CN105263953A - Porcine parvovirus 5A, methods of use and vaccine - Google Patents

Porcine parvovirus 5A, methods of use and vaccine Download PDF

Info

Publication number
CN105263953A
CN105263953A CN201480003551.1A CN201480003551A CN105263953A CN 105263953 A CN105263953 A CN 105263953A CN 201480003551 A CN201480003551 A CN 201480003551A CN 105263953 A CN105263953 A CN 105263953A
Authority
CN
China
Prior art keywords
seqidno
ppv5a
polypeptide
sequence
antibody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201480003551.1A
Other languages
Chinese (zh)
Other versions
CN105263953B (en
Inventor
A·V·耶尔
D·M·M·乔丹
A·R·帕特森
M·B·鲁夫
E·M·沃恩
J·G·维多利亚
C·A·维瑟克
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boehringer Ingelheim Animal Health USA Inc
Original Assignee
Boehringer Ingelheim Vetmedica Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boehringer Ingelheim Vetmedica Inc filed Critical Boehringer Ingelheim Vetmedica Inc
Priority claimed from PCT/US2013/075059 external-priority patent/WO2014099669A1/en
Publication of CN105263953A publication Critical patent/CN105263953A/en
Application granted granted Critical
Publication of CN105263953B publication Critical patent/CN105263953B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention provides novel nucleotides sequences, protein sequences, immunogenic compositions, vaccines, and methods that relate to making and using new porcine parvovirus 5A (PPV5A) that infects, inter alia, domestic swine. The compositions and methods provide for the detection of infections by said new virus, monitoring genetic changes in the viral sequences in wild and domestic animals and herds, and making and using novel vaccines for protecting animals from infection by the virus.

Description

Pig parvoviral 5A, using method and vaccine
sequence table
Subject application is containing the sequence table of with good grounds 37C.F.R.1.821-1.825.The mode that the sequence table of enclosing of subject application is quoted in full is incorporated herein.This ASCII duplicate system called after 10-0150-PCT-SEQ.txt of foundation on March 21 in 2013 and size is 34,542 bytes.
Technical field
The invention belongs to animal health fields and relate to new pig parvoviral strain (comprising the attenuated viral strains for inoculation), manufacture method and use the methods for the treatment of from the vaccine of this novel parvovirus strain acquisition.
Background technology
Parvovirus infections many animals species, and some of them can cause bad clinical disease, but these viruses of major part only cause slight or subclinical infection.It belongs to Parvoviridae (Parvoviridae) and forms two subfamilies: densovirus subfamily (Densovirinae), its member's infected insect; And parvovirus subfamily (Parvovirinae), its member infects vertebrates.A rear subfamily is current comprises five genus: dependovirus (Dependovirus), red Tobamovirus (Erythrovirus), A Liushen mink Tobamovirus (Amdovirus), bocavirus belong to (Bocavirus) and parvovirus (1) (Parvovirus (1)).
Parvovirus virion is for non-Envelope type and containing 5-6 kilobase of having an appointment (kilobases; Kb) sub-thread, linear DNA genome.Genome is made up of two main open reading frames (ORF), these two main open reading frame encodes nonstructural and capsid protein.The bocavirus of nearest description carries the 3rd ORF (1) between two main ORF.
Classical pig parvoviral (PPV1) strain during parvovirus belongs to extensively distributes in the whole world and can cause the reproductive disorders of pig, especially in the drove that vaccination regimen does not correctly carry out or efficacy of vaccines reduces due to immunosuppressive factor.During last decade, in pig, various new parvovirus detected.These parvoviruss comprise pig parvoviral 2 (PPV2) (2) and correlated virus (3).One group of Novel pig and bovine parvovirus is identified in Hong Kong, that is recklessly can virus (hokoviruses) (PHoV, BHoV) (4), and find that these viruses are similar with the mankind PARV4 and PARV5 on genetics.Although it at first recklessly can be viral with Hong Kong called after, proposing PHoV Novel classification is PPV3 (5).PPV4 shows and the highest similarity of bovine parvovirus 2, but code capacity and genome organization and bocavirus similar because the extra ORF3 that PPV4 and bocavirus are encoded similarly between ORF1 and ORF2.But, the presumption ORF3 albumen significantly different from the protein of bocavirus coding (5) of PPV4 coding.
Still need the appearance of new virus in monitoring pig and research and development about the vaccine of new virus, treatment and detection method.
Summary of the invention
The invention provides novel nucleoside acid sequence, protein sequence, immunogenic composition, vaccine and about the method manufacturing and use novel fine minor illness strain, these novel parvovirus strains are especially infected and are raised and train pig.These virus strain relate to ill is raising and train in the tissue sample of pig the novel pig parvoviral identified from clinical; Based on the sequence homology with known pig parvoviral species and virus strain, this novel viral nomenclature is pig parvoviral 5A or PPV5A.
The composition of the present invention and method make to detect infection caused by this new virus, it is wild to monitor and the heredity change of virus sequence in performing animal and drove, and manufacture and use novel vaccines to watch for animals and avoid virus infection.
The immunogenic composition of the present invention and vaccine comprise the peptide sequence by the nucleic acid sequence encoding of SEQIDNO:1, or its immunogenic fragments, comprise the adjuvant for inducing stronger immunogenic response alternatively.
The exemplary composition of the present invention comprises the peptide sequence of SEQIDNO:2, SEQIDNO:3, SEQIDNO:4 or it has any one in the fragment of immunoreactivity to PPV5A specific antibody.The better polypeptide of the present invention comprises the sequence of SEQIDNO:2 or SEQIDNO:4, especially SEQIDNO:4.Preferably, these polypeptide or its fragment have immunoreactivity to PPV5A specific antibody.
In another aspect, the invention provides the nucleotide sequence of coding one or more polypeptide, antibody construct or antibody conjugates.The gene order of coded polypeptide comprises and the sequence at least 95% of SEQIDNO:1,90%, 85% or even 80% homology and/or identical nucleotide sequence, in detail, the nucleotide sequence 2845-5547 of SEQIDNO:1 (capsid protein), or the fragment of polypeptide PPV5A specific antibody to immunoreactivity of encoding in SEQIDNO:1.The exemplary nucleotide sequence of the present invention comprises the sequence of the Nucleotide 2845-5547 of Nucleotide 1975-2844 and SEQIDNO:1 of SEQIDNO:1, and coding has any one in the sequence of the fragment of the polypeptide of immunoreactivity to PPV5A specific antibody.Preferably, nucleotide sequence or gene are that coding has the polypeptide of immunoreactivity or the nucleotide sequence of peptide or gene to PPV5A specific antibody.
In addition, the polypeptide of the present invention as used herein includes, but is not limited to comprise following polypeptide:
I) polypeptide of the aminoacid sequence of SEQIDNO:2 or SEQIDNO:4 is comprised;
Ii) with polypeptide at least 80% homology i) and/or identical polypeptide;
Iii) i) and/or ii) the fragment of polypeptide;
Iv) iii) or fragment iv), it comprises at least 5, better 8, better 10, even better 15 continuous amino acids be included in the sequence of SEQIDNO:2 or SEQIDNO:4;
V) by the polypeptide of polynucleotide encoding, these polynucleotide comprise the sequence of the Nucleotide 2845-5547 of Nucleotide 1975-2844 or SEQIDNO:1 of SEQIDNO:1;
Vi) by with vi) polynucleotide at least 80% homology or identical polynucleotide encoding more than peptide;
Vii) by the protein fragments of polynucleotide encoding, these polynucleotide comprise at least 15, better 24, better 30, even better 45 continuous nucleotides be included in the sequence of the Nucleotide 2845-5547 of Nucleotide 1975-2844 or SEQIDNO:1 of SEQIDNO:1.
The immunogenic composition of the present invention comprises at least that one or more, as the PPV5A polypeptide of definition herein, can comprise the vehicle that physiology can accept further, such as pharmaceutically or veterinary science can accept supporting agent, adjuvant or its combination.
In these PPV5A polypeptide that any PPV5A polypeptide provided thus or comprise provides thus, any immunogenic composition of one or many person all can be used as medicine, goodly be used as vaccine or immunogenic composition, the best object that is used for is for the prevention of PPV5A infection or treatment.
Especially better PPV5A polypeptide comprises the polypeptide with immunogenic epitopes, and these immunogenic epitopes induction has the immunological response of specificity to PPV5A.Better PPVA polypeptide comprises the polypeptide (people such as Simpson with the aminoacid sequence being predicted to be surface antigen in relevant PPV1, JMB315,2002) and include, but is not limited to residue 141-156,272-278 and 329-339 of SEQIDNO:4.
It will be understood by those skilled in the art that the composition of use herein can be associated with the sterile solution that known injectable, physiology can accept.For preparation for parenteral injection or the instant solution of infusion, can use easily to wait and open the aqueous solution, such as normal saline solution or plasma protein solution.In addition, the immunogenicity of the present invention and vaccine composition can comprise supporting agent, thinner, isotonic agent, stablizer or the adjuvant that veterinary science can accept.
The method of the present invention includes, but is not limited in object, cause the immunoreactive method for PPV5A infection, and it comprises to use to object and comprises one or more step as the immunogenic composition of the PPV5A polypeptide of definition herein.Preferably, for PPV5A be greater than One serotype or virus strain causes immune response.The composition of the present invention can be used for treatment or prevention PPV5A infects.Preferably, this immune response reduces relevant to the infection of one or more PPV5A serotype or one of to be caused by the infection of one or more PPV5A serotype or the sickness rate of various clinical symptom or seriousness.
Herein, need the proper object used of the composition accepting the present invention comprise needs prevention or treatment and virus, microorganism, parasite, protozoon, bacterium or fungi about infection, disease or symptom animal.The animal carrying out immune response stimulating by the composition or method that use the present invention comprises domestic animal, such as pig, ox, poultry (such as chicken, duck, goose or turkey), goat and sheep; And performing animal, such as mouse, rabbit, dog, cat and horse.Better animal comprises pig, murine, equine species, lagomorph and bovid.Best in the immune response of pig moderate stimulation.
The present invention also provides reduction and PPV5A infect relevant or are infected by PPV5A and one of to cause or the sickness rate of various clinical symptom or the method for seriousness, it comprises the step of the immunogenic composition using the present invention, this immunogenic composition comprises one or more PPV5A peptide provided thus and goodly comprises carrier molecule, make compared with the object of the immunogenic composition provided thus is not provided, the sickness rate of the clinical symptom of PPV5A infection or seriousness reduce at least 10%, better at least 20%, better at least 30%, better at least 50%, better at least 70%, the best at least 100%.These clinical symptoms comprise and infect by independent PPV5A the viremia and immunosuppression that cause.These clinical symptoms can comprise neurological symptom (dysthymia disorders, ataxia, drowsiness), diarrhoea, expiratory dyspnea, body condition loss, arthroncus (cause and walk lamely and lie on the back), average every daily weight increase reduce, the dead and polyserositis that caused by the concurrent infection with another organism (such as mycoplasma hyorhinis (Mycoplasmahyorhinis)).
According to another aspect, the present invention also relates to the method for prevention PPV5A infection, wherein this PPV5A infect can by with SEQIDNO1, 2, the nucleotide sequence of 3 and/or 4 has 100% sequence thereto, with SEQIDNO1, 2, the nucleotide sequence of 3 and/or 4 has at least 95% sequence thereto, with SEQIDNO1, 2, the nucleotide sequence of 3 and/or 4 have at least 90% sequence thereto or and SEQIDNO1, 2, the PPV5A that the nucleotide sequence of 3 and/or 4 has at least 85% sequence thereto causes, the method comprises the step of the immunogenic composition using the present invention, this immunogenic composition comprises one or more PPV5A peptide provided thus.
The method of any immunogenic composition that the present invention also provides preparation to provide thus, the PPV5A peptide that the method comprises to be provided thus by one or more mixes with carrier molecule, goodly makes this one or more PPV5A peptide and carrier molecule covalent coupling or put together each other.These conjugates can be multivalence or unit price.The immunity that multivalent composition or vaccine comprise multiple PPV5A peptide and carrier molecule combines.In another aspect, the invention provides the method manufacturing one or more PPV5A peptide, the method comprises the nucleic acid molecule transformed host cell (being preferably prokaryotic cell prokaryocyte, such as intestinal bacteria (E.coli)) with any PPV5A peptide provided thus of encoding.Or host cell can be eukaryotic cell, such as zooblast, insect cell, protist cell, vegetable cell or fungal cell.Preferably, eukaryotic cell is mammalian cell, such as CHO, BHK or COS; Or fungal cell, such as yeast saccharomyces cerevisiae (Saccharomycescerevisiae); Or insect cell, such as Sf9.It is also better that the baculovirus (Baculovirus) of nucleic acid of the present invention is expressed.
The present invention provides the method manufacturing one or more PPV5A peptide on the other hand, and this one or more PPV5A inducing peptide is at least one PPV5A genetic variation and the immune response of two or more PPV5A genetic variation better.This method comprises cultivates through the expression vector of conversion, this expression vector codes through conversion and express one or more PPV5A peptide disclosed herein.Protein through expression retains by expressing organism or secretes in substratum.Expression ties up to be enough to carry out under generation can induce the condition for the immunoreactive PPV5A peptide of PPV5A.PPV5A serotype (PPV5A inducing peptide is for its immune response) includes, but is not limited to the sequence with at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91% or 90% homogeny.
The method of composition manufacturing the present invention can comprise further by the conjugate of one or more PPV5A peptide and carrier molecule and the vehicle that physiology can accept (such as pharmaceutically or veterinary science can accept supporting agent, adjuvant or its combine) mix.Those skilled in the art will recognize that vehicle, the selection of adjuvant or combination will especially determine by route of delivery, individual preference and animal species.
In another aspect, the invention provides the method for the PPV5A infection in diagnosis object.The method comprises provides one or more PPV5A peptide; Make this one or more PPV5A peptide and the sample contacts from object acquisition; And if detect in the sample to which and in conjunction with the antibody of one or more PPV5A peptide, then can identify that object suffers from PPV5A and infects.
In another aspect, the invention provides determine object be previously exposed to PPV5A infect and the immunoreactive method can expressed for PPV5A.The method comprises provides one or more PPV5A peptide; Make this one or more PPV5A peptide and the sample contacts from object acquisition; And if detect in the sample to which and in conjunction with the antibody of one or more PPV5A peptide, then can identify that object suffers from PPV5A and infects.
Also providing package is containing the test kit of immunogenic composition in the present invention, and this immunogenic composition comprises one or more PPV5A peptide, better for carrier molecule; For encapsulating the container of immunogenic composition; One group of printing description; And immunogenic composition can be used the dispensing device of animal.Alternatively, one or more PPV5A peptide and carrier molecule can conjugated form or packed with compound form out of the ordinary.When separately for seasonable, also supply the component that one or more PPV5A peptide and carrier molecule are puted together and suitable printing description.
The present invention is also provided for the test kit inoculated animal, and it comprises one group of printing description; The immunogenic composition comprising one or more PPV5A peptide provided thus can be applied to the dispensing device of animal; And wherein at least one PPV5A peptide makes animal infect relevant disease immune at least one to PPV5A effectively.Preferably, this one or more PPV5A peptide system is selected from the PPV5A peptide provided thus.The test kit of the present invention can comprise supporting agent that veterinary science can accept, adjuvant or its combination further.
Its inclusion can be executed with drops and join by the dispensing device in the test kit of the present invention; And when in intranasal, per os, intracutaneous or intramuscular use animal time, the immunogenic composition comprising the PPV5A peptide provided thus included in test kit can reduce the seriousness of at least one clinical symptom of PPV5A infection.Preferably, compared with the infected animals of untreated, the better reduction at least 10% of seriousness of clinical symptom, better at least 20%, better at least 30%, better at least 50%, better at least 70%, the best at least 100%.
Also the method being used for the treatment of or preventing the infection caused by PPV5A is disclosed.The method comprises the immunogenic composition of the present invention to subject effective amounts, and wherein this treatment or prevention system are selected from by the following group formed: the symptom of minimizing PPV5A infection, the seriousness reducing the clinical symptom of PPV5A infection or sickness rate, reduction are infected the object mortality ratio and combination thereof that cause by PPV5A.
The composition of the present invention comprises supporting agent that veterinary science can accept, adjuvant or its combination further.These compositions can be used as vaccine and comprise one or more extra attenuated vaccine, inactivated vaccine or its combination.These vaccines cause and react to the protective immunity be selected from by the relevant disease of the virus of the following group formed at least one: pig parvoviral 1,2,3,4,5A, 5B, other pig parvoviral kind, other pig pathogenic virus and bacterium and combination thereof.The vaccine that can amount to other type used with the vaccine group for PPV5A includes, but is not limited to 2 type porcine circovirus (such as circoFLEX, circoFLEX-MycoFLEX), pig reproducibility and breathing syndrome virus are (such as pRRSATP, pRRSVMLV), pig parvoviral (such as pRRSV-PLE), mycoplasma (such as mycoFLEX) etc.
It will be understood by those skilled in the art that the composition of use herein can be associated with the sterile solution that known injectable, physiology can accept.For preparation for parenteral injection or the instant solution of infusion, can use easily to wait and open the aqueous solution, such as normal saline solution or plasma protein solution.In addition, the immunogenicity of the present invention and vaccine composition can comprise pharmaceutically or veterinary science can accept supporting agent, thinner, isotonic agent, stablizer or adjuvant.
The method of the present invention also can comprise the composition of the present invention and veterinarily acceptable supporting agent, adjuvant or its combined hybrid.Those skilled in the art will recognize that supporting agent, the selection of adjuvant or combination will especially determine by route of delivery, individual preference and animal species.
The present invention also provides by using composition to animal to reduce the method for the seriousness of Progressive symmetric erythrokeratodermia PPV5A infection in animal.Composition can comprise the combination of attenuated virus culture or one or more PPV5A peptide and the veterinary science supporting agent that can accept.
Better route of administration comprises in intranasal, per os (such as in tap water), intracutaneous and intramuscular.Be preferably intramuscular to use, best with single dose form.Those skilled in the art will recognize that, the composition of the present invention can also be used and use by other route of administration by more than twice or twice dosage.For example, these other approach comprise in subcutaneous, intracutaneous, intravenously, Ink vessel transfusing, intra-arterial, intraperitoneal, sheath, tracheal strips, intracutaneous, in intracardiac, leaflet, in marrow, in lung or intravaginal.Depending on required time length and the validity for the treatment of, the composition of the present invention can be used once or several, also can use off and on, such as every day and using with various dose within a couple of days, several weeks or several months.
The present invention is also provided for the test kit inoculated animal, and it comprises one group of printing description; Can by the dispensing device of vaccine administration animal; And at least one is from the strain isolated of cell culture (including but not limited to bacterium, fungi, insect or mammalian cell cultures), its effectively make animal at least one and PPV5A, other parvovirus strain, other pathogenic agent and/or its combine relevant disease immune.The test kit of the present invention can comprise supporting agent that veterinary science can accept, adjuvant or its combination further.
Its inclusion can be executed with drops and join by the dispensing device in the test kit of the present invention; And when in intranasal, per os, intracutaneous or intramuscular use animal time, strain isolated included in test kit can reduce the seriousness of at least one clinical symptom of PPV5A infection.In some test kits, strain isolated also can reduce the seriousness of at least one clinical symptom of PPV5A infection.Preferably, compared with the infected animals of untreated, the seriousness of clinical symptom reduces at least 10%.
Other target of the present invention, feature and advantage will become apparent by the following detailed description.Although However, it should be understood that the preferred embodiment of instruction the present invention, to describe in detail and specific embodiment system only provides as explanation, because those skilled in the art are by the various change understood from this detailed description in the spirit of the present invention and category and amendment.
Accompanying drawing explanation
The following drawings forms the part of this specification sheets, and comprises these accompanying drawings to further illustrate some aspect of the present invention.Can by with reference to one of in these accompanying drawings or many persons, the detailed description combining the specific embodiment provided herein understands the present invention better.Subject application contains at least one the figure made with colour.The duplicate with color drawings of present patent application publication will had needs by business quarters and provided after paying necessary expense.
Fig. 1 is the nucleotide sequence of PPV5A (SEQIDNO:1).
Fig. 2 is the protein sequence of PPV5A replicative enzyme (SEQIDNO:2).
Fig. 3 is the protein sequence of PPV5A open reading frame (ORF) protein (SEQIDNO:3).
Fig. 4 is the protein sequence of PPV5A capsid protein (SEQIDNO:4).
Fig. 5 is that the protein sequence of PPV5A capsid protein and the paired amino acid identity of other virus sequences many compare.
Reference about virus sequence is recited in table 1:
Table 1
Fig. 6 shows compared with other virus VP 1 enumerated in table 1 and capsid protein, the Phylogenetic analysis (phylogeneticanalysis) in the VP1/CAP region of PPV5A.
Fig. 7 shows the homogeny of PPV5A capsid protein (the residue 55-792 of SEQIDNO:4) and the most closely-related PPV4 albumen (GenBank numbering AFM73871 (SEQIDNO:5)), and it shows 40% (310/774) sequence thereto.
Fig. 8 shows the homogeny of PPV5A replicase protein (the residue 15-516 of SEQIDNO:2) and the most closely-related PPV4 albumen (GenBank numbering ADB20210 (SEQIDNO:11)), and it shows 58% (292/504) sequence thereto.
Embodiment
The invention provides with herein the novel pig parvoviral 5A that discloses and the relevant nucleic acid of variant thereof and the effective fragment of fragment, polypeptide and immunology thereof, vaccine, the effective preparation of immunology, antibody, diagnostic assay and test kit, and manufacture and use the method for these compositions and preparation.
Unless otherwise instructed, otherwise the practice of the present invention will use the routine techniques of molecular biology, microbiology, recombinant DNA technology, protein chemistry and immunology known in the art.These technology absolutely prove in the literature.See such as Sambrook, Fritsch and Maniatis, MolecularCloning:ALaboratoryManual, I, II and III roll up, the second edition (1989); DNACloning, I and II volume (D.N.Glover compiles 1985); OligonucleotideSynthesis (M.J.Gait compiles 1984); NucleicAcidHybridization (B.D.Hames and S.J.Higgins compiles 1984); AnimalCellCulture (R.K.Freshney compiles 1986); ImmobilizedCellsandEnzymes (IRL press, 1986); Perbal, B., APracticalGuidetoMolecularCloning (1984); MethodsInEnzymology series (S.Colowick and N.Kaplan compiles, AcademicPress, Inc.); Proteinpurificationmethods-apracticalapproach (E.L.V.Harris and S.Angal compiles, IRLPress, OxfordUniversityPress); And HandbookofExperimentalImmunology, I-IV volume (D.M.Weir and C.C.Blackwell compiles, 1986, BlackwellScientificPublications).
Before describing the present invention in detail, should be understood that and the invention is not restricted to specific DNA, peptide sequence or process parameter, thus these sequences or the certain alterable of parameter.Also should be understood that term system used herein only for describe the present invention specific embodiment object and to be not intended to tool restricted.Must be noted that, unless indicated in addition clearly herein, otherwise as in this specification sheets and appended claims use, singulative " (a/an) " and " should (the) " comprise a plurality of indicator.Therefore, for example, the mixture comprising two or more antigen is mentioned to " antigen ", the mixture comprising two or more vehicle is mentioned to " vehicle ", and analogue.
a. define
Unless otherwise defined, otherwise when submit applications, all technology of use herein and scientific terminology have with those skilled in the art usually understand identical implication.The implication of term and category should be clear; But if there is any potential ambiguity, then the definition provided herein has precedence over any dictionary or extrinsic definition., unless the context requires otherwise, otherwise singular references should comprise plural form and plural term should comprise singulative in addition.Herein, unless otherwise stated, the use of "or" mean " and/or ".In addition, term " comprises (including) " and the use of other form (such as " comprising (includes) " and " comprising (included) ") does not have restricted.The all patents mentioned herein and publication are all incorporated herein by reference.
" protection for disease ", " protective immunity ", " functional immunity " and similar phrase mean the reaction for disease or symptom by using the therapeutic composition of one or more the present invention or its combination and generation, its deleterious effect caused be exposed to disease or infection without less compared with desired by the object of immunity.That is the seriousness of the deleterious effect infected in the object of inoculation reduces.In the object through inoculation, can reduce, slow down or possibility preventing infection completely.Herein, when meaning complete preventing infection, it is by certain illustrated.If prevent completely undeclared, then this term comprises partial prophylaxis.
Herein, " reduce the sickness rate of clinical symptom and/or seriousness " or " minimizing clinical symptom " means compared with (but being not limited to) infects with wild-type, in reduction colony, the number of infected object, reduction or elimination present the number of the object of the clinical symptom of infection or reduce in one or more object the seriousness of any clinical symptom existed.For example, it should refer to that any pathogen load reduces, pathogenic agent comes off, pathogen propagation reduces or any clinical symptom venereal disease of PPV5A infection levies minimizing.Preferably, with do not accept composition and compared with the object be infected, one or more accepts these clinical symptoms in the object of the therapeutic composition of the present invention and is reduced by least 10%.More preferably, accept clinical symptom in the object of the composition of the present invention and be reduced by least 20%, better at least 30%, better at least 40% and better at least 50%.
Term " protection of increase " means (but being not limited to) in this article compared with the object control group without inoculation, infects one of relevant or various clinical symptom significantly reduce in the group of objects of inoculation with infectious agent (being preferably PPV5A).Term " clinical symptom significantly reduces " means (but being not limited to) after challenge infection thing, compared with the control group without inoculation, in the group of objects of inoculation, the frequency of disease development of at least one clinical symptom reduces at least 10%, better 20%, better 30%, better 50% and better 70%.
" long-effective protection " should refer to " effect of improvement ", and it continued at least 3 weeks, but better at least 3 months, better at least 6 months.In domestic animal situation, the best reaches the mean age of selling its meat for long-effective protection should continue to animal.
" immunogenicity or immune composition " means the objective composition comprising at least one PPV5A protein or polypeptide or its immunogenic portion, and it causes the immunological response in the host of cell or the antibody-mediated immune response for said composition.In the preferred embodiment of the present invention, immunogenic composition induction one of to be infected for PPV5A or the immune response of various clinical symptom and better imparting protective immunity.
It " immunogenicity " PPV5A polypeptide or " antigen " mean the polypeptide or protein that cause immunological response described herein as used herein." immunogenicity " PPV5A protein or polypeptide comprise the full length sequence of any encoding sequence of qualification herein or its analogue or immunogenic fragments.Term " immunogenic fragments " or " immunogenic portion " mean the fragment of the aminoacid sequence of PPV5A protein or through brachymemma and/or be substituted form, it comprises one or more epi-position and therefore causes immunological response described herein.Usually, these are through brachymemma and/or be substituted form or fragment and will comprise or encode at least six continuous amino acids from full-length proteins (such as capsid protein).More preferably, through brachymemma or be substituted form or fragment will have at least 10, better at least 15, and better at least 19, and better 30 continuous amino acids from full-length proteins (such as capsid protein).
Term " epi-position " means section or the fragment of objective composition such as protein or polypeptide, and it is by immune system recognition, specifically by antibody, B cell or T cell identification.In the present invention, one of epi-position peptide sequence being generally viral protein or multiple fragment.
These fragments can use the multiple epitope mapping techniques qualification known in prior art.See such as EpitopeMappingProtocolsinMethodsinMolecularBiology, the 66th volume (GlennE.Morris compiles, 1996) HumanaPress, Totowa, NewJersey.For example, linear epitope can by synthesizing a large amount of peptides (these peptides correspond to some part of protein molecule) and make when these peptides are still attached to upholder peptide and antibody response determine on solid support thing simultaneously.Technique known and describe in the prior art, see such as No. the 4th, 708,871, United States Patent (USP); The people such as Geysen (1984) Proc.Natl.Acad.Sci.USA81:3998-4002; And people (1986) Molec.Immunol.23:709-715 such as Geysen.Similarly, easily conformational epitope can be identified by the space conformation (such as by such as x-ray crystallography and two dimensional NMR) determining amino acid.See EpitopeMappingProtocols, see above.Also synthetic antigen is comprised, such as multi-epitope, side joint epi-position and other restructuring or the antigen derived with synthesis mode in this definition.See people (1993) Eur.J.Immunol.23:2777-2781 such as such as Bergmann; The people such as Bergmann (1996), J.Immunol.157:3242-3249; Suhrbier, A. (1997), Immunol.andCellBiol.75:402-408; And the people such as Gardner, (1998) 12thWorldAIDSConference, Geneva, Switzerland, 28-July 3 June, 1998 (its teaching and content are all incorporated herein by reference).
" immune response " or " immunological response " means (but being not limited to) developing cells and/or antibody-mediated for immune response that is compositions related or vaccine.Usually, immunity or immunological response include, but is not limited to following one of on or many persons: the generation of antibody, B cell, helper cell, suppressor T cell and/or cytotoxic T cell or activation, it is specifically for antigen included in vaccine compositions related or interested.Preferably, host will show therapeutic or protective immunity (memory) reaction, make will to strengthen the resistance of novel infection and/or the clinical severity reduction of disease.This protection will be reduced by symptom number, symptom severity; Or there is not one or more symptom relevant with pathogenic infection; Viremia outbreak postpones; The permanent reduction of virus; Overall virus load reduces and/or virus discharges reduction proof.
Herein, " specific immunoreactivity " means immunoreactive protein matter or polypeptide, and it identifies the antigen property of PPV5A infection, but does not react with the antigen property strictly attacking contrast.For determining the specificity of potential PPV5A immunoreactive protein matter or other polypeptide, panimmunity analytical method (ELISA, IFA, Western blot (WesternBlot)) test protein will be used for the animal serum containing the upper similar virus of heredity.Also by for material (baculovirus, the Sf9 cell etc.) test protein in panimmunity analytical method containing the protein relevant to expression method.
As used herein, " pharmaceutically or veterinarily acceptable supporting agent " or " vehicle " comprise any and all solvents, dispersion medium, dressing, adjuvant, stablizer, thinner, sanitas, antibacterial agent and anti-mycotic agent, isotonic agent, absorption delay agent and analogue thereof.In some preferred embodiment and especially in the embodiment comprising freeze-drying immunogenic composition, the stablizer for the present invention comprises the stablizer for freeze-drying or lyophilize.
In certain embodiments, the immunogenic composition of the present invention contains adjuvant.It " adjuvant " can comprise aluminium hydroxide and aluminum phosphate, saponin(e (such as QuilA, QS-21 (CambridgeBiotechInc. as used herein, CambridgeMA), GPI-0100 (GalenicaPharmaceuticals, Inc., Birmingham, AL)), water-in-oil emulsion, O/w emulsion, water-in-oil-in-water compositions.Emulsion can especially based on following material: light liquid state paraffin oil (European Pharmacopoeia (EuropeanPharmacopea) type); The isoprenoid oil of such as squalane or squalene; The oil of generation is closed by the oligomerization of alkene, especially iso-butylene or decene; Acid containing straight chained alkyl or the ester of alcohol, more in particular be vegetables oil, ethyl oleate, propylene glycol two (octanoate/decylate), glycerine three (octanoate/decylate) or Rikemal PO 200; The ester of branched chain lipid acid or alcohol is especially isostearate.Oil and emulsifier combination use to form emulsion.Emulsifying agent is preferably non-ionic surfactant, especially for alternatively through the ester of the sorbitan ester of ethoxylation, mannide ester (such as anhydrate mannitol oleic acid ester), diol ester, polyglycerol ester, propylene glycol ester and oleic acid, Unimac 5680, ricinolic acid or oxystearic acid, and polyoxypropylene polyoxyethylene copolymer block, especially be Pluronic product, be in particular L121.See people such as Hunter, TheTheoryandPracticalApplicationofAdjuvants (Ed.Stewart-Tull, D.E.S.), JohnWileyandSons, NY, the people such as 51-94 page (1995) and Todd, Vaccine15:564-570 (1997).Exemplary adjuvant is " VaccineDesign, TheSubunitandAdjuvantApproach ", M.Powell and M.Newman compiles, PlenumPress, the emulsion MF59 of description in the SPT emulsion of description in 1995 the 147th page and the 183rd page of same book.
The compound of the multipolymer that another embodiment of adjuvant is the polymkeric substance and MALEIC ANHYDRIDE and alkenyl derivative that are selected from acrylic or methacrylic acid.Favourable adjuvant compound is the polymkeric substance of especially crosslinked with polyalkenyl ether that is sugared or polyvalent alcohol acrylic or methacrylic acid.These compounds are by term carbomer (carbomer) known (Phameuropa the 8th volume, the 2nd phase, in June, 1996).Those skilled in the art also can with reference to United States Patent (USP) the 2nd, 909, No. 462, it describes and has at least 3 hydroxyls, is goodly no more than these acrylate copolymer that hydroxylated compounds is crosslinked more than 8 hydroxyls, and the hydrogen atom of at least three hydroxyls is through having the unsaturated aliphatic group displacement of at least 2 carbon atoms.Better group is the group containing 2 to 4 carbon atoms, such as vinyl, allyl group and other alkene system unsaturated group.These unsaturated groups itself can contain other substituting group of such as methyl.Be especially be applicable to the product (BFGoodrich, Ohio, USA) of designation card ripple not (Carbopol) sale.Itself and allyl sucrose or be cross-linked with allyl group pentaerythritol.Wherein, card ripple not 974P, 934P and 971P can be mentioned.Best for using card ripple not 971P.In the multipolymer of MALEIC ANHYDRIDE and alkenyl derivative, have multipolymer EMA (Monsanto), it is the multipolymer of MALEIC ANHYDRIDE and ethene.The dissolving of these polymkeric substance in water produces acidic solution, and it will through neutralization, better to physiological ph to produce assist agent solution, immunogenicity, immunity or vaccine composition itself will be incorporated in this assist agent solution.
Other adjuvant be applicable to especially includes, but is not limited to RIBI adjuvant system (RibiInc.), segmented copolymer (CytRx, AtlantaGA), SAF-M (Chiron, EmeryvilleCA), monophosphoryl lipid A, avridine (Avridine) lipid-amine adjuvant, from the heat labile enterotoxin (restructuring or alternate manner) of intestinal bacteria (E.coli), Toxins,exo-, cholera (choleratoxin), IMS1314 or Muramyl dipeptide, or natural existence or reconstitution cell hormone or its analogue or endogenous cell hormone release stimulant.
Expection adjuvant can often agent about 100 μ g be to the amount of about 10mg, and the amount of better every agent about 500 μ g to about 5mg, the amount of better every agent about 750 μ g to about 2.5mg and best every agent are about the amount interpolation of 1mg.Or, with the volumeter of final product, adjuvant can be in the concentration of about 0.01% to 50%, better be in about 2% to 30% concentration, better be in about 5% to 25% concentration, better be in about 7% to 22% concentration and the best be in 10% to 20% concentration.
" thinner " can comprise water, normal saline solution, dextrose, ethanol, glycerine and analogue thereof.Isotonic agent can especially comprise sodium-chlor, dextrose, mannitol, Sorbitol Powder and lactose.Stablizer especially comprises an alkali metal salt of albumin and ethylenediamine tetraacetic acid (EDTA).
" through being separated " means " by artificial " and changes from native state, and also even it is present in occurring in nature, then it has changed from its initial environment or has shifted out, or both.For example, when this term is used for herein, be naturally present in polynucleotide in live organism or polypeptide not " through being separated ", but the identical polynucleotide be separated with the coexisting substances of its native state or polypeptide " through being separated ".
" security " means that the animal through inoculation does not occur adverse consequences after inoculation, and these adverse consequencess include, but is not limited to: the vaccine based on virus of living may be reversed into toxicity; Remarkable clinical side effects, the such as unacceptable inflammation of persistence, systemic disease or vaccine administration site.
Term " inoculation (vaccination/vaccinating) " as used herein or its variant mean (but being not limited to) process, it comprises the immunogenic composition using the present invention, and this immunogenic composition causes the immune response that maybe can cause for PPV5A in (directly or indirectly) animal when using animal.
Under the background of the present invention, " death " means the death caused with the concurrent infection of other organism infected by PPV5A and/or infect by PPV5A enhancings, and comprises and put to death animal in order to avoid suffer hardships and its life provided to the situation of humanity termination because infecting too serious.
" attenuation " means the toxicity reducing pathogenic agent.In the present invention, " attenuation " and " nontoxicity " synonym.In the present invention, attenuated virus has reduced for its toxic the clinical symptom making it not cause PPV5A infection, but the immunoreactive virus in targeting mammalian can be induced, but also can mean and be subject to non-attenuated PPV5A and infect and do not accept compared with it " control group " animal of attenuated virus, the sickness rate or the seriousness that are subject to the clinical symptom in the animal of attenuation PPV5A infection reduce.In this context, term " reduce (reduce/reduced) " means reduction at least 10% compared with control group as hereinbefore defined, better 25%, better 50%, better 60%, better 70%, better 80%, and better 90% and best 100%.Therefore, attenuation, non-toxic PPV5A virus strain are be applicable to being incorporated to the virus strain in the immunogenic composition comprising modified work PPV5A virus.
" kill " or " deactivation " means with physics or chemical reagent process, this physics or chemical reagent make PPV5A viral kill and/or otherwise make it not reproduce.PPV5A can be killed by prior art method, such as heat, radiation or UV-light exist under use psoralene.PPV5A deactivation can be made by prior art method, such as use one or more chemical ablation agent, one of to include but not limited in binary ethylenimine (BEI), beta-propiolactone, formalin (formalin), glutaraldehyde and/or sodium lauryl sulphate or many persons carry out chemical ablation.Make the method for the method of the virulent virus strain attenuation of these viruses and manufacture inactivation of viruses preparation known in the art, and be described in such as U.S.4,567,042 and 4,567, in 043.Therefore can especially be totivirus form for the antigen from PPV5A in the vaccine composition of the present invention, totivirus be modified and/or the live virus preparation of attenuation or through killing or the virus formulation of deactivation.
It " antibody " comprises anti-PPV5A antibody as used herein, such as mono-clonal and polyclonal antibody, single-chain antibody, chimeric antibody, humanized antibody, people's antibody, pig antibody and CDR grafted antibody, comprise the compound of the CDR sequence comprising the PPV5A polypeptide specifically identifying the present invention.Term " right ... to have specificity " indicates the variable region of the antibody of the present invention only to identify and (that is can distinguish single PPV5A polypeptide and related polypeptide in conjunction with PPV5A polypeptide, and ignore the sequence thereto found in peptide family, homology or similarity), and allow (alternatively) its via with the outside, variable region of antibody (and in detail, in the constant region of antibody molecule) sequence interact and interact with other oroteins (other antibody in such as staphylococcus aureus protein A (S.aureusproteinA) or elisa technique).Screening strength method for measuring the binding specificity of the antibody of the present invention is well-known in the art and puts into practice routinely in the art.Discuss about the comprehensive of these analytical methods, see the people such as Harlow (volume), AntibodiesALaboratoryManual:ColdSpringHarborLaboratory; ColdSpringHarbor, NY (1988), the 6th chapter.Also contain and identify and the antibody of fragment in conjunction with the PPV5A polypeptide of the present invention, prerequisite is that these antibody first and at first have specificity as hereinbefore defined to the PPV5A polypeptide of the present invention deriving this fragment.For clarity, " antibody " means immunoglobulin molecules, and it can be incorporated into this antigen due to the immune response for specific antigens.The serum protein of immunoglobulin (Ig) is served as reasons " gently " polypeptide chain and " weight " polypeptide chain formation, it has " constant " district and " variable " district and based on the composition of constant region and classify (such as IgA, IgD, IgE, IgG and IgM).Antibody (can comprise such as Fv, Fab', F (ab') 2 and strand) in a variety of forms to be existed, and comprises improvement on synthesis, and it is all or a part of that it contains in one or more single chain antibody peptide sequence.
Herein, " effective dose " means (but being not limited to) causes the antigen amount that maybe can cause immune response, and this immune response causes the clinical symptom accepted in animal that antigen uses to reduce.
As used herein, under the background of composition, term " significant quantity " means can the amount of immunogenic composition of induction of immunity reaction, and this immune response to reduce in animal the infection of disease or the sickness rate of event or alleviates its seriousness.In specific words, the significant quantity of live attenuated virus preparation is (as by Mei Ji plaque forming unit (plaqueformingunit; PFU) number or equivalent metric are measured) be utilize tissue culture infective dose (TCID50) (being also about to cause 50% through the amount of the pathogenic agent of the pathological change of inoculation and sensitive cells culture) to monitor.For vaccine or the Antigen Subunit of deactivation, significant quantity means relative antigenic content (RAC), that is the packet content of antigen in each effective dose.Or, under the background of therapy, term " significant quantity " mean the amount of therapy be enough to reduce or improve disease or illness or its one or more symptom seriousness or time length, prevention disease or ongoing disease, cause disease or illness to disappear, prevent the recurrence of one or more symptom relevant with disease or illness, development, outbreak or process, or enhancing or improve prevention or the treatment of another therapy or therapeutical agent.
As known in the art it " sequence thereto " mean two or more peptide sequences or two or more polynucleotide sequences (that is reference sequences and treat and reference sequences than arranging than both checking order) between relation.Sequence thereto system by will both check order row and reference sequences in the best way comparison with the sequence similarity producing top after compare these sequences to measure, wherein sequence similarity such as the coupling (introducing gap if desired) between the string by these sequences measures.After this comparison, sequence thereto is determined on the basis that position contraposition is put, if such as a specific location Nucleotide or amino-acid residue identical, then these sequences are this position " identical ".Subsequently, by the sum of these position homogenies divided by the sum of reference sequences nucleotide or residue to produce sequence thereto %.Sequence thereto easily can be calculated by currently known methods, include, but is not limited to the method described in Publication about Document: ComputationalMolecularBiology, Lesk, A.N. compile, OxfordUniversityPress, NewYork (1988); Biocomputing:InformaticsandGenomeProjects, Smith, D.W. compile, AcademicPress, NewYork (1993); ComputerAnalysisofSequenceData, part i, Griffin, A.M. and Griffin, H.G. compiles, HumanaPress, NewJersey (1994); SequenceAnalysisinMolecularBiology, vonHeinge, G., AcademicPress (1987); SequenceAnalysisPrimer, Gribskov, M. and Devereux, J. compiles, M.StocktonPress, NewYork (1991); And Carillo, H. and Lipman, D., SIAMJ.AppliedMath., 48:1073 (1988); Its teaching is incorporated herein by reference.Measure the preferred approach of sequence thereto through designing to produce the maximum match between cycle tests.The disclosing in available computer program of sequence thereto of both having checked order between row in mensuration is programmed to the method for measuring sequence thereto.The embodiment of this supervisor includes, but is not limited to GCG suite of programs (Devereux, J. people is waited, NucleicAcidsResearch, 12 (1): 387 (1984)), BLASTP, BLASTN and BLASTX (Altschul, S.F. people is waited, J.Molec.Biol., 215:403-410 (1990)).BLASTX program can from NCBI and the open acquisition in other source (BLASTManual, Altschul, S. people is waited, NCVINLMNIHBethesda, MD20894, Altschul, S.F. people is waited, J.Molec.Biol., 215:403-410 (1990), its teaching is incorporated herein by reference).This supervisor the best uses prepsetting gap flexible strategy (defaultgapweight) aligned sequences to produce the sequence thereto of the top both checked order between row and reference sequences.As explanation, have to have with reference nucleotide sequence at least such as 85%, the polynucleotide of the nucleotide sequence of better 90%, better 95% " sequence thereto " mean, except set polynucleotide sequence may comprise 15 at the most, better 10 at the most, except better 5 point mutation at the most compared with every 100 Nucleotide of reference nucleotide sequence, the nucleotide sequence of set polynucleotide is identical with reference sequences.In other words, at least 85% is had, in the polynucleotide of the nucleotide sequence of better 90%, better 95% homogeny having relative to reference nucleotide sequence, in reference sequences at the most 15%, the better Nucleotide of 10%, better 5% can lack or replace through another Nucleotide, maybe can by the total nucleotide accounted in reference sequences at the most 15%, better 10%, better 5% multiple Nucleotide insert in reference sequences.These sudden changes of reference sequences may occur in 5' end position or the 3' end position place of reference nucleotide sequence, or, individually intersperse among in one or more the continuous group between the Nucleotide in reference sequences or in reference sequences between these terminal positions Anywhere.Similarly, have to have with reference amino acid sequence at least such as 85%, the polypeptide of the given amino acid sequence of better 90%, better 95% sequence thereto means, except set peptide sequence may comprise 15 at the most, better 10 at the most, except better 5 amino acid changes at the most compared with every 100 amino acid in reference amino acid sequence, the given amino acid sequence of polypeptide is identical with reference sequences.In other words, have at least 85% for obtaining with reference amino acid sequence, the set peptide sequence of the better sequence thereto of 90%, better 95%, in reference sequences at the most 15%, better at the most 10%, better at the most 5% amino-acid residue can to lack or through another aminoacid replacement, maybe can by the total amino acid residues that accounts in reference sequences at the most 15%, better at the most 10%, better at the most 5% multiple aminoacid insertion reference sequences in.These changes of reference sequences can to betide between the N-terminal of reference amino acid sequence or carboxy terminal positions place or these terminal positions Anywhere, in one or more the continuous group between the residue individually interspersing among reference sequences or in reference sequences.Preferably, the difference of not identical resi-dues is that conserved amino acid replaces.But, when measuring sequence thereto, do not comprise conservative replacement as coupling.
It " sequence homology " means the method for the dependency of a kind of mensuration two sequences as used herein.For measuring sequence homology, by the comparison and introduce gap if desired in the best way of two or more sequences.But contrary with " sequence thereto ", conserved amino acid is substituted in when measuring sequence homology and is also considered as coupling.In other words, for obtaining the polypeptide with reference sequences with 95% sequence homology, in reference sequences 85%, the better amino-acid residue of 90%, better 95% must mate or comprise and have the conservative of another amino acid and replace, maybe can account for total amino acid residue in reference sequences at the most 15%, better at the most 10%, better at the most 5% multiple amino acid (not comprising conservative replacement) insertion reference sequences in.Homologous sequence is better to be comprised at least one and has 50, better 100, better 250, extension of the Nucleotide of better 500 encoding homologous amino acid.
" conservative replacement " means that amino-acid residue another amino-acid residue through having similar characteristics or character (comprising size, hydrophobicity etc.) replaces, and overall function is not significantly changed.It also can mean and cause the Nucleotide of conserved amino acid replacement to replace.
b. carrier molecule
The PPV5A protein of the present invention or peptide can in conjunction with or covalently bound carrier molecule be preferably above-mentioned carrier molecule.Better carrier for animal is bovine serum albumin bletilla keyhole spiral shell hemocyanin.Carrier protein itself is preferably immunogen.
The PPV5A protein of the present invention or peptide can by any facilitated method known in technique and carrier covalent couplings.Although use symmetrical connexon (such as adipic dihydrazide, as by people such as Schneerson, J.ExperimentalMedicine, 152,361-376 (1980) describes) or Heterobifunctional connexon (such as 3-(2-pyridyidithio) propionic acid N-succimide ester, as by people such as Fattom, InfectionandImmunity, 56,2292-2298 (1988) describes) belong in the category of the present invention, but better avoid using any connexon and change into make the present invention PPV5A peptide directly and carrier molecule coupling.This coupling can realize by means of reductive amination, and as by people J.Immunology such as Landi, 127,1011-1019 (1981) describes.
Size (as defined by the molecular-weight average) alterable of immunogenic composition and depending on selected PPV5A protein or peptide and the method making PPV5A protein or peptide and couple vector.Therefore, it can be as small as 1,000 dalton (10 3) or be greater than 10 6dalton.By reductive amination couling process, the molecular weight of PPV5A protein or peptide usually 5,000 to 500,000 or 500, in the scope of more than 000; Such as the capsid protein of SEQIDNO:4, predicted molecular weight is about 80,000 dalton, predicts that its formation comprises 60 monomeric proteins and so on virus particle (VLP).
Carrier molecule (that is the peptide of the PPV5A protein of specific binding the present invention or peptide, its derivative and analogue and peptide simulant) can be produced by various methods known in technique, include, but is not limited to solid phase synthesis or utilize the solution (people such as Nakanishi, 1993, Gene137:51-56; Merrifield, 1963, J.Am.Chem.Soc.15:2149-2154; The people such as Neurath, H. compile, and TheProteins, II roll up, the 3rd edition, 105-237 page, AcademicPress, NewYork, N.Y. (1976), and its mode quoted in full is incorporated herein).
The antibody of the PPV5A protein of the present invention or peptide or the present invention or its bound fraction can be used with injectable dosage together with medicine and pharmacology or veterinary science carrier by the solution in thinner or form of suspension.
The security of this equimolecular and effect in described cell culture or laboratory animal by standard program measure and by veterinary biological centers for making of pharmaceutical preparations (CenterforVeterinaryBiologics; CVB) regulate.The toxicity of this equimolecular and therapeutic efficiency by standard pharmaceutical program determination in cell culture or laboratory animal, such as, can measure LD 50(dosage that 50% colony is lethal).
The vaccine of the present invention can be multivalence or unit price.Polyvalent vaccine system is combined by the immunity of multiple PPV5A protein or peptide and carrier molecule and makes.
In an aspect, PPV5A protein or peptide combinations comprise the immunogenic conjugate of effectively immunity amount, goodly combine with immunostimulant; And the vehicle that physiology can accept.As used in the present invention, " immunostimulant " is intended to contain any compound or the composition that can strengthen immune system activity, no matter it is the specificity enhancement with specific antigens combination, or is only the independent action of the activity to one or more key element in immune response.Immunostimulation immunomodulator compounds includes, but is not limited to mineral gels, such as aluminium hydroxide; Surfactant, such as lysolecithin, Pu Luonike polyvalent alcohol; Polyanion; Peptide; Fat liquor; Alum and MDP.Use the method for these materials known in the art, and the optimum quantity determining the stimulator of set vaccine belong in the limit of power of those skilled in the art completely.More than one immunostimulant can be used in set composite.Also immunogen can be incorporated in liposome, or with the polysaccharide that uses in vaccine formulation and/or other polymeric conjugation.
Composition if desired can in packaging or dispensing device device, and this packaging or dispensing device device can contain the unit dosage of activeconstituents containing one or more.Packaging can such as comprise metal or plastic foil, such as blister packs.Packaging or dispensing device device can with using specification sheets, better for using Mammals, are especially pig.
c. adjuvant
For improving the immunogenicity of the immunogenic composition provided thus further, these compositions also can comprise one or more adjuvant except containing except one or more PPV5A protein or peptide.
Adjuvant can by previously describing or any technology purifying well known in the prior art.Better purification technique is silica gel column chromatography, especially " hurried " (fast) chromatographic technique, and as by people such as W.ClarkStill, J.OrganicChemistry, 43,2923-2925 (1978) describe.But, other chromatography method can be used to carry out (comprising HPLC) purifying of adjuvant.Also purified by crystallisation adjuvant can be used.In some cases, if directly obtain the product with AG purity from synthesis, then without the need to carrying out purifying.
According to the known technology for generation of adjunvant composition, prepare the vaccine composition of the present invention by by adjuvant and PPV5A protein or peptide physical mixed under suitable aseptic condition.Conjugate exists by making the compound that net negative charge (it is by the positive charge be electrostatically attracted on long chain alkyl compound adjuvant) promotes PPV5A protein or peptide and adjuvant.
the vehicle that D. physiology can accept
The vaccine composition of the present invention can use to be allocated with the technology type technology seemingly for other medical peptide composition.Therefore, adjuvant and the better PPV5A protein that is combined with carrier molecule and/or mix with adjuvant or peptide can store and restore to form suspension in the vehicle that can accept on physiology before administration by lyophilized form.Or adjuvant and conjugate can be stored in vehicle.Better vehicle is sterile solution, especially aseptic buffer solution, such as phosphate buffered normal saline solution.Any make adjuvant and conjugate combine in vehicle the method making the immunizing-effective of immunogenic composition obtain improvement be suitable.
The variable volume of the vaccine of the present invention of single dose, but usually will belong in the usual range of conventional vaccine.Under the concentration of above-mentioned conjugate and adjuvant, the volume of single dose is better between about 0.1ml and about between 3ml, better between about 0.2ml and about between 1.5ml, is more preferred from about 1.0ml.
The vaccine composition of the present invention can be used by any facilitated method.
e. composite
Comprise and to can be used as vaccine with the PPV5A protein of carrier molecule coupling or the immunogenic conjugate of peptide for for one of PPV5A or various serotype immunity.The vaccine being contained in the immunogenic conjugate in the vehicle that physiology can accept is applicable to make animal (being preferably pig) immunity with treatment or prevent in the method for PPV5A infection.
Antibody by the immunogenic conjugate for the present invention with immunogenic conjugate immunity generation can be used for passive immunization therapy and produces antiidiotypic antibody infecting with treatment or prevention PPV5A.
The object that composition is used is preferably animal, includes, but is not limited to ox, horse, sheep, pig, poultry (such as chicken), goat, cat, dog, hamster, mouse and rat; The best is pig.
The composite of the present invention comprises one of effectively immunity amount or panimmunity Immunogenic Compositions or for the vehicle that its antibody and physiology can accept.Vaccine comprises the vehicle that one of effectively immunity amount or panimmunity Immunogenic Compositions and physiology can accept.Composite should adapt to mode of administration.
Immunogenic composition if desired also can containing a small amount of wetting agent or emulsifying agent or pH buffer reagent.Immunogenic composition can be liquor, suspension, emulsion, tablet, pill, capsule, sustained release formulation or powder.Oral formulations can comprise standard supporting agent, such as pharmaceutical grade mannitol, lactose, starch, Magnesium Stearate, sodium asccharin, Mierocrystalline cellulose, magnesiumcarbonate etc.
f. effective dose
Compound described herein can be treated effective dose and is applied to object to treat PPV5A relative disease.Dosage will depending on accepting host and the many factors (such as host's build, body weight and age) of vaccine.
For the immunogenic conjugate or antibody that are used for the present invention in composite precise volume will depending on route of administration and object property (such as species, the age, build, disease stage/degree), and should to judge according to the situation of standard clinical techniques according to the judgement of doctor and each object.Effective immunity amount is for being enough to the amount of the PPV5A infectious diseases in treatment or object of prevention.Effective dose also can be calculated by the dose response curve deriving from animal model test macro and can from 0.1mg/kg to 20mg/kg, and better 1mg/kg to 10mg/kg changes.
The immunogenicity of composition can be determined by using any immunoassay known in technique immune response of monitoring and test object after with composition immunity.Generation body fluid (antibody) reaction and/or cell-mediated immunity can be considered as the instruction of immune response.Tested object can comprise animal, such as pig, mouse, hamster, dog, cat, rabbit, ox, horse, sheep and poultry (such as chicken, duck, goose and turkey).
The immune response of tested object can by various methods analyst, such as: the reactivity of gained immune serum and immunogenic conjugate, as analyzed by known technology, such as enzyme linked immunosorbent assay analysis method (ELISA), immunoblot method, immuno-precipitation etc.; Or protection avoids pathogenic infection through the host of immunity and/or the weakening of the symptom that caused by pathogenic infection in the host of immunity; as determined by any method for analyzing the infectious diseases factor (infectiousdiseaseagent) content known in technique, other such as, in quantitative PCR, virus purification or technique known technology.Also can by measure immunoglobulin (Ig) institute for the content of antigen determine the content of the infectious diseases factor.It is effective that the content reduction of the infectious diseases factor or the symptom of infectious diseases improve indication composition.
Before in vivo using in animal, in vitro can test the required therapeutic of the therapeutical agent of the present invention or preventative activity.For example, can be used for determining whether that the ex vivo assay method that specific treatment agent is used in instruction comprises cells ex vivo culture assays method, wherein be exposed to therapeutical agent from the suitable cell of cell strain or the cell of object cultivation of certainly suffering from specified disease or illness or otherwise accept therapeutical agent and use, and observation therapeutical agent is to the effect of cell.
Or can analyze therapeutical agent by following methods: make therapeutical agent and cell (cultivating or the cell strain of cultivation of hanging oneself from object) contact, to the infection of the infectious diseases factor, responsive but uninfection disease factor infects these cells; Cell is made to be exposed to the infectious diseases factor; And then determine with the infection rate of the cell of therapeutic agent whether lower than not with the infection rate of the cell of therapeutic agent.Can infect by the infectious diseases factor of any methods analyst cell known in technique.
In addition, can by before therapy, during therapy or after therapy with appropriate intervals measure antibody institute in animal model subjects for the content of molecule assess therapeutical agent.Any change of the amount of molecule can be identified or do not change and it is associated to the effect of object with treatment.The content of molecule can be determined by any method known in technique.
After using the method and composition of the present invention to be inoculated for PPV5A by animal, the combination between any binding analysis method assessment gained antibody well known in the prior art and specific molecular can be used.Also these analytical methods can be carried out to select to present specific antigen the antibody of higher affinity or specificity.
G. detect and diagnostic method
The antibody produced by using the primary PPV5A of the present invention, attenuated virus, protein or peptide or its bound fraction are applicable to the existence detecting PPV5A in sample.This detection method comprises following steps: provide for the primary PPV5A of the present invention, attenuated virus, protein or peptide produced through separation antibody or its bound fraction, to be added in the sample suspected containing a certain amount of PPV5A virus through separation antibody or its bound fraction, and detection comprises the existence of the mixture divided through separation antibody or its joint portion being incorporated into PPV5A virus.
The antibody of the present invention or its bound fraction are also applicable to the existence detecting PPV5A protein or peptide in sample.This detection method comprises following steps: provide for primary PPV5A, attenuated virus, protein or peptide produced through separation antibody or its bound fraction, to be added in the sample suspected containing a certain amount of PPV5A protein or peptide through separation antibody or its bound fraction, and detect the existence comprising the mixture divided through separation antibody or its joint portion being incorporated into PPV5A protein or peptide.
As described in this article, be combined as combine to the immunoglobulin (Ig) of specific molecular of member, in specific words antibody (and functionally active fragment) can be used as diagnostic reagent and prognosis agent.In many embodiment:, the invention provides combine to the measurement of member and these measure the purposes in clinical application.The immunoglobulin (Ig) of the present invention can be used for the antigen such as detected in biological sample, by this can the existence of immunoglobulin (Ig) combined in tested object the abnormal level of molecule and/or the anomaly pattern of this equimolecular." abnormal level " means relative to the amount in the similar sample from the body portion or object of not suffering from disease or represents that the standard content of amount increases to some extent or reduces.The antibody that also can comprise the present invention in test kit as reagent for diagnosis or prognosis technology.
In an aspect, the antibody that immunologic opsonin is incorporated into the present invention of PPV5A primary or attenuated virus, protein or peptide can be used for the diagnosis of PPV5A infection, prognosis or screening.
In another aspect, the invention provides the method for diagnosis or screening PPV5A infection or the existence for its immunity, it comprises the degree that in measuring object, antibody is combined with the immunologic opsonin of the sample deriving from object, wherein antibody mediated immunity specific binding PPV5A protein or peptide, the degree of wherein this immunologic opsonin combination relative to from do not have the infectious diseases factor object similar sample in the degree of this immunologic opsonin combination increase instruction PPV5A to some extent and exist.
Embodiment for the suitable assays detecting the existence of PPV5A peptide or its antagonist includes, but is not limited to ELISA, radio immunoassay, gel diffusion precipitation reaction analytical method, immunodiffusion assay method, agglutination assay, fluoroimmunoassay, a-protein immunoassay or IEA method.
Immunoassay for specific molecular typically will be included in detection mode can hatch sample (cell of such as biofluid, tissue extract, fresh collection or the lysate of institute's culturing cell) and detect the antibody of combination by any one in the multiple technologies known in technique under the antibody of mark exists.
The binding activities of set antibody can be measured according to well-known process.Those skilled in the art can use normal experiment to determine operability and the optimum analysis condition of each mensuration.
The present invention relates to the diagnostic kit for detecting or measure PPV5A on the other hand.Be provided for the test kit of diagnostic uses, it comprises anti-PPV5A antibody in one or more container, and alternatively for the combination collocation thing through mark of antibody.Or anti-PPV5A antibody can such as, through mark (using detectable label, chemoluminescence, enzyme, fluorescence or radioactive segment).Therefore, the invention provides diagnostic kit, it comprises anti-PPV5A antibody and contrast immunoglobulin (Ig).In a specific embodiment, a kind of above-claimed cpd in container can detection mode through mark.Test kit can comprise in a reservoir further alternatively predetermined amount by the PPV5A virus of the antibody recognition of test kit, protein or peptide, to be used as standard substance or contrast.
h. subject
Route of administration includes, but is not limited in nose, per os (such as in tap water), intracutaneous and intramuscular.Intramuscular is used especially better.Those skilled in the art will recognize that, the composition of the present invention can also be used and use by other route of administration by more than once, twice or twice dosage.For example, these other approach comprise in subcutaneous, intracutaneous, intravenously, Ink vessel transfusing, intra-arterial, intraperitoneal, sheath, in tracheal strips, intracardiac, leaflet, in marrow, in lung and intravaginal.Depending on required time length and the validity for the treatment of, the composition of the present invention can be used once or several, also can use off and on, such as every day and using with various dose within a couple of days, several weeks or several months.
Comprise following examples so that the preferred embodiment of the present invention to be described.It will be understood by a person skilled in the art that, the technology disclosed in following examples represent by inventor find in the practice of the present invention the technology of good action, and therefore can be considered the better model forming the present invention's practice.But, according to the present invention, it will be understood by a person skilled in the art that, under the spirit not departing from the present invention and category, multiple change can be produced in the specific embodiment disclosed and still obtain similar or similar results.
The title that subject application relates to application same date is the application case (attorney docket BIC-1153) of " PorcineParvovirus5B, MethodsofUseandVaccine ", and the mode that its content is quoted in full is incorporated herein.
Embodiment
Material and method
material source: receive the tissue homogenate from three pigs from rare Outbreak investigation.The clinical medical history of feedlot is that 200lb pig suffers from whole-body muscle vibration, and it exists when static, but during movement strengthens.Extensive testing is carried out in veterinary diagnostic laboratory, this laboratory prompting virokine (based on microscopic lesions), but only identify factor X (the non-classical Pestivirus suis relevant to pestivirus), afterwards sample is provided to inventor to help to determine the potential cause of CNS symptom in these animals.
dNA and protein analysis: use the high-flux sequence from 454LifeSciences (BranfordCT) (" 454 technology ") to carry out the DNA analysis of the sample from infected pig, undertaken by Operon (HuntsvilleAL).Nuclease process via virus particle protection nucleic acid makes sample be rich in virus sequence, then carries out extracting, random amplification and high-flux sequence; Usually as the people PLoSpathogen2008 such as Victoria September 26; Carry out described in 4 (9): e1000163.
Be the difference member (divergentmember) of Parvoviridae (Parvoviridaefamily) at first by gained sequence characterization by BLASTx analysis.Use Sequencher software Assembly sequences and the result joint objective order-checking of these DNA analysis can obtain the DNA sequence dna of SEQIDNO:1, it is the complete encoding sequence of presumption of the virus of called after PPV5A.Use the further analyzing DNA sequence of Sequencher software, identify three presumption coding regions, it corresponds to the coding region found in other parvovirus kind, comprises rdrp virus (SEQIDNO:2), open reading frame " ORF3 " (SEQIDNO:3) and viral capsid proteins (SEQIDNO:4).
embodiment 1: the novel virus of qualification
By 454 technology (viral multiple heterologous genes group) qualification from the DNA sequence dna in the sample of the lung homogenate of two irrelevant pigs of different states.BLASTn and BLASTx analysis shows the most identical with pig parvoviral 4, there is 67% nucleotide sequence identity maximum value in the conservative region of wherein rdrp gene (REP), and capsid protein (CAP) coding region does not present the coupling that can distinguish in Nucleotide aspect.In protein aspect, the replicase protein of presumption presents about 60% amino acid identity and in capsid protein, presents about 50% homogeny.Virus is expressed as cenospecies, i.e. pig parvoviral 5A (PPV5A).Based on capsid protein coding sequences research and development Auele Specific Primer, and the screening of homogenate PCR-based similar in tissue and pathology/Clinical symptoms show to there is the factor in about 16% sample.Based on the clinical symptom reported and to screen the relevant virusology data of tissue, observe the statistically significant dependency with other viral agents some and clinical pathology/histopathology.
embodiment 2: identify that PPV5A is novel parvovirus and Phylogenetic analysis
The replicative enzyme (REP) of the presumption of multiple known viruse kind and the paired amino acid identity of capsid (VP1/CAP) albumen are showed in Fig. 5.PPV5A sequence and the most closely related homogeny (being respectively about 60%/50%) with the PPV4 of REP and CAP support PPV5A to be appointed as cenospecies.
Based on the conservative region of CAP protein, it is novelty kind during Parvoviridae and parvovirus belong to that Phylogenetic analysis (Fig. 6) shows this virus.More conservative REP protein sequence (not shown) is used to obtain similar results.
embodiment 3: confirmation PPV5A is disease factor
The animal of three kinds of PPV5aPCR assaypositive tissue homogenate to the non-feeding colostrum (CDCD) of caesarean delivery from ISU is used to inoculate, to attempt amplicon virus and to determine whether the concurrent infection of novel parvovirus and PRRSV causes clinical breathing symptom to increase.In this research, in the group with the tissue homogenate inoculation containing novel parvovirus, there is unexpected high death toll (20%-22%), and use the PPV5A of high-titer in the PPV5A specific PCR qualification serum of target capsid protein coding region.Then use and attack CDCD pig to reproduce clinical symptom from the tissue of an animal one of in this research.In this research, in most of infected animals, find the systemic infection of high titer virus mass formed by blood stasis.In the group accepting the inoculum containing PPV5A, dead (20%), walk lamely, average every day weight gain reduces, the incidence of heating and macroscopic and microscopic lesions is higher.
the cultivation of embodiment 4:PPV5A, separation and purifying
Use the little section of sterile mortar and pestle grinding PCR assaypositive tissue (such as spleen, brain, lung, intestines etc.).By through grinding organize settling flux to contain HEPES damping fluid and microbiotic in 5-10ml in upgrading EMEM, make it clarify to eliminate larger tissue block.Collect supernatant liquor and continue through various strainer to eliminate major part comparatively macroparticle (comprising bacterium).In addition, also process from the faecal samples suspension of PCR animals showing positive and serum by continuous filtration to carry out virus purification.
The dilution of filtrate through trypsin treatment or keep unprocessed and be adsorbed at a certain temperature in 6 orifice plates foundation and on blastema culture (being recited in hereinafter).Extract inoculum out and replace with the fresh maintain base of 2ml.Plate is then at 5%CO 2hatch at 33 DEG C-37 DEG C in atmosphere and the cytopathic effect of observation every day compared with simulating the contrast of (ordinary culture medium) inoculation, such as cell rounding, Cell-Cell Fusion, come off, cell gathers together.Viral growth/the separation in potential positive hole is screened by PCR.
The clone being applicable to the foundation of virus purification especially comprises: ST (pig testis), SK6 (Ren sus domestica), BHK-21 (the young kidney of hamster), VIDOR1 (pig fetal retinal), PK-15NADC (Ren sus domestica), PK/WRL (Ren sus domestica), HRT-180 (human colorectal adenocarcinoma), Hep2 (human epithelium), Vero (cercopithecus aethiops kidney) and RK-13 (rabbit kidney).
The blastema culture being applicable to this process especially comprises: the lung of Pig embryos, kidney, testis, tracheae and intestines culture.
After isolated viral, by many wheels, plaque purified or restriction dilution carrys out purified virus and with relatively large amplicon virus, and produces the stock culture being used for experimentation on animals.
embodiment 5: prepare inactivation of viruses and vaccine
About 35 DEG C to 39 DEG C between and 2 to 15mMBEI exist under, be more preferably under about 10mMBEI exist under carry out deactivation.Deactivation system carries out at least 24 hours, nearly 24 to 72 hours.Then the reagent of the deactivation reagent in the neutralization solution of equivalent is added; The Sulfothiorine of such as equivalent.Inactivation of viruses preparation is prepared according to method known in technique, for example, as Preuss, T. people is waited, ComparisonofTwoDifferentMethodsforInactivationofVirusesi nSerum, CLINICALANDDIAGNOSTICLABORATORYIMMUNOLOGY, (1997), 504-508 or Bahnemann, H.G., Inactivationofviralantigensforvaccinepreparationwithpart icularreferencetotheapplicationofbinaryethylenimine, VACCINE, (1990), disclosed in 299-303.Once prepare inactivation of viruses, then material and carrier formulation are combined for final vaccine formulation.
embodiment 6: prepare attenuated virus and vaccine
Attenuated virus preparation system prepares according to method known in technique, for example, as VaccineProtocols, and the 2nd edition; Robinson, Husdon, Cranage compile, and disclosed in HumanaPress2003.For example, " ... wild-type virus in tissue culture/animal host extensive subculture until toxicity loss and immunogenicity keep between reach the balance that can accept ... "
By many wheels, plaque purified or restriction dilution carrys out purifying attenuated virus.Use the specificity of the order-checking of pcr analysis method, the degree of depth or fluoroimmunoassay determination culture material.
Attenuated Virus Vaccines is prepared by the purified attenuated virus preparation of combination and carrier formulation.
embodiment 7: preparation comprises the subunit vaccine of capsid protein
By the capsid protein preparing SEQIDNO:4 through the SEQIDNO:4 of clone or the expression of its fragment in multiple proteins expression system.
baculovirus expression: the PPV5A capsid protein of SEQIDNO:4 is expressed in baculovirus expression system, usually according to the people such as Kost (6), and the method for announcement in 2012.When initial purification, in soluble part, find a small amount of protein.The method improving productive rate and solubleness includes, but is not limited to use substituting buffer condition (such as urea or Guanidinium hydrochloride), substituting combination and purification condition (such as cobalt or nickel are affine tubing string, negatively charged ion or cation exchange column) or substituting expression condition (such as temperature, time, substituting cell strain).
bacterial expression: the PPV5A capsid protein of SEQIDNO:4 is expressed in bacterial expression system, usually according to the method disclosed in EMDChemicalsInc.NovagenUserProtocolTB184.This method comprise add intrinsic HIS label (EMDChemicalsInc., 2011 (7)) contained in bacteria carrier with promote the purifying of protein that produces.Usually according to GEHealthcare, the method purifying of announcement in 2012 (8) marks capsid protein through the HIS of bacterial expression, and uses products therefrom to produce PPV5A specific antibody as described in Example 8.
Attenuation subunit vaccine is prepared by the purified capsid protein preparation of combination and carrier formulation.
embodiment 8: prepare specific binding in the antibody of PPV5A
Subunit protein preparation by the antigen formulations or capsid (SEQIDNO:4) albumen or its fragment that use PPV5A virus makes rabbit immunity to prepare specific binding in the antibody of PPV5A.The serum sample of the rabbit of inoculation of hanging oneself is screened for the polyclonal antibody being incorporated into PPV5A antigen.The mouse and determining of inoculation of making to hang oneself produces for the spleen of the antibody of antigen and myeloma cell fusion to produce hybridoma.Then hybridoma is screened for the combination with PPV5A antigen.
polyclonal antibody: prepare service company (customantibodyproductionservice) at customization antibody, use and make two New Zealand white rabbit (NewZealandWhiterabbit) immunity (Rockland antibody and analytical methods (RocklandAntibodiesandAssays) according to the capsid protein through bacterial expression of the HIS mark of embodiment 7 preparation; Gilbertsville, PA).At D0, D7, D14 and D28, every rabbit about 100 μ g antigen is used to make rabbit immunity.For D0 and D7 inoculation, the intradermal vaccination of animal system; The inoculation carried out at D14 and D28 is subcutaneous administration.Complete Freund's adjuvant (CompleteFreund'sadjuvant) is used in first time inoculation; Cannot be used up full freund's adjuvant (incompleteFreud'sadjuvant) in subsequent inoculations.Within the 38th day and the 45th day before immunity and after immunity, collect the serum sample from two rabbits.
The polyclonal antibody preparations of anti-PPV5A specificity is screened by Rockland antibody and analytical method.By fluoroimmunoassay (IFA), Western blot and enzyme conjugation immunosorbent assay method (ELISA), produce antibody PPV5A protein that is purified or partial purification to binding specificity.The parameter of the specificity of each analytical method is as follows: measure Western blot specificity, by measuring IFA specificity and measure ELISA specificity by with irrelevant protein coated panel compared with the cell do not infected by the 88.8kDa size protein detecting prediction.
monoclonal antibody: prepare service company (Rockland antibody and analytical method at customization antibody; Gilbertsville, PA), use and in Balb/c mouse, produce monoclonal antibody according to the capsid protein through baculovirus expression of the HIS mark of embodiment 7 preparation.Multiple PPV5A antigen formulations is used to make mouse immune according to the standard scheme by the design of customization antibody Preparation equipment.By the immune response after customization antibody Preparation equipment monitoring inoculation, and select the Ab candidates for generation of hybridoma.Standard scheme for generation of monoclonal antibody is well known to those skilled in the art, for example, as the people such as Gabriele (9), disclosed in 117-135 page.
Hybridoma is produced with from the splenocyte collected through Mice Inoculated determining to produce for the antibody of PPV5A antigen by being combined in Hybridoma medium the B cell tumour cell that is cultured to proliferation period according to standard scheme, as the people such as Gabriele (9), disclosed in 117-135 page.In fusion and after cultivating hybridoma, screen hybridoma for the combination with PPV5A antigen, and select the hybridoma producing anti-PPV5A.According to the monoclonal antibody that standard scheme uses affinitive layer purification to be produced by hybridoma, as the people such as Gabriele (9), disclosed in 209-232 page.
Use the immunological technique known in technique, such as ELISA, Western Blot analysis and epitope mapping (EpitopeMappingProtocolsinMethodsinMolecularBiology, (GlennE.Morris compiles 66th volume, 1996) HumanaPress, Totowa, NewJersey) identify and to PPV5A, there is the high-affinity antibody of specificity and characterize further, comprise epi-position, the antibody of determining its combination and about the specificity of other related diseases seed culture of viruses, and select the high-affinity antibody be applicable to PPV5A virus antigen to high specific.
the diagnostic assay of embodiment 9:PPV5A
elisa assay method: use ELISA program, use according to the PPV5A in the antibody measurement biological sample of embodiment 8 preparation.Analyze the genealogy of law to carry out as follows:
The envelope antigen that will be selected from the capsid protein of SEQIDNO:4 is buffered liquid (0.05M carbonate-bicarbonate buffer reagent in bag; PH9.6) ultimate density realizing 8ng/ μ l is diluted in.Every hole is with 50 μ l envelope antigen coated panels (high protein in conjunction with 96 hole elisa plates, Phenix catalog number (Cat.No.) MPG-655061).Sealing plate and hatch at 37 DEG C 1 hour or hatch overnight at 4 DEG C.Remove coating solution and plate washs three times with every hole 200 μ lPBST (1XPBS+0.05%Tween-20).Plate wraps quilt with every hole 300 μ l lock solution (PBS containing 0.5%w/v skimmed milk powder), seals and hatch 1 hour at 37 DEG C.Remove lock solution and the every hole 200 μ lPBST of plate washs three times.Sample dilutes with 1:100 in lock solution; In plate, 100 μ l serum samples are added in every hole.Sealing plate and hatch 1 hour at 37 DEG C.Remove serum sample and the every hole 200 μ lPBST of plate washs three times.Second antibody (the anti-pig IgG of goat (H+L) of HRP combination; JacksonImmuno-Research114-035-003) in lock solution with 1:10,000 dilution and for wrapping by plate with every hole 100 μ l.Sealing plate and hatch 1 hour at 37 DEG C.Remove second antibody and the every hole 200 μ lPBST of plate washs three times.Plate every hole 50 μ lTMB (3,5,3', 5'-tetramethyl benzidine; KPL catalog number (Cat.No.) 53-00-01) wrap quilt.Plate at room temperature hatches about ten minutes in dark.The every hole 50 μ l stop bath (2MH of plate 2sO 4; KPL catalog number (Cat.No.) 50-85-04) wrap quilt.Read optical density (OD) at 450 nm.
pcr analysis method: for PCR and the qPCR analytical method optimizing based on gel of PPV5A.These are analyzed the genealogy of law and carry out as follows: for qPCR analytical method, each reaction system is prepared by the following reagent of interpolation: often kind of reactant 10 μ l2XSsoFast probe supermix (BioRad, catalog number (Cat.No.) 172-5233), often kind of reactant 5 μ l is through the water of DEPC process, often kind of reactant 1 μ l forward primer (6 μMs of concentration) (AATGCGTGTGCTTACGCTTA:SEQIDNO:6), often kind of reverse primer of reactant 1 μ l (6 μMs of concentration) (TGGGTTCGAATATGAAGAGG:SEQIDNO:7), often kind of reactant 1 μ l probe (4 μMs of concentration) (6-FAM/TCATCAGGAACCCTGGAGTGATCTCA/BHQ_1:SEQIDNO:8) and often kind of reactant 2 μ l are through the DNA of extraction.Reaction continues once to circulate for 2 minutes on T100 thermo cycler (Bio-Rad) at 95 DEG C, at following two kinds of temperature, then carries out 40 circulations: continue 5 seconds at 95 DEG C, then at 60 DEG C lasting 5 seconds.Use CFX96 optical imaging system (Bio-Rad) reading of data.For the analytical method based on gel, each reaction system is prepared by the following reagent of interpolation: often kind of reactant 12.5 μ l2XAmpliTaqGoldMastermix (AppliedBiosystems, catalog number (Cat.No.) 4302758), often kind of reactant 8.0 μ l is through the water of DEPC process, often kind of reactant 1.25 μ l forward primer (GTACTATGAATTTCCAAACGATCTTCCTTTCG:SEQIDNO:9) (10 μMs of concentration), the often kind of reverse primer of reactant 1.25 μ l (TTACACCAAATCTGGGACTCTAAACAGGC:SEQIDNO:10) (10 μMs of concentration) and often kind of reactant 2 μ l are through the DNA of extraction.Reaction continues once to circulate for 5 minutes on T100 thermo cycler (Bio-Rad) at 95 DEG C, then at following temperature, 40 circulations are carried out: at 95 DEG C, continue 30 seconds, continue 30 seconds at 60 DEG C and continue 45 seconds at 72 DEG C, then at 72 DEG C, final prolongation continues 10 minutes.
embodiment 10: effect of PPV5A vaccine in assessment pig
For assessment comprises objective composition effect in pig of at least one PPV5A protein or polypeptide (prototype PPV5A vaccine), the non-feeding colostrum (CDCD) animal (see table 2) being divided into caesarean delivery in three groups five week age is at random used to carry out randomised study.At research the 0th day (D0) and D14 composition or placebo (phosphate buffered normal saline solution; PBS) animal is inoculated.Animal is attacked at the known material containing PPV5A of D28.Monitoring clinic observation, rectal temperature, measured body weight and blood collecting.At D56, perform an autopsy on sb. to assess macroscopic pathology to animal.By compare with statistical way through inoculation and without inoculation animal between Percent mortality, viremia (tiring and the time length), seroconversion (tiring and the time length) and clinical symptom to be to determine effect of PPV5A vaccine.
Table 2.
Group # Group N Room Inoculation Attack
1 PPV5A-Vx 10 1 and 2 PPV5A prototype Be
2 PBS-Vx 10 1 and 2 PBS Be
3 Strict contrast 5 3 Nothing No
Can invariably prepare under testing according to the present invention and perform all compositions and method that disclose and advocate herein.Although describe composition and the method for the present invention according to preferred embodiment, but those skilled in the art will be apparent, not departing under the concept of the present invention, spirit and category, to composition described herein and method and change can be made in the step or order of steps of the method.In more specific words it, by aobvious and easily know some chemistry available and physiology related reagent replaces reagent described herein and obtains identical or similar results.Apparent these the similar replacements all of those skilled in the art and modification are all considered as belonging in the spirit of the present invention defined by following claim, category and concept.
Reference
Clearly be incorporated herein by reference below with reference to document, its incorporated extent makes it provide to supplement the exemplary procedural of content described herein or other details.
(1)CságolaA,etal.,Detection,prevalenceandanalysisofemergingporcineparvovirusinfections.ArchVirol.Jun；157(6):1003-10(2012).
(2)HijikataM,etal.,IdentificationofnewparvovirusDNAsequenceinswineserafromMyanmar.JpnJInfectDis54:244-245(2001).
(3)WangF,etal.,NovelparvovirussublineageinthefamilyofParvoviridae.VirusGenes41:305-308(2010).
(4)LauSK,etal.,Identificationofnovelporcineandbovineparvovirusescloselyrelatedtohumanparvovirus4.JGenVirol89:1840-1848(2008).
(5)CheungAK,etal.,Identificationandmolecularcloningofanovelporcineparvovirus.ArchVirol155(5):801-806(2010).
(6)Kostetal.,Recombinantbaculovirusesasmammaliancellgene-deliveryvectors,TrendsinBiotechnology,20,173-180,Apr.2002.citedbyother.
(7)EMDChemicalsInc.2011.Xa/LICKits,UserProtocolTB184.
(8)GEHealthcare.RecombinantProteinPurificationHandbook.18-1142-75.
(9)Gabrieleetal.(eds.),AntibodyMethodsandProtocols,MethodsinMolecularBiology,2012,vol.901,chapter7.

Claims (27)

1. separated polynucleotide, comprise polynucleotide:
A) there is the nucleotide sequence of SEQIDNO:1;
B) there is the nucleotide sequence of the polypeptide of coding SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4;
C) have the nucleotide sequence with SEQIDNO:1 with 80% homogeny, its coding has the biology of the polypeptide of SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4 or the polypeptide of immunology effective active;
D) it is the fragment of the nucleotide sequence of SEQIDNO:1, and described fragment comprises the sequence of at least 30 continuous nucleotides in SEQIDNO:1, or
E) it is the fragment of the nucleotide sequence of SEQIDNO:1, and described fragment comprises the sequence of at least 30 continuous nucleotides in SEQIDNO:1, and the immunology effective active of the aminoacid sequence of its coding SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4.
2. a separated polypeptide, comprises polypeptide:
A) there is the aminoacid sequence of SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4;
B) have and with SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4, there is 80% homogeny and there is the biology of the polypeptide of being encoded by SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4 or the aminoacid sequence of immunology effective active;
C) it is the fragment of the aminoacid sequence of SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4, and described fragment comprises at least 15 continuous amino acids in SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4;
D) it is the fragment of the aminoacid sequence of SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4, and described fragment comprises at least 15 continuous amino acids in SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4, and has immunology effective active; Or
E) by the protein fragments of polynucleotide encoding, described polynucleotide comprise at least 15 Nucleotide, and described at least 15 Nucleotide are included in the sequence of the Nucleotide 2845-5547 of Nucleotide 1975-2844 or SEQIDNO:1 of Nucleotide 87-1967, SEQIDNO:1 of SEQIDNO:1.
3. a separated pig parvoviral 5A (PPV5A), comprises:
A) nucleotide sequence of SEQIDNO:1, or
B) have the nucleotide sequence of 80% homogeny with SEQIDNO:1, its coding has the biology of the polypeptide of SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4 or the polypeptide of immunology effective active.
4. PPV5A as claimed in claim 3, it comprises attenuation, the non-toxic form of PPV5A.
5. the vaccine being used for the treatment of or preventing toxicity PPV5A to infect, it comprises the form of the killed of PPV5A as claimed in claim 3 or attenuation.
6. the vaccine being used for the treatment of or preventing toxicity PPV5A to infect, it comprises the subunit of the form of the killed of PPV5A as claimed in claim 3 or attenuation.
7. vaccine as claimed in claim 6, wherein said subunit is the capsid protein of SEQIDNO:4.
8. vaccine as claimed in claim 6, wherein said subunit is the effective fragment of immunology of the polypeptide of SEQIDNO:4.
9. an immunogenic formulation, it comprises the polypeptide as claimed in claim 2 of immunological effective amount, and medicine and pharmacology or the acceptable supporting agent of veterinary science, vehicle or thinner.
10. in Mammals, produce an immunoreactive method, comprise the PPV5A as claimed in claim 3 using immunological effective amount.
11. 1 kinds produce immunoreactive method in Mammals, comprise the polypeptide as claimed in claim 2 using immunological effective amount.
12. 1 kinds produce immunoreactive method in Mammals, comprise the vaccine as claimed in claim 5 using immunological effective amount.
13. 1 kinds produce immunoreactive method in Mammals, comprise the vaccine as claimed in claim 6 using immunological effective amount.
14. 1 kinds produce immunoreactive method in Mammals, comprise the vaccine as claimed in claim 7 using immunological effective amount.
15. as the method for claim 10, and wherein said Mammals is pig, and described immune response provides the protective immunity for being infected the disease caused by PPV5A.
16. as the method for claim 11, and wherein said Mammals is pig, and described immune response provides the protective immunity for being infected the disease caused by PPV5A.
17. as the method for claim 12, and wherein said Mammals is pig, and described immune response provides the protective immunity for being infected the disease caused by PPV5A.
18. as the method for claim 13, and wherein said Mammals is pig, and described immune response provides the protective immunity for being infected the disease caused by PPV5A.
19. as the method for claim 14, and wherein said Mammals is pig, and described immune response provides the protective immunity for being infected the disease caused by PPV5A.
20. 1 kinds of separated antibody, its specific binding is by the PPV5A polypeptide of pig parvoviral 5A polynucleotide encoding of sequence with SEQIDNO:1, described polypeptide has the aminoacid sequence of SEQIDNO:2, SEQIDNO:3 or SEQIDNO:4, and wherein said antibody does not combine the polypeptide of being encoded by different parvovirus.
The method of the existence of PPV5A in 21. 1 kinds of identification of organism samples, comprising:
A) make the contact of described biological sample as the antibody of claim 21,
B) formation of mixture between described antibody and PPV5A polypeptide is detected,
The existence of wherein said mixture indicates in described biological sample exists PPV5A.
22. 1 kinds of carriers or plasmid, it comprises polynucleotide as claimed in claim 1.
23. 1 kinds of host cells, it comprises the carrier as claim 22.
24. 1 kinds of hybridomas, it expresses the antibody as claim 20.
25. 1 kinds of diagnostic kits for the identification of the existence of PPV5A in biological sample, it comprises:
A) as the antibody of claim 21, and
B) for detecting the reagent of the formation of mixture between described antibody and PPV5A polypeptide.
26. 1 kinds of Immunogenic agents boxes, it comprises
A) at least one immunogenicity PPV5A peptide, it makes animal infect relevant disease immune at least one to PPV5A effectively;
B) at least one supporting agent or adjuvant molecules;
C) for encapsulating the container of described immunogenic composition;
D) one group of printing description; And
E) dispensing device, described immunogenic composition can be applied to animal by it.
27. as the Immunogenic agents box of claim 26, it comprises at least one immunogenic protein further, described at least one immunogenic protein makes described animal at least one other pig pathogenic virus or bacterial immune effectively, and other pig pathogenic virus of described at least one or bacterium can cause the disease relevant to the infection of described virus or bacterium.
CN201480003551.1A 2014-01-15 2014-01-15 Porcine parvovirus 5A, methods of use, and vaccines Expired - Fee Related CN105263953B (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2013/075059 WO2014099669A1 (en) 2012-12-17 2014-01-15 Porcine parvovirus 5a, methods of use and vaccine

Publications (2)

Publication Number Publication Date
CN105263953A true CN105263953A (en) 2016-01-20
CN105263953B CN105263953B (en) 2020-01-07

Family

ID=55102785

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201480003551.1A Expired - Fee Related CN105263953B (en) 2014-01-15 2014-01-15 Porcine parvovirus 5A, methods of use, and vaccines

Country Status (1)

Country Link
CN (1) CN105263953B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106459928A (en) * 2014-04-17 2017-02-22 英特维特国际股份有限公司 Porcine parvovirus
CN117866053A (en) * 2024-01-10 2024-04-12 武汉珈创生物技术股份有限公司 Polyclonal antibody for simultaneously detecting multiple porcine parvoviruses and preparation and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1294517A (en) * 1997-11-14 2001-05-09 欧洲细胞技术有限公司 Immunoglobulin molecules having synthetic variable region and modified specificity
WO2002068698A2 (en) * 2001-02-22 2002-09-06 Xencor, Inc. Use of nucleic acid libraries to create toxicological profiles
CN102382845A (en) * 2011-10-14 2012-03-21 中国农业科学院生物技术研究所 Method for producing porcine parvovirus antigen and its product
CN102791288A (en) * 2010-03-05 2012-11-21 英特维特国际股份有限公司 Recombinant attenuated parvovirus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1294517A (en) * 1997-11-14 2001-05-09 欧洲细胞技术有限公司 Immunoglobulin molecules having synthetic variable region and modified specificity
WO2002068698A2 (en) * 2001-02-22 2002-09-06 Xencor, Inc. Use of nucleic acid libraries to create toxicological profiles
CN102791288A (en) * 2010-03-05 2012-11-21 英特维特国际股份有限公司 Recombinant attenuated parvovirus
CN102382845A (en) * 2011-10-14 2012-03-21 中国农业科学院生物技术研究所 Method for producing porcine parvovirus antigen and its product

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
A. JOZWIK等: "Vaccination against porcine parvovirus protects against disease, but does not prevent infection and virus shedding after challenge infection with a heterologous virus strain", 《JOURNAL OF GENERAL VIROLOGY》 *
CANUTI,M.等: "accession JQ037754", 《GENBANK》 *
CHEUNG,A.K.等: "replicase [Porcine parvovirus 4]", 《GENBANK: ADB20210.1》 *
GORODKIN J: "accession EV966948", 《GENBANK》 *
田莉莉等: "猪细小病毒VP2蛋白单克隆抗体的制备及抗原捕捉ELISA方法的建立", 《畜牧与兽医》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106459928A (en) * 2014-04-17 2017-02-22 英特维特国际股份有限公司 Porcine parvovirus
CN117866053A (en) * 2024-01-10 2024-04-12 武汉珈创生物技术股份有限公司 Polyclonal antibody for simultaneously detecting multiple porcine parvoviruses and preparation and application thereof

Also Published As

Publication number Publication date
CN105263953B (en) 2020-01-07

Similar Documents

Publication Publication Date Title
TWI442935B (en) Porcine circovirus type 2, immunogenic composition containing the same, test kit, and application thereof
TWI656213B (en) Porcine prion 5A, usage and vaccine
US9550812B2 (en) Synthetic capsid proteins and uses thereof
US20200306362A1 (en) Senecavirus a immunogenic compositions and methods thereof
JP2017192398A (en) Porcine parvovirus 5b, methods of use and vaccine
WO2007140244A2 (en) Vaccination of young animals against lawsonia intracellularis infections
CA3136141A1 (en) Porcine circovirus type 3 (pcv3) vaccines, and production and uses thereof
JP6072935B2 (en) Porcine parvovirus 5A, method of use and vaccine
CN105263953A (en) Porcine parvovirus 5A, methods of use and vaccine
WO2019092027A1 (en) Sapelovirus immunogenic compositions and uses thereof
EA041112B1 (en) SENECAVIRUS A IMMUNOGENIC COMPOSITIONS AND METHODS WITH THEM

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information
CB02 Change of applicant information

Address after: American Missouri

Applicant after: Boehringer Ingelheim Animal Health USA Inc.

Address before: American Missouri

Applicant before: BOEHRINGER INGELHEIM VETMEDICA, Inc.

CB02 Change of applicant information
CB02 Change of applicant information

Address after: Georgia, USA

Applicant after: Boehringer Ingelheim Animal Health USA Inc.

Address before: American Missouri

Applicant before: Boehringer Ingelheim Animal Health USA Inc.

GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20200107