501 and application thereof |
| CN106520831B (en) * | 2016-11-18 | 2020-05-26 | 青岛市畜牧兽医研究所 | Method for modifying mammalian genome |
| CN107904237A (en) * | 2017-11-09 | 2018-04-13 | 石河子大学 | The application of the gene order and the sequence of targeting editor's rabbit H11 locus |
| CN110305872A (en) * | 2019-07-17 | 2019-10-08 | 中国农业科学院北京畜牧兽医研究所 | The construction method of miniature pig diabetes B model and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
| CN103820441A (en) * | 2014-03-04 | 2014-05-28 | 黄行许 | Method for human CTLA4 gene specific knockout through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat) and sgRNA(single guide RNA)for specially targeting CTLA4 gene |
-
2014
- 2014-11-27 CN CN201410699674.5A patent/CN104560995B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
| CN103820441A (en) * | 2014-03-04 | 2014-05-28 | 黄行许 | Method for human CTLA4 gene specific knockout through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat) and sgRNA(single guide RNA)for specially targeting CTLA4 gene |
Non-Patent Citations (3)
| Title |
|---|
| CRISPR/Cas9 and Genome Editing in Drosophila;Andrew R. Bassett et al.;《Journal of Genetics and Genomics》;20131218;第41卷;表2 * |
| CT573021.3;Matthews et al.;《GenBank》;20051224;第1页 * |
| Dissection of Lis1 and Ndel1 in Neuronal Migration;Hippenmeyer et al.;《Neuron》;20101118;第68卷;695-709 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104560995A (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104560995B (en) | SgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and coding DNA (deoxyribonucleic acid) and application thereof | |
| JP7075170B2 (en) | Extended single guide RNA and its uses | |
| CN105646719B (en) | Efficient fixed-point transgenic tool and application thereof | |
| CN104531685B (en) | sgRNA specifically recognizing pig H11 site, and coding DNA and application of sgRNA | |
| US9879283B2 (en) | CRISPR oligonucleotides and gene editing | |
| CN109136248B (en) | Multi-target editing vector and construction method and application thereof | |
| Wang et al. | A simple CRISPR/Cas9 system for multiplex genome editing in rice | |
| US10526590B2 (en) | Compounds and methods for CRISPR/Cas-based genome editing by homologous recombination | |
| JP7100057B2 (en) | Systems and methods for genome editing | |
| Liang et al. | Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection | |
| WO2021023307A1 (en) | Crispr/cas9 gene editing system and application thereof | |
| KR102151065B1 (en) | Composition and method for base editing in animal embryos | |
| EP3733842A1 (en) | System and method for genome editing | |
| WO2020224611A1 (en) | Improved gene editing system | |
| WO2023142594A1 (en) | Accurate pam-limitation-free adenine base editor and use thereof | |
| US20220298494A1 (en) | Enzymes with ruvc domains | |
| EP3929292A1 (en) | System and method for genome editing based on c2c1 nucleases | |
| Kim et al. | Base editing of organellar DNA with programmable deaminases | |
| CA3225082A1 (en) | Enzymes with ruvc domains | |
| CN111662932B (en) | Method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing | |
| CN115772523A (en) | Base editing tool | |
| CN114891791B (en) | sgRNA of specific targeting canine Rosa26 gene and application thereof | |
| WO2024017189A1 (en) | Tnpb-based genome editor | |
| CN118685399A (en) | Engineered guide RNA, CRISPR/CnCas f1 system and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |