EA041112B1 - SENECAVIRUS A IMMUNOGENIC COMPOSITIONS AND METHODS WITH THEM - Google Patents

Description

Sequence listing

This application contains a sequence listing in accordance with section 37 of the Code of Federal Regulations of the United States parts 1.821-1.825. The sequence listing accompanying this application is incorporated herein in its entirety by reference.

State of the art invention

The technical field to which the invention belongs

The present invention relates to Seneca Valley virus A or Senecavirus A (SVA) and its use as an immunogenic composition or vaccine for the treatment of animals affected by Senecavirus A.

Description of the Prior Art

SVA is a non-enveloped, single-stranded RNA virus from the Picornaviridae family. Foot-and-mouth disease virus (FMDV) and swine vesicular disease virus (SVDA) are also members of the Picornaviridae family.

The virus was originally discovered as a contaminant from cell culture media (See, Hales, L.M., et al., Complete genome sequence analysis of Seneca Valley virus-001, a novel oncolytic picornavirus. J Gen Virol, 2008. 89(Pt 5 ): pp. 1265-75, incorporated by reference in its entirety); however, neutralizing antibodies against the virus have been found in pigs, cattle, mice, and humans (see, Knowles, N.J., et al., Epidemiology of Seneca Valley Virus: Identification and Characterization of Isolates from Pigs in the United States, in The Northern Lights EUROPIC 2006 - 14th meeting of the European Study Group on the Molecular Biology of Picornaviruses 2006: Saairselka, Inari, Finland, incorporated by reference in its entirety). Known clinical signs of infection include vesicular lesions on the muzzle and hoof ring, acute lameness, hoof ring ulceration, and hoof detachment (Singh, K., et al., Seneca Valley Virus and vesicular lesions in a pig with idiopathic vesicular disease. J Vet Sci Technol, 2012. 3(6) and Pasma, T., S. Davidson, and S. L. Shaw, Idiopathic vesicular disease in swine in Manitoba CVJ, 2008. 49: pp. 84-85, both incorporated by reference in their entirety ). In 2016, Koch's postulate was fulfilled when an SVA isolate propagated in cell culture was used to infect normal animals and vesicular lesions were observed four days after infection (Montiel, N., et al., Vesicular Disease in 9-Week-Old Pigs Experimentally Infected with Senecavirus A. Emerg Infect Dis, 2016. 22(7): p. 1246-8, incorporated by reference in its entirety).

US 8,039,606 describes the use of Seneca Valley Virus in the treatment of tumors. However, this Seneca Valley virus is different from the SVA of the present invention.

There has been an inexplicable increase in SVA cases in the US, Canada, Australia, Italy, New Zealand, and Brazil. In addition, due to the similarity of clinical signs with FMDV, this virus is of interest to the swine industry. Notice 16-03 of the Center for Veterinary Biologicals (CVB) confirmed that the CVB was interested in licensing biologics and/or prophylactic agents for the SVA virus.

Brief summary of the invention

The present invention relates to immunogenic compositions, vaccines, and related methods that overcome the shortcomings in the art. Compositions and methods refer to immunogenic compositions that include inactivated/killed and/or recombinant forms of (+) non-enveloped single-stranded RNA virus SVA. In particular, this application provides a vaccine to elicit an immune response in pigs to protect against diseases associated with Senecavirus A. This Senecavirus A isolate NAC#20150909 (SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3 ) was isolated from vesicular fluid collected from 5 month old pigs with vesicular lesions on the muzzle and hoof ring.

The immunogenic compositions and vaccines of this invention comprise SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3.

Exemplary compositions of the invention comprise polypeptide sequences of SEQ ID NO: 3, or fragments thereof, that are immunoreactive to SVA.

The immunogenic compositions and vaccines of this invention comprise an SVA antigen expressed in one non-limiting example in insect cells by a recombinant baculovirus expressing modified SVA P1, 2A, partial 2B and 3B, and 3C proteases, e.g. a modified SVA nucleic acid sequence (SEQ ID NO : 18) encoding an amino acid sequence (SEQ ID NO: 19) and typically also includes an adjuvant. The vaccine may also include other components such as preservative(s), stabilizer(s), and antigens against other swine pathogens.

A preferred P1-2A-P3 nucleic acid sequence suitable for use in the present invention is a polynucleotide encoding a P1-2A-P3 polypeptide, wherein said polynucleotide is at least 80, 81, 82, 83, 84, 85, 86, 87, 88 or 89%, more preferably at least 90, 91, 92, 93 or 94%, and most preferably at least 95, 96, 96.1, 96.2, 96.3, 96.4 , 96.5, 96.6, 96.7, 96.8, 96.9, 97, 97.1, 97.2, 97.3, 97.4, 97.5, 97.6, 97.7 , 97.8, 97.9, 98, 98.1, 98.2, 98.3, 98.4, 98.5, 98.6, 98.7, 98.8, 98.9, 99, 99 .1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7,

- 1 041112

99.8, 99.9% identical to SEQ ID NOs: 18, 20, 22, 24, 32 and 33. As used herein, it is specifically understood that the term sequence identity to SEQ ID NO: X or identical to SEQ ID NO: X, respectively, are equivalent to the term sequence identity to the sequence of SEQ ID NO: X in the length of the sequence of SEQ ID NO: X or identical to the sequence of SEQ ID NO: X in the length of the sequence of SEQ ID NO: X, respectively, and in this context, X is any integer chosen from 18, 20, 22, 24, 32, and 33.

A preferred P1-2A-P3 polypeptide suitable for use in the present invention is a polypeptide having the sequence shown in SEQ ID NOS: 19, 21, 23, 25, 27 and 29, having at least 80% homology with SEQ ID NOs: 19, 21, 23, 25, 27 and 29, such as having at least 85% homology with SEQ ID NOs: 19, 21, 23, 25, 27 and 29, such as having at least 85% homology with SEQ ID NOs: 19, 21, 23, 25, 27 and 29, such as having at least 90% homology with SEQ ID NOs: 19, 21, 23, 25, 27 and 29, such as at least 95%, at least 98% or at least 99% homologous to SEQ ID NOS: 19, 21, 23, 25, 27 and 29.

In another aspect, the present invention relates to nucleic acid sequences that encode one or more polypeptides, antibody constructs, or antibody conjugates. Gene sequences encoding polypeptides contain a nucleic acid sequence that is at least 95%, 90%, 85%, or even 80% homologous and/or identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or fragments thereof, encoding a polypeptide , which is immunoreactive to SVA. Exemplary nucleic acid sequences of the invention include any of SEQ ID NO: 1, SEQ ID NO: 2 and fragments thereof that encode a polypeptide that is immunoreactive to SVA.

In addition, the polypeptide of this invention, as used herein, includes a polypeptide that contains:

a polypeptide containing the amino acid sequence of SEQ ID NO: 3;

a polypeptide that is at least 80% homologous and/or identical to polypeptide I);

fragment of polypeptides I) and/or II);

polypeptide I) or II);

fragment III) or IV) containing at least 5, preferably 8, more preferably 10, most preferably 15 contiguous amino acids included in the sequence of SEQ ID NO: 3;

a polypeptide encoded by a polynucleotide containing the sequence of SEQ ID NO: 1 or 2;

a polypeptide that is encoded by a polynucleotide that is at least 80% homologous or identical to the VI polynucleotides);

a protein fragment that is encoded by a polynucleotide that contains at least 15, preferably 24, more preferably 30, most preferably 45 contiguous nucleotides included in, but not limited to, SEQ ID NO: 1 or SEQ ID NO: 2.

Immunogenic compositions of the present invention that contain at least one or more SVA polypeptides as defined herein may additionally contain a physiologically acceptable carrier, such as a pharmaceutically or veterinarily acceptable carrier, an adjuvant, or a combination thereof.

Any of the SVA polypeptides provided herein, or any immunogenic compositions containing one or more of these SVA polypeptides provided herein, can be used as a drug, preferably as a vaccine or immunogenic composition, most preferably for prophylaxis or treating an SVA infection in a subject.

Those skilled in the art will appreciate that the compositions used herein may include known injectable physiologically acceptable sterile solutions. Aqueous isotonic solutions, such as saline or plasma protein solutions, are readily available to prepare a ready-to-use solution for parenteral injection or infusion. In addition, the immunogenic and vaccine compositions of the present invention may include veterinarily acceptable carriers, diluents, isotonic agents, stabilizers, or adjuvants.

The methods of the invention include a method of inducing an immune response to an SVA infection in a subject, comprising the step of administering to the subject an immunogenic composition comprising one or more SVA polypeptides as defined herein, but not limited to. Compositions of the invention may be used to treat or alternatively prevent SVA infection. Preferably, such an immune response reduces the frequency or severity of one or more clinical signs associated with or caused by infection with SVA serotypes.

As used herein, suitable subjects and subjects in need thereof, to which the compositions of the present invention may be administered, include animals in need of either

- 2 041112 prevention or treatment of an infection, disease or condition associated with a virus. Animals in which the immune response has been stimulated by use of the compositions or methods of the present invention include livestock such as pigs, cattle, goats and sheep. Preferred animals include pigs, murids, equids, lagomorphs and bovids. Most preferably, the immune response is stimulated in pigs.

The invention also relates to a method for reducing the frequency or severity of one or more clinical signs associated with or caused by SVA infection, comprising the step of administering an immunogenic composition of the present invention, which contains one or more SVA peptides, as provided herein, and preferably a carrier molecule such that the frequency or severity of the clinical sign of SVA infection is reduced by at least 10%, preferably at least 20%, even more preferably at least 30%, even more preferably at least 50%, even more preferably by at least 70%, most preferably at least 100%, relative to a subject who did not receive the immunogenic composition as provided herein.

Such clinical signs include vesicular disease such as open or closed blisters or lesions located on the muzzle, oral mucosa, and/or at the junction where the skin and hoof wall (hoof coronet) meet, hemorrhage into the nail bed, sudden lameness with redness and swelling on or around the coronet of the hoof; and in breeding females causes sudden food refusal, lethargy, loss of appetite and/or fever up to 105°F (~ 40.6°C).

There is a short-term (4-10 days) increase in mortality in newborn piglets (less than 7 days), which may or may not have diarrhea associated with it. Estimates of morbidity and mortality are 30-70% over a short period of time. When examining increased neonatal mortality, it is common to note vesicular lesions in breeding animals. This type of infection in pigs, which results in vesicles on the snout and hoof ring, is also called idiopathic porcine vesicular disease.

According to a further aspect, the present invention also relates to a method for preventing an SVA infection, characterized in that the SVA infection may be caused by Seneca Valley virus, comprising the step of administering an immunogenic composition of the present invention that comprises one or more SVA peptides as provided herein. .

The present invention also relates to a method for preparing any of the immunogenic compositions provided herein, which method includes mixing one or more SVA peptides, as provided herein, with a carrier molecule, preferably such that one or more SVA peptides and the carrier molecule has been covalently linked or conjugated to each other. Such conjugates may be multivalent or monovalent. Multivalent compositions or vaccines include immunoconjugation of multiple SVA peptides to a carrier molecule. In another aspect, the present invention relates to a method for preparing one or more SVA peptides, the method comprising transforming a host cell, preferably a prokaryotic cell such as E. coli, with a nucleic acid molecule that encodes any of the SVA peptides, as provided herein. Alternatively, the host cell may be a eukaryotic cell, such as an animal cell, a protist cell, a plant cell, or a fungal cell. Preferably the eukaryotic cell is a mammalian cell such as CHO, BHK or COS, or a fungal cell such as Saccharomyces cerevisiae or an insect cell such as Sf9.

Another aspect of the present invention relates to a method for obtaining one or more SVA peptides that induce an immune response to SVA. It involves culturing a transformed expression vector encoding and expressing one or more of the SVA peptides described herein. Expressed proteins are either retained by expression of the organism or secreted into the culture medium. Expression occurs under conditions sufficient to produce an SVA peptide capable of inducing an immune response to SVA.

A method for producing a vaccine of recombinantly expressed P1-2A-P3 antigen produced in insect cells with a recombinant baculovirus expressing a modified P1-2A-P3 SVA protein is also provided herein. The method in one exemplary embodiment comprises cloning the P1-2A-P3 SVA sequence into the pVL1393 vector (BD Biosciences) and co-transfecting Sf9 insect cells. For the inactivated recombinant SVA material, harvest of baculovirus SVA was inactivated for 24 h with 5 mM BEI, purified and filtered through 0.45 µm. Typically, the inactivated virus is subjected to further processing, for example by concentration and mixing with other components, to obtain a composition for sale. Thus, for example, fluids containing inactivated virus may be concentrated and mixed with adjuvant and/or antigen(s) from one or more other porcine pathogens.

Methods for preparing the compositions of the present invention may further include mixing a conjugate of one or more SVA peptides or inactivated whole virus

- 3 041112 preparations and carrier molecules with a physiologically acceptable carrier, such as a pharmaceutically or veterinarily acceptable carrier, an adjuvant, or a combination thereof. One of skill in the art will appreciate that the choice of carrier, adjuvant, or combination will be determined by the method of delivery, personal preference, and animal species, among other things.

In another aspect, the present invention relates to a method for diagnosing an SVA infection in a subject. This method includes providing one or more SVA peptides; contacting one or more SVA peptides with a sample obtained from a subject; and identifying the subject as having an SVA infection if an antibody capable of binding to one or more SVA peptides is found in the sample.

In another aspect, the invention relates to a method for determining that a subject has previously been exposed to an SVA infection and is capable of eliciting an immune response to SVA. This method includes providing one or more SVA peptides; contacting one or more SVA peptides with a sample obtained from a subject; and identifying the subject as having an SVA infection if an antibody capable of binding to one or more SVA peptides is found in the sample.

The invention also relates to kits that contain an immunogenic composition that contains one or more SVA peptides, preferably together with a carrier molecule; a container for packaging the immunogenic composition; a set of printed instructions; and a dispenser suitable for administering the immunogenic composition to an animal. Optionally, one or more SVA peptides and the carrier molecule may be packaged as a conjugate or as separate compounds. The separate kit also includes means for conjugating one or more SVA peptides and a carrier molecule, as well as corresponding printed instructions.

The present invention also relates to animal vaccination kits containing a set of printed instructions; a dispenser suitable for administering the immunogenic composition provided herein containing one or more SVA peptides to an animal; and wherein at least one of the SVA peptides effectively immunizes the animal against at least one disease associated with SVA infection. Preferably, one or more SVA peptides are selected from those provided herein. The kits of the present invention may further comprise a veterinarily acceptable carrier, an adjuvant, or a combination thereof.

The dispenser in the kit according to the invention is suitable for dispensing its contents in the form of drops; and an immunogenic composition comprising SVA peptides as provided herein, included in a kit, is suitable for reducing the severity of at least one clinical sign of SVA infection when administered intranasally, orally, subcutaneously, or intramuscularly to an animal. Preferably, the severity of the clinical sign is reduced by at least 10%, preferably at least 20%, even more preferably at least 30%, even more preferably at least 50%, even more preferably at least 70% , most preferably at least 100% compared to an untreated infected animal.

Methods for treating or preventing infections caused by SVA are also disclosed. The method includes administering an effective amount of an immunogenic composition of the present invention to a subject, said treatment or prophylaxis being selected from the group consisting of reducing signs of SVA infection, reducing the severity or frequency of clinical signs of SVA infection, reducing the mortality of subjects from SVA infection, and combinations thereof.

The compositions of the present invention further comprise a veterinarily acceptable carrier, adjuvant, or combination thereof. Such compositions can be used as a vaccine and contain an inactivated vaccine. Such vaccines induce a protective immune response to at least one disease associated with SVA.

Those skilled in the art will appreciate that the compositions used herein may include known injectable physiologically acceptable sterile solutions. Aqueous isotonic solutions, such as saline or plasma protein solutions, are readily available to prepare a ready-to-use solution for parenteral injection or infusion. In addition, the immunogenic and vaccine compositions of the present invention may include pharmaceutically or veterinarily acceptable carriers, diluents, isotonic agents, stabilizers, or adjuvants.

The methods of this invention may also include mixing the composition of this invention with a veterinarily acceptable carrier, adjuvant, or combination thereof. One of skill in the art will appreciate that the choice of carrier, adjuvant, or combination will be determined by the method of delivery, personal preference, and animal species, among other things.

Methods for treating or preventing infections caused by SVA are also disclosed. The method includes administering an effective amount of an immunogenic composition of the present invention to an animal, said treatment or prophylaxis being selected from the group consisting of reducing signs of SVA infection, reducing the severity or frequency of clinical signs of SVA infection, reducing animal mortality from SVA infection, and combinations thereof.

Preferred routes of administration include oral, intranasal, intradermal and

- 4 041112 intramuscular. Administration by the intramuscular route, most preferably as a single dose, is preferred. The person skilled in the art will understand that the compositions of the present invention can also be administered in two or more doses, as well as by other routes of administration. For example, such other routes of administration include subcutaneous, intradermal, intravenous, intravascular, intraarterial, intraperitoneal, intrathecal, intratracheal, intradermal, intracardiac, intralobal, intramedullary, intrapulmonary, or intravaginal. Depending on the desired duration and effectiveness of the treatment, the compositions according to the invention may be administered one or more times, also intermittently, for example on a daily basis for several days, weeks or months, and in different dosages.

The present invention also relates to animal vaccination kits containing a set of printed instructions; a dispenser suitable for administering the vaccine to the animal; and at least one SVA culture isolate. The kits of the present invention may further comprise a veterinarily acceptable carrier, an adjuvant, or a combination thereof.

The dispenser in the kit according to the invention is suitable for dispensing its contents in the form of drops; and the isolate included in the kit is suitable for reducing the severity of at least one clinical sign of SVA infection when administered intranasally, orally, subcutaneously or intramuscularly to an animal. In some kits, the isolate is also able to reduce the severity of at least one clinical sign of SVA infection. Preferably, the severity of the clinical sign is reduced by at least 10% compared to an untreated infected animal.

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples showing preferred embodiments of the present invention are provided by way of illustration only, as various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

Brief description of graphic materials

Fig. 1 shows scheme (A) of the SVVP13C construct (SEQ ID NO: 18) and scheme (B) of the SVVP 13C-CO (codon optimized) construct (SEQ ID NO: 20) for the baculovirus expression system.

Fig. 2 shows scheme (A) of the SVVP1-His-Sires-SVV3C construct (SEQ ID NO: 32) and scheme (B) of the SVVP1CO-His-Sires-SVV3C (codon-optimized) construct (SEQ ID NO: 33) for the baculovirus expression system .

Fig. 3 shows scheme (A) of the SVVP13C VP3/VP1 construct (SEQ ID NO: 22) for mutating the VP3/VP1 cleavage site and scheme (B) of the SVVP13CD construct (SEQ ID NO: 24) for the baculovirus expression system.

Fig. 4 shows Western blotting of supernatant samples of BaculoFBU/SVVP13C (A) (SEQ ID NO: 18) and BaculoFBU/SVVP13C CO (B) (SEQ ID NO: 20) compared with native SVV antigen detected by cross-reactive rabbit anti-alpha polyclonal antibodies -SVV VP1, anti-alpha-C VP2 and anti-alpha-C VP3. Lane A is the protein standard, lane 1 is the harvest of the Baculo SVV supernatant, lane 2 is the SVV antigen (SEQ ID NO: 3), and lane 3 is the negative control of the harvest of the Baculo supernatant. Expected band sizes: full-length P1 SVV=about 95 kDa (SEQ ID nO: 19, amino acids 1-859), VP1=about 29 kDa (SEQ ID nO: 19, amino acids 596859), VP2=about 32 kDa (SEQ ID NO: 19, amino acids 73-356), VP3=about 26 kDa (SEQ ID NO: 19, amino acids 357-595).

Fig. 5 shows a Western blot of the sucrose fraction (A) of native SVV and the sucrose fraction (B) of BauloFBU/SVVP13C with rabbit polyclonal antibodies alpha-SVV VP1, alpha-SVV VP2 and alpha-SVV PV3. Lane A is the protein standard, lanes 1-10 represent sucrose fractions 1-10, N is the BaculoFBU negative control/no insert, P is the positive control of native inactivated SVV, and S is the original sucrose gradient sample. Expected band sizes: full-length P1 SVV=about 95 kDa (SEQ ID NO: 19, amino acids 1-859), VP1=about 29 kDa (SEQ ID NO: 19, amino acids 596-859), VP2=about 32 kDa (SEQ ID NO: 19, amino acids 73356), VP3=about 26 kDa (SEQ ID NO: 19, amino acids 357-595).

Fig. 6 shows Western blot harvests of BaculoFBU/SVVP13C (SEQ ID NO: 18) and BaculoFBU/VVP13C VP3/VP1 (SEQ ID NO: 22) supernatants with rabbit polyclonal antibodies α-SVV VP1 (upper row) and α-SVV VP3 (lower row). row). Lane A - protein standard, lane 1 - collection of Baculo SVV supernatant, lane 2 - collection of SVV antigen supernatant and lane 3 - collection of Baculo supernatant neg. control.

Fig. 7 shows Western blotting of BaculoFBU/VVP13C VP3/VP1 sucrose fractions (SEQ ID NO: 22) with rabbit anti-SVV VP1, anti-SVV VP2 and anti-SVV VP3 polyclonal antibodies. Lane A is a protein standard, N is a native BaculoFBU control/no insert, P is a positive control of native inactivated SVV (SEQ ID NO: 3), S is a TBS resuspended SVVP13C VP3/VP1 pellet (SEQ ID NO: 22), and lanes 1-9 represent sucrose fractions 1-9. Full-length P1 SVV=about 95 kDa (SEQ ID NO: 19, amino acids 1-859), VP1=about

- 5041112 kDa (SEQ ID NO: 19, amino acids 596-859), νΡ2=οκοΛο 32 kDa (SEQ ID NO: 19, amino acids 73356), VP3=about 26 kDa (SEQ ID NO: 19, amino acids 357-595) .

Fig. 8 shows a Western blot of a harvest of BaculoFBU/VVP13CD supernatant (SEQ ID NO: 24) detected with rabbit anti-SVV VP1, anti-SVV VP2, and anti-SVV VP3 polyclonal antibodies. Lane A is the protein standard, lane 1 is the harvest of the Baculo SVV supernatant, lane 2 is the SVV antigen (SEQ ID NO: 3), and lane 3 is the negative control of the harvest of the Baculo supernatant. Expected band sizes: full-length P1 SVV=about 95 kDa (SEQ ID NO: 19, amino acids 1-859), VP1=about 29 kDa (SEQ ID NO: 19, amino acids 596-859), VP2=about 32 kDa (SEQ ID NO: 19, amino acids 73-356), VP3=about 26 kDa (SEQ ID NO: 19, amino acids 357-595).

Fig. 9 shows Western blotting of BaluloFBU/SVVP13CD sucrose fractions (SEQ ID NO: 24) with rabbit anti-SVV VP1, anti-SVV VP2 and anti-SVV VP3 polyclonal antibodies. Lane A is a protein standard, lane 1 is a harvest of Baculo SVV supernatant, lane N is a negative control of BaculoFBU/no insert, P is a positive control of native inactivated SVV (SEQ ID NO: 3), S is a TBA resuspended pellet of SVVP13CD (SEQ ID NO: 25) and lanes 1-10 represent sucrose fractions 1-10. Expected band sizes: full-length P1 SVV=about 95 kDa (SEQ ID NO: 19, amino acids 1-859), VP1=about 29 kDa (SEQ ID NO: 19, amino acids 596-859), VP2=about 32 kDa (SEQ ID NO: 19, amino acids 73-356), VP3=about 26 kDa (SEQ ID NO: 19, amino acids 357-595).

Fig. 10 shows a Western blot of BaculoFBU/SVVP13C (A) (SEQ ID NO: 18), BaculoFBU/SVVP13CD (A) (SEQ ID NO: 24) and BaculoFBU/SVVP13CVP3/VP1 (B) (SEQ ID NO: 22). Soluble fractions with rabbit polyclonal antibodies α-SVV VP1, α-SVV VP2 and α-CBB VP3 on Day 3. DNS-PAGE gel for BaculoFBU/SVVP13C and BaculoFBU/SVVP13CD (C). Lane A - protein standard, lane P - positive control of native SVV antigen, lane 1 - soluble fraction of SVVP13C on day 3, lane 2 - soluble fraction of SVVP13CD on day 3, lane 3 - soluble fraction of SVVP13C VP3/VP1 on day 3 and lane N - negative control of the soluble fraction of BaculoFBU/no insert. Expected band sizes: full-length P1 SVV=about 95 kDa (SEQ ID NO: 19, amino acids 1-859), VP1=about 29 kDa (SEQ ID NO: 19, amino acids 596-859), VP2= about 32 kDa (SEQ ID NO: 19, amino acids 73-356), VP3=about 26 kDa (SEQ ID NO: 19, amino acids 357-595).

Fig. 11 shows Western blotting of day 3 sucrose fractions of soluble BaculoFBU/SVVP13C (SEQ ID NO: 18) (A), BaculoFBU/SVVP13CD (SEQ ID NO: 24) (B) and BaculoFBU/SVVP13C VP3/VP1 (SEQ ID NO: 22) (C) with rabbit polyclonal antibodies anti-alpha SVV VP1, anti-alpha SVV VP2 and anti-alpha SVV VP3. Lane A is the protein standard, P is the positive control of native inactivated SVV, lanes 1-11 are sucrose fractions 1-11, and N is the negative control of BaculoFBU soluble fraction/no insert. Expected band sizes: full-length P1 SVV=about 95 kDa (SEQ ID NO: 19, amino acids 1859), VP1=about 29 kDa (SEQ ID NO: 19, amino acids 596-859), VP2=about 32 kDa (SEQ ID NO: 19, amino acids 73-356), VP3=about 26 kDa (SEQ ID NO: 19, amino acids 357-595).

Fig. 12 shows the mean least squares of rectal temperatures (°C) versus study day and group.

Fig. 13 shows mean log ₁₀ genomic copies/ml serum group SVA RNA by group and day.

Detailed description

In carrying out the present invention will be used, unless otherwise indicated, conventional methods of molecular biology, microbiology, recombinant DNA technology, protein chemistry and immunology, which are known to experts in this field of technology. Such methods are described in detail in the literature. See, for example, Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Vols. I, II and III, Second Edition (1989); DNA Cloning Vols. I and II (D. N. Glover ed. 1985); Oligonucleotide Synthesis (M. J. Gait ed. 1984); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Animal Cell Culture (R. K. Freshney ed. 1986); Immobilized Cells and Enzymes (IRL press, 1986); Perbal, B., A Practical Guide to Molecular Cloning (1984); the series, Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Protein purification methods - a practical approach (E.L.V. Harris and S. Angal, eds., IRL Press at Oxford University Press); and Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell eds., 1986, Blackwell Scientific Publications).

Before describing the present invention in detail, it should be understood that the present invention is not limited to particular DNA, polypeptide sequences, or process parameters, as these may, of course, vary. In addition, it should be understood that the terminology used herein is for the purpose of describing specific embodiments of the invention only and is not intended to be limiting. It should be noted that, as used in this specification and the appended claims, the singular also includes the plural, unless the context clearly dictates otherwise. Thus, for example, a reference to an antigen includes a mixture of two or more antigens; reference to filler includes mixtures of two or more fillers and the like.

- 6 041112

A. Definitions.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by a person skilled in the art to which this invention belongs at the time of filing. The meaning and scope of terms should be clear; however, in case of any latent ambiguity, definitions given in this document take precedence over definitions in any dictionary or outside the document. In addition, unless otherwise required by context, terms used in the singular must include the plural and terms used in the plural must include the singular. Herein, in this document, the use of or means and/or unless otherwise indicated. In addition, the use of the term including, as well as other forms such as includes and included, is not intended to be limiting. All patents and publications mentioned in this document are incorporated herein by reference.

Protection against disease, protective immunity, functional immunity and similar phrases means a response to a disease or condition induced by the administration of one or more therapeutic compositions of the present invention, or a combination thereof, that results in less deleterious effects than would be expected in a non-immunized subject. who has been exposed to disease or infection. Those. the severity of the harmful effects of infection is reduced in the vaccinated subject. Infection can be reduced, slowed down, or possibly completely prevented in a vaccinated subject. This document specifically states if the infection prophylaxis was complete. Unless indicated that the infection was completely prevented, the term includes partial prevention.

As used herein, reduction in the frequency and/or severity of clinical signs or reduction in clinical symptoms means a reduction in the number of infected subjects in a group, a reduction or elimination in the number of subjects showing clinical signs of infection, or a reduction in the severity of any clinical signs that are present in one or more subjects. compared to wild-type infection, but are not limited to this. For example, this should refer to any reduction in pathogen load, pathogen isolation, reduction in pathogen transmission, or reduction in any clinical sign of malaria symptoms. Preferably, these clinical signs are reduced in one or more subjects receiving the therapeutic composition of the present invention by at least 10% compared to subjects not receiving the composition who become infected. More preferably, clinical signs are reduced in subjects receiving the composition of the present invention by at least 20%, preferably at least 30%, more preferably at least 40%, even more preferably at least 50%.

The term increased protection in the present invention means a statistically significant reduction in one or more clinical symptoms that are associated with an infection caused by an infectious agent, preferably SVA, respectively, in a vaccinated group of subjects compared to a control group of unvaccinated subjects, but is not limited to this. The term statistically significant reduction in clinical symptoms means that the incidence of at least one clinical symptom in a vaccinated group of subjects is at least 10%, preferably 20%, more preferably 30%, even more preferably 50%, and even more preferably 70% lower than in the unvaccinated control group after infection with an infectious agent, but not limited to this.

Long-term protection refers to improved efficacy that lasts for at least 3 weeks, more preferably at least 3 months, even more preferably at least 6 months. In the case of livestock, it is most preferred that continued protection be maintained until the average age at which the animals are sold for meat.

An immunogenic or immunological composition refers to a composition of matter that contains at least one SVA immunogenic composition, or immunogenic portion thereof, that elicits an immune response in the host body of a cellular or antibody-mediated immune response to the composition. In a preferred embodiment of the present invention, the immunogenic composition induces an immune response, and more preferably, provides protective immunity against one or more clinical signs of SVA infection.

An immunogenic or antigen as used herein refers to a polypeptide or protein that elicits an immune response as described herein. An immunogenic SVA protein or polypeptide includes the full sequence of any SVA as defined herein, or analogues or immunogenic fragments thereof. The term immunogenic fragment or immunogenic region refers to a fragment or truncated and/or substituted form of SVA that includes one or more epitopes and thus elicits the immunological response described herein. In general, such truncated and/or substituted forms or fragments will contain at least six contiguous amino acids of the full length SVA protein. More preferably, truncated or substituted forms or fragments will have at least 10, more preferably

- 7 041112 preferably at least 15, and even more preferably at least 19 contiguous amino acids of a full-length SVA protein. Such fragments can be identified using any number of epitope mapping techniques well known in the art. See, for example, Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996) Humana Press, Totowa, New Jersey. For example, linear epitopes can be determined by simultaneously synthesizing a large number of peptides on solid supports, peptides corresponding to regions of a protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such methods are known and described in the art, see, for example, US patent No. 4708871; Geysen et al. (1984) Proc. Natl. Acad. sci. USA 81:3998-4002; and Geysen et al. (1986) Molec. Immunol. 23:709-715. Similarly, conformational epitopes can be easily identified by determining the spatial conformation of amino acids, for example, using x-ray crystallography and two-dimensional nuclear magnetic resonance. See protocols for epitope mapping above. Synthetic antigens are also included in the definition of, for example, polyepitopes, flanking epitopes, and other recombinant or synthetically derived antigens. See, for example, Bergmann et al. (1993) Euro. J. Immunol. 23:2777-2781; Bergmann et al. (1996), J. Immunol. 157:3242-3249; Suhrbier, A. (1997), Immunol. and Cell Biol. 75:402-408; and Gardner et al., (1998) 12th World AIDS Conference, Geneva, Switzerland, June 28-July 3, 1998. (Descriptions and contents of which are incorporated herein by reference).

An immune response or immunological response means the development of a cellular and/or antibody-mediated immune response to, but not limited to, a composition or vaccine of interest. Typically, an immune or immunological response includes one or more of the following: production or activation of antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells directed specifically to the antigen or antigens included in the composition. or a vaccine of interest, but are not limited to. Preferably, the host will show either a therapeutic or protective immunological (secondary) response such that resistance to the new infection is increased and/or the clinical severity of the disease is reduced. Such protection will be demonstrated either by a reduction in the number of symptoms, the severity of symptoms, or the absence of one or more of the symptoms associated with infection of the pathogen, a delay in the onset of viremia, a decrease in viral persistence, a decrease in the total viral load, and/or a decrease in viral excretion.

As used herein, specific immunoreactive refers to an immunoreactive protein or polypeptide that recognizes the characteristic antigen of an SVA infection but does not react with the antigen characteristic of a stringent challenge.

As used herein, a pharmaceutically or veterinarily acceptable carrier includes all possible solvents, dispersion media, coatings, adjuvants, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, absorption retarding agents, and the like. In some preferred embodiments, and especially those involving lyophilized immunogenic compositions, stabilizing agents for use in the present invention include lyophilization or freeze-drying stabilizers.

In some embodiments, the implementation of the immunogenic composition of the present invention contains an adjuvant. The term adjuvants as used herein may include aluminum hydroxide and aluminum phosphate, saponins, e.g. Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion. The emulsion may be based, in particular, on a light liquid paraffin oil (according to the European Pharmacopoeia); an isoprenoid oil such as squalane or squalene; oil resulting from the oligomerization of alkenes, in particular isobutene or decene; esters of acids or alcohols containing a linear alkyl group, more specifically vegetable oils, ethyl oleate, propylene glycol di-(caprylate/caprate), glyceryl tri(caprylate/caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular esters of isostearic acid. The oil is used in combination with emulsifiers to form an emulsion. Emulsifiers are preferably non-ionic surfactants, in particular esters of sorbitan, mannitol (e.g. anhydromannitol oleate), glycol, polyglycerol, propylene glycol and oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene polyoxyethylene copolymer blocks, in particular pluronic products , especially L121. See Hunter et al., The Theory and Practical Application of Adjuvants (Ed. Stewart-Tull, D. E. S.), JohnWiley and Sons, NY, pp51-94 (1995) and Todd et al., Vaccine 15:564-570 (1997 ). Illustrative adjuvants are the SPT emulsion described on page 147 of Vaccine Design, The Subunit and Adjuvant Approach in M. Powell and M. Newman, Plenum Press, 1995, and the MF59 emulsion described on page 183 of the same book. Another example of an adjuvant is a compound selected from polymers of acrylic or methacrylic acid and copolymers of maleic anhydride and alkenyl derivatives. Preferential

- 8 041112 adjuvant compounds are polymers of acrylic or methacrylic acid, which are cross-linked, especially with polyalkenyl ethers of sugars or polyhydric alcohols. These compounds are known under the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Those skilled in the art may also refer to US Pat. No. 2,909,462 which describes similar acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably no more than 8, hydrogen atoms of at least three hydroxyl groups replaced unsaturated aliphatic radicals containing at least 2 carbon atoms. Preferred radicals containing from 2 to 4 carbon atoms are, for example, vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals themselves may contain other substituents such as methyl. These products sold under the name CARBOPOL® (Lubrizol) are particularly suitable. They are cross-linked with allyl sucrose or allyl pentaerythritol. Among them, Carbopol 974P, 934P and 971P can be mentioned. Most preferred is the use of Carbopol 971P. Among the copolymers of maleic anhydride and an alkenyl derivative, are EMA copolymers (Monsanto), which are copolymers of maleic anhydride and ethylene. Dissolving these polymers in water results in an acidic solution that will be neutralized, preferably to physiological pH, to provide an adjuvant solution in which only the immunogenic, immunological or vaccine composition will be included.

Other suitable adjuvants include RIBI adjuvant system (Ribi Inc.) copolymer Block (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA) monophosphoryl lipid A, Avridine lipid-amine adjuvant, E. coli heat labile enterotoxin (recombinant or otherwise), cholera toxin, IMS 1314 or muramyl dipeptide or natural cytokines or recombinant cytokines or analogues thereof or stimulators of endogenous cytokine release, among many others, but not limited to.

It is expected that the adjuvant may be added in an amount of from about 100 µg to about 10 mg per dose, preferably in an amount of from about 100 µg to about 10 mg per dose, more preferably in an amount of from about 500 µg to about 5 mg per dose, still more preferably in an amount of from about 750 μg to about 2.5 mg per dose, and most preferably in an amount of about 1 mg per dose. Alternatively, the adjuvant may be at a concentration of from about 0.01% to 50%, preferably at a concentration of from about 2% to 30%, more preferably at a concentration of from about 5% to 25%, even more preferably at a concentration of about 7% to 22%, and most preferably at a concentration of 10 to 20% by volume of the final product.

The term diluents may include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents may include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others.

Stabilizers include albumin and alkaline salts of ethylenediaminetriacetic acid, among others.

The term distinguished means altered by the hand of man from his natural state, i.e., if it exists in nature, it has been altered or removed from its original environment, or both. For example, a polynucleotide or polypeptide naturally present in a living organism is not isolated, but the same polynucleotide or polypeptide isolated from coexisting materials in its natural state is isolated, as the term is used herein.

The term safety refers to the absence of adverse effects in vaccinated animals following vaccination, including but not limited to: potential reversal of the bacterium-based vaccine to virulence, clinically significant side effects such as persistence, systemic disease, or unacceptable inflammation at the injection site of the vaccine.

The terms vaccination or vaccination, or variations thereof, as used herein, means a process that includes, but is not limited to, administering an immunogenic composition of the present invention that, when administered to an animal, elicits or is capable of eliciting, directly or indirectly, an immune response in the animal to SVA.

The term mortality in the context of the present invention refers to death caused by an SVA infection and includes the situation where the infection is so severe that the animal is sacrificed to prevent suffering and ensure a humane end to its life.

As used herein, the term "effective dose" means an amount of an antigen that elicits or can elicit an immune response that results in a reduction in clinical symptoms in, but not limited to, an animal to which the antigen is administered.

As used herein, the term effective amount means, in the context of a composition, an amount of an immunogenic composition capable of inducing an immune response that reduces the incidence or severity of an infection or disease incident in an animal. In particular, the effective amount refers to colony forming units (CFU) per dose. Alternatively, in the context of therapy, the term effective amount refers to the amount of therapy that is

- 9 041112 tactic to reduce or lessen the severity or duration of a disease or disorder, or one or more of their symptoms, prevent progression of a disease or disorder, cause regression of a disease or disorder, prevent recurrence, development, onset or progression of one or more symptoms associated with a disease or disorder, or enhancing or improving the prevention or treatment of another therapy or therapeutic agent.

The term fragment refers to a fragment or a truncated and/or substituted form of an SVA peptide or a gene encoding such an SVA peptide that includes one or more epitopes and thus elicits an immunological response to SVA. Preferably, such a fragment is a fragment or a truncated and/or substituted form of any of the SVA peptides or any of the SVA genes provided herein. In general, such truncated and/or substituted forms or fragments will contain at least six contiguous amino acids of the full length SVA sequence. More preferably, truncated or substituted forms or fragments will have at least 10, more preferably at least 15, and even more preferably at least 19 contiguous amino acids of the full length SVA sequence. Such fragments can be identified using any number of epitope mapping techniques well known in the art. See, for example, Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996) Humana Press, Totowa, New Jersey. For example, linear epitopes can be determined by simultaneously synthesizing a large number of peptides on solid supports, peptides corresponding to regions of a protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such methods are known and described in the art, see, for example, US patent No. 4708871; Geysen et al. (1984) Proc. Natl. Acad. sci. USA 81:3998-4002; and Geysen et al. (1986) Molec. Immunol. 23:709-715. Similarly, conformational epitopes can be easily identified by determining the spatial conformation of amino acids, for example, using x-ray crystallography and two-dimensional nuclear magnetic resonance.

See protocols for epitope mapping above. Synthetic antigens are also included in the definition of, for example, polyepitopes, flanking epitopes, and other recombinant or synthetically derived antigens. See, for example, Bergmann et al. (1993) Euro. J. Immunol. 23:2777-2781; Bergmann et al. (1996), J. Immunol. 157:3242-3249; Suhrbier, A. (1997), Immunol. and Cell Biol. 75:402-408; and Gardner et al., (1998) 12th World AIDS Conference, Geneva, Switzerland, June 28-July 3, 1998. (Descriptions and contents of which are all incorporated herein by reference).

The term variant in relation to a sequence (eg, polypeptide or nucleic acid sequence) means substantially similar sequences. To obtain nucleotide sequences containing an open reading frame, variants include sequences that, due to the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those obtained, for example, by site-directed mutagenesis, and for open reading frames encode a native protein, as well as those that encode a polypeptide having amino acid substitutions relative to the native protein for codon optimization. Typically, the nucleotide sequence variants of this invention will be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more preferably at least 90%, 91, 92, 93, or 94% %, and most preferably at least 95, 96, 96.1, 96.2, 96.3, 96.4, 96.5, 96.6, 96.7, 96.8, 96.9, 97 , 97.1, 97.2, 97.3, 97.4, 97.5, 97.6, 97.7, 97.8, 97.9, 98, 98.1, 98.2, 98.3 , 98.4, 98.5, 98.6, 98.7, 98.8, 98.9, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6 , 99.7, 99.8, 99.9% sequence identical compared to a reference sequence using one of the alignment programs described using standard parameters.

The term SVA immunoreactive, as used herein, means that the peptide or fragment elicits an immunological response to SVA.

The term homology, as used herein, refers to a method for determining the relationship of two sequences. To determine sequence homology, two or more sequences are optimally aligned and, if necessary, gaps are introduced. However, unlike sequence identity, conservative amino acid substitutions are counted as a match when determining sequence homology. In other words, to obtain a polypeptide or polynucleotide having 95% sequence homology with a reference sequence, 85%, preferably 90%, even more preferably 95% of the amino acid residues or nucleotides in the reference sequence must match or contain a conservative substitution with another amino acid or nucleotide, or an amount of amino acids or nucleotides up to 15%, preferably up to 10%, even more preferably up to 5% of the total number of amino acid residues or nucleotides, not including conservative substitutions, in the reference sequence can be inserted into the reference sequence. Preferably the homologous sequence contains at least a stretch of 50, even more preferably 100, even more preferably 250, even more preferably 500 nucleotides.

- 10 041112

Conservative substitution refers to the replacement of a mino acid residue or nucleotide with another amino acid residue or nucleotide having similar characteristics or properties, including size, hydrophobicity, etc., such that the overall functionality is not significantly altered.

Sequence identity, as known in the art, refers to the relationship between two or more polypeptide sequences or two or more polynucleotide sequences, namely a reference sequence and a sequence provided for comparison with a reference sequence. Sequence identity is determined by comparing a given sequence with a reference sequence after the sequences have been optimally aligned to achieve the highest degree of sequence similarity as determined by matching between strings of such sequences. After such an alignment, sequence identity is determined position by position, for example, sequences are the same at a certain position if the nucleotides or amino acid residues at that position are identical. The total number of such position identities is then divided by the total number of nucleotides or residues in the reference sequence to determine percent sequence identity. Sequence identity can be readily calculated using known methods, including those described in Computational Molecular Biology, Lesk, A. N., ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D. W., ed. , Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988), but not limited to, the description of which is incorporated herein by reference. Preferred methods for determining sequence identity are designed to give the greatest match between test sequences. Methods for determining sequence identity are coded into publicly available computer programs that determine sequence identity between given sequences. Examples of such programs include the GCG software package (Devereux, J., et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Molec. Biol ., 215:403-410 (1990), but are not limited to The BLASTX program is publicly available from NCBI and other resources (BLAST Manual, Altschul, S. et al., NCVI NLM NIH Bethesda, MD 20894, Altschul, S. F. et al. , J. Molec Biol., 215:403-410 (1990, the description of which is incorporated herein by reference.) These programs optimally align sequences using default gap penalties to ensure a high level of sequence identity between data. and reference sequences By way of illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity with a reference nucleotide sequence, it is assumed that the nucleotide sequence The sequence of a given polynucleotide is identical to the reference sequence, except that a given polynucleotide sequence may include up to 15, preferably up to 10, even more preferably up to 5 point mutations for every 100 nucleotides of the reference nucleotide sequence. In other words, in a polynucleotide having a nucleotide sequence having at least 85%, preferably 90%, even more preferably 95% identity with a reference nucleotide sequence, up to 15%, preferably 10%, even more preferably 5% of the nucleotides in the reference sequence can be removed or replaced with other nucleotides, or up to 15%, preferably 10%, even more preferably 5% of the total nucleotides in the reference sequence can be inserted into the reference sequence. These reference sequence mutations can occur at the 5' or 3' end of the reference nucleotide sequence, or anywhere in between, interspersed or singly among nucleotides in the reference sequence, or in one or more contiguous groups within the reference sequence. Similarly, by a polypeptide having a given amino acid sequence having at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity with a reference amino acid sequence, it is assumed that the given amino acid sequence of the polypeptide is identical to the reference sequence except that that a given polypeptide sequence may include up to 15, preferably up to 10, even more preferably up to 5 amino acid composition changes for every 100 amino acids of the reference amino acid sequence. In other words, to obtain a given sequence of a polypeptide having at least 85%, preferably 90%, even more preferably 95% sequence identity with a reference amino acid sequence, up to 15%, preferably up to 10%, even more preferably up to 5% amino acid residues in of the reference sequence may be deleted or replaced with another amino acid, or up to 15%, preferably up to 10%, even more preferably up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference

- 11 041112 new sequence. These reference sequence changes may occur at the amino or carboxyl terminal positions of the reference amino acid sequence, or anywhere in between these terminal positions, alternately or individually among residues in the reference sequence, or in one or more contiguous groups within the reference sequence. Preferably, positions of residues that are not identical are distinguished by conservative amino acid substitutions. However, conservative substitutions are not included as a match in determining sequence identity.

The terms sequence identity or percent identity are used interchangeably herein. For the purposes of the present invention, this document specifies that in order to determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison (e.g., gaps can be introduced into the first amino acid or nucleic acid sequence for optimal alignment with second amino acid or nucleic acid sequence). The amino acid or nucleotide residues at the respective amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid or nucleotide residue at the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences (ie, % identity=number of identical positions/total number of positions (ie, overlapping positions) x100). Preferably, these two sequences are of the same length.

Sequence comparison can be performed over the entire length of the two compared sequences or over fragments of two sequences. Typically, and preferably within the scope of the present invention, the comparison is made over the entire length of the two compared sequences. However, sequence identity may be over a region of, for example, twenty, fifty, one hundred or more contiguous amino acid residues.

As used herein, and in particular, it is understood that the term having at least X% sequence identity with the nucleic acid/amino acid sequence according to SEQ ID NO: Y (or alternatively, the term having at least X% sequence identity with a nucleic acid/amino acid sequence according to SEQ ID NO: Y) equivalent to a term having at least X% sequence identity with a nucleic acid/amino acid sequence according to SEQ ID NO: Y over the length of SEQ ID NO: Y, or a term having at least X% sequence identity with the nucleic acid/amino acid sequence according to SEQ ID NO: Y over the entire length of the sequence of SEQ ID NO: Y, respectively.

Vectors and methods for making and/or using vectors (or recombinants) for expression can be the methods or similar methods described in: US Pat. 5942235, 382425, PCT Publications WO 94/16716, WO 96/39491, WO 95/30018; Paoletti, Applications of pox virus vectors to vaccination: An update, PNAS USA 93: 11349-11353, October 1996; Moss, Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety, PNAS USA 93: 11341-11348, October 1996; Smith et al., US Pat. No. 4,745,051 (recombinant baculovirus); Richardson, C. D. (Editor), Methods in Molecular Biology 39, Baculovirus Expression Protocols (1995 Humana Press Inc.); Smith et al., Production of Human Beta Interferon in Insect Cells Infected with a Baculovirus Expression Vector, Molecular and Cellular Biology, December, 1983, Vol. 3, no. 12, p. 2156-2165; Pennock et al., Strong and Regulated Expression of Escherichia coli B-Galactosidase in Infect Cells with a Baculovirus vector, Molecular and Cellular Biology March 1984, Vol. 4, no. 3, p. 406; EPA0370573; US Application No. 920197, filed October 16, 1986; publication of the patent EP No. 265785; US patent No. 4769331 (recombinant herpes virus); Roizman, The function of herpes simplex virus genes: A primer for genetic engineering of novel vectors, PNAS USA 93:11307-11312, October 1996; Andreansky et al., The application of genetically engineered herpes simplex experimental viruses to the treatment of brain tumors, PNAS USA 93: 11313-11318, October 1996; Robertson et al., Epstein-Barr virus vectors for gene delivery to B lymphocytes, PNAS USA 93: 11334-11340, October 1996; Frolov et al., Alphavirus-based expression vectors: Strategies and applications, PNAS USA 93: 1137111377, October 1996; Kitson et al., J. Virol. 65, 3068-3075, 1991; US Patents. No. 5591439, 5552143. WO 98/00166; US Applications Nos. 08/675556 and 08/675566, both filed July 3, 1996 (recombinant adenovirus); Grunhaus et al., 1992, Adenovirus as cloning vectors, Seminars in Virology (Vol. 3) p. 237-52, 1993; Ballay et al. EMBO Journal, vol. 4, p. 3861-65, Graham, Tibtech 8, 85-87, April, 1990; Prevec et al., J. Gen Virol. 70, 42434; PCT WO 91/11525; Feigner et al. (1994), J. Biol. Chem. 269, 2550-2561 Science 259: 1745-49, 1993; and McClements et al., Immunization with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in combination, induces protective immunity in animal models of herpes simplex virus-2 disease, PNAS USA 93: 11414-11420, October 1996; and US patents. No. 5591639, 5589466 and 5580859, as well as WO 90/11092, WO 93/19183, WO 94/21797, WO 95/11307, WO 95/20660; Tang et al., Nature,

- 12 041112 and Furth et al., Analytical Biochemistry, relating to the expression of DNA vectors in particular. See also WO 98/33510; Ju et al., Diabetologia, 41: 736-739, 1998 (Lentivirus expression system); Sanford et al., US Pat. No. 4,945,050; Fischbachet al. (Intracel); WO 90/01543; Robinson et al., Seminars in Immunology vol. 9, pp. 271-283 (1997), (DNA vector systems); Szoka et al., US Pat. No. 4,394,448 (Method of introducing DNA into living cells); McCormick et al., US Pat. No. 5,677,178 (use of cytopathic viruses); and US Pat. No. 5,928,913 (vectors for gene delivery); as well as other documents cited in the present description.

Preferred viral vectors include baculovirus such as BaculoGold (BD Biosciences Pharmingen, San Diego, Calif.), in particular, provided that the production cells are insect cells. While the baculovirus expression system is preferred, those skilled in the art will recognize that other expression systems will work for the purposes of the present invention.

B. Carrier molecules.

The carrier molecules to which the SVA peptides of this invention may be conjugated or covalently linked are preferably those described above. Preferred vehicles for use in animals are bovine serum albumin and keyhole limpet hemocyanin. Protein carriers suitable for use in humans include tetanus toxoid, diphtheria toxoid, acellular pertussis vaccine (LPF toxoid), cross-reactive materials (CRMs) that are antigenically similar to bacterial toxins but non-toxic due to mutation. Thus, for example, CRM 197 prepared according to Pappenheimer, et al, Immunochemistry, 9, 891-906 (1972), as well as other bacterial carrier proteins, for example, meningococcal outer membrane protein can be used. Preferably, the carrier protein itself is an immunogen.

The SVA peptides of this invention may be covalently linked to the carrier by any convenient method known in the art. Whereas the use of a symmetrical linker such as adipic acid dihydrazide as described in Schneerson et al, J. Experimental Medicine, 152, 361-376 (1980), or a heterobifunctional linker such as Nasuccinimidyl-3-(2pyridyldithio)propionate , as described in Fattom et al, Infection and Immunity, 56, 2292-2298 (1988) is within the scope of the present invention, it is preferred to avoid the use of any linker and instead couple the SVA peptide of the present invention directly to the carrier molecule. Such a connection can be achieved by reductive amination as described in Landi et al J. Immunology, 127, 1011-1019 (1981).

The size of the immunogenic composition, as defined by average molecular weight, is variable and depends on the SVA peptide(s) chosen and the manner in which the SVA peptide(s) are coupled to the carrier. So it can be as much as 1000 daltons (10) or more than 10 daltons. Using the reductive amination coupling method, the molecular weight of the SVA peptide(s) is typically in the range of 5,000 to 500,000, eg 300,000 to 500,000, or eg 5,000 to 50,000 daltons.

Carrier molecules, i.e. peptides, derivatives and analogs thereof, and peptidomimetics that specifically bind the SVA peptide of this invention can be prepared by various methods known in the art, including solid phase synthesis or solution (Nakanishi et al., 1993, Gene 137 :51-56; Merrifield, 1963, J. Am. Chem. Soc. 15:2149-2154; Neurath, H. et al., Eds., The Proteins, Vol II, 3d Ed., p. 105-237, Academic Press, New York, N.Y. (1976), incorporated herein by reference in its entirety), but not limited to.

The SVA peptides of the present invention or the antibodies or binding regions thereof of the present invention may be administered in injectable doses in solution or suspension in a diluent with a pharmaceutical or veterinary carrier.

The toxicity and therapeutic efficacy of such molecules can be determined using standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine the LD ₅₀ (lethal dose for 50% of the population).

The vaccines of the present invention may be multivalent or monovalent. Multivalent vaccines are made by immuno-conjugation of multiple SVA peptides to a carrier molecule.

In one aspect, the SVA peptide compositions comprise an effective immunizing amount of an immunogenic conjugate, preferably in combination with an immunostimulant; and a physiologically acceptable carrier. As used herein, the term immunostimulant encompasses any compound or composition that has the ability to enhance the activity of the immune system, whether it be a specific potentiating effect in combination with a specific antigen, or simply an independent effect on the activity of one or more elements of the immune response. Immunostimulant compounds include mineral gels such as aluminum hydroxide; surfactants such as lysolecithin, PLURONIC® polyols; polyanions; peptides; oil emulsions; alum and MDP, but are not limited to. Ways to use these materials well

- 13 041112 known in the art, and a person skilled in the art is able to determine the optimal amount of stimulant for a given vaccine. More than one immunostimulant may be used in a given composition.

The immunogen may also be incorporated into liposomes or conjugated to polysaccharides and/or other polymers for use in a vaccine.

The compositions may, if desired, be presented in a package or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The package may, for example, contain a metal or plastic foil, such as a blister pack. The package or dispenser may be accompanied by instructions for administration, preferably for administration to a mammal, especially a pig. Such container(s) may be associated with a notice in the form prescribed by a government agency regulating the manufacture, use, or sale of pharmaceutical or biological products, such notice reflecting the agency's authorization of manufacture, use, or sale for human administration.

B. Adjuvants.

To further enhance immunogenicity, the immunogenic compositions provided herein that contain one or more SVA peptides may also contain one or more adjuvants.

The adjuvant may be purified using any of the methods previously described or known in the art. The preferred purification method is silica gel chromatography, in particular flash chromatography as described in W. Clark Still et al, J. Organic Chemistry, 43, 2923-2925 (1978). However, other chromatographic methods, including HPLC, can be used to purify the adjuvant. Crystallization can also be used to purify the adjuvant. In some cases, no purification is required as the analytical grade product is obtained directly from the synthesis.

The vaccine compositions of the present invention are prepared by physically mixing the adjuvant with the SVA peptide(s) under appropriate sterile conditions in accordance with known methods to form an adjuvanted composition. Complexation of the SVA peptide(s) and the adjuvant is facilitated by the presence of a net negative charge on the conjugate, which is electrostatically attracted to the positive charge present on the long chain alkyl compound of the adjuvant.

It is expected that the adjuvant may be added in an amount of from about 100 µg to about 10 mg per dose, preferably in an amount of from about 100 µg to about 10 mg per dose, more preferably in an amount of from about 500 µg to about 5 mg per dose, still more preferably in an amount of from about 750 μg to about 2.5 mg per dose, and most preferably in an amount of about 1 mg per dose. Alternatively, the adjuvant may be at a concentration of from about 0.01% to 75%, preferably at a concentration of from about 2% to 30%, more preferably at a concentration of from about 5% to 25%, even more preferably at a concentration of about 7% to 22%, and most preferably at a concentration of 10 to 20% by volume of the final product.

D. Physiologically acceptable carriers.

The vaccine compositions of the present invention can be formulated using methods similar to those used for other pharmaceutical polypeptide compositions. Thus, the adjuvant and SVA peptide(s), preferably conjugated to a carrier molecule and/or mixed with the adjuvant, can be stored in lyophilized form and reconstituted in a physiologically acceptable vehicle to form a suspension prior to administration. Alternatively, the adjuvant and conjugate may be stored in a carrier. Preferred carriers are sterile solutions, in particular sterile buffer solutions such as phosphate buffered saline. Any method of combining an adjuvant and a conjugate in a carrier to improve the immunological efficacy of the immunogenic composition is suitable.

The volume of a single dose of the vaccine of the present invention may vary, but is usually within the ranges commonly used in conventional vaccines. The volume of a single dose is preferably from about 0.1 to about 3 ml, preferably from about 0.2 to about 1.5 ml, more preferably from about 0.2 to about 0.5 ml at the conjugate and adjuvant concentrations indicated above.

The vaccine compositions of the present invention may be administered by any convenient route.

D. Compositions.

Immunogenic conjugates containing an SVA peptide linked to a carrier molecule can be used as a vaccine for immunization against SVA. Vaccines containing the immunogenic conjugate in a physiologically acceptable carrier may be used in a method of immunizing animals, preferably pigs, to treat or prevent SVA infections.

Antibodies generated in response to the immunogenic conjugates of the present invention by immunization with the immunogenic conjugate can be used in passive immunotherapy and the generation of anti-idiotypic antibodies to treat or prevent SVA infection.

- 14 041112

The subject to which the composition is administered is preferably an animal, including but not limited to cows, horses, sheep, pigs, birds (eg chickens), goats, cats, dogs, hamsters, mice and rats, most preferably a mammal is a pig.

The compositions of this invention contain an effective immunizing amount of one or more immunogenic compositions or antibodies thereto, and a physiologically acceptable carrier. Vaccines contain an effective immunizing amount of one or more immunogenic compositions and a physiologically acceptable carrier. The composition must correspond to the route of administration.

The immunogenic composition, if desired, may also contain small amounts of wetting or emulsifying agents or pH buffering agents. The immunogenic composition may be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. Oral formulations may include standard carriers such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like.

E. Effective dose.

The compounds described herein may be administered to a subject at therapeutically effective doses for the treatment of SVA-associated diseases. The dose will depend on the host receiving the vaccine, as well as factors such as the size, weight, and age of the host.

The exact amount of an immunogenic conjugate or antibody of this invention to be used in a formulation will depend on the route of administration and the nature of the subject (e.g., species, age, size, stage/morbidity), and should be determined according to the judgment of the practitioner and the circumstances of each individual. subject in accordance with standard clinical methods. An effective immunizing amount is an amount sufficient to treat or prevent an SVA infectious disease in a subject. An example of a suitable dose is about 6 to 7 log TSH50/ml. Alternatively, effective doses can also be extrapolated from dose-response curves obtained from model animal assays and can range from 0.001 to 100 mg/kg.

The toxicity and therapeutic efficacy of the compounds can be determined using standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine the LD ₅₀ (lethal dose in 50% of the population) and ED ₅₀ (therapeutically effective dose in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, and it can be expressed as the ratio LD ₅₀ /ED ₅₀ . Compounds that exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design delivery systems that target such compounds to the affected tissue site to minimize the potential for damage to uninfected cells and thereby reduce side effects. .

Data obtained from cell culture assays and animal studies can be used in determining the dosage range for use in animals, especially pigs. The dosage of such compounds is preferably within a range of circulating concentrations that include an ED ₅₀ with little or no toxicity. The dosage may vary within this range depending on the dosage form used and the route of administration. For any compound used in the methods of this invention, a therapeutically effective dose can be initially estimated from cell culture assays. The dose can be formulated in animal models to achieve a range of circulating plasma concentrations that includes the IC ₅₀ (ie the concentration of test compound that achieves half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine doses in subjects. Plasma levels can be measured, for example, using high performance liquid chromatography.

The immunogenicity of a composition can be determined by monitoring the immune response of subjects after immunization with the composition using any immunoassay known in the art. The generation of a humoral (antibody) response and/or cell-mediated immunity can be taken as an indicator of an immune response. Test subjects may include animals such as pigs, mice, hamsters, dogs, cats, rabbits, cows, horses, sheep, birds (eg chickens, ducks, geese and turkeys).

The immune response of test subjects can be analyzed using various approaches, such as: the reactivity of the resulting immune sera to the immunogenic conjugate, as analyzed using known methods, such as enzyme-linked immunosorbent assay (ELISA), immunoblotting, immunoprecipitation, etc.; or by protecting immunized hosts from pathogen infection and/or ameliorating symptoms due to pathogen infection in immunized hosts, as determined by any method known in the art, to quantify infectious disease agent levels, e.g., bacterial levels (e.g., by culturing sample from the subject), or by other method known in the art. Infectious disease agent levels can also be determined by measuring antigen levels against which

- 15 041112 immunoglobulin was sent to him. Reducing levels of an infectious disease agent or ameliorating the symptoms of an infectious disease indicates that the composition is effective.

Therapeutic agents of this invention may be tested in vitro for the desired therapeutic or prophylactic activity prior to in vivo use in animals or humans. For example, in vitro assays that can be used to determine administration of a particular therapeutic agent include in vitro cell culture assays in which appropriate cells from a cell line or cultured cells from a subject having a particular disease or disorder are exposed to or administered with a therapeutic agent. , and the effect of the therapeutic agent on the cells is observed.

Alternatively, the therapeutic agent can be tested by contacting the therapeutic agent with cells (either cultured from the subject or from a cultured cell line) that are susceptible to infection by the infectious disease agent, but that are not infected by the infectious disease agent, exposing the cell to the infectious disease agent. and then determining whether the infection rate of cells that have been in contact with the therapeutic agent is lower than the infection rate of cells that have not been in contact with the therapeutic agent. Infection of cells with an infectious disease agent can be analyzed using any method known in the art.

In addition, a therapeutic agent can be assessed by measuring the level of the molecule against which the antibody is directed in an animal or human model at appropriate time intervals before, during, or after therapy. Any change or lack of change in the amount of the molecule can be identified and correlated with the effect of the treatment in the subject. The level of the molecule can be determined by any method known in the art.

After an animal is vaccinated with an SVA infection using the methods and compositions of the present invention, any binding assay known in the art can be used to evaluate the binding between the resulting antibody and a particular molecule. These assays can also be performed to select for antibodies that exhibit higher affinity or specificity for a particular antigen.

G. Methods of detection and diagnostics.

Antibodies or their binding regions resulting from the use of the SVA peptides of the present invention can be used to detect the presence of SVA virus in a sample. This detection method comprises the following steps: providing an isolated antibody or its binding region generated to the SVA peptide of the invention, adding to the isolated antibody or its binding region a sample suspected of containing an amount of SVA, and detecting the presence of the complex, including binding the isolated antibody or its binding areas with SVA.

The antibodies or binding regions thereof of the present invention can also be used to detect the presence of an SVA peptide in a sample. This detection method comprises the following steps: providing an isolated antibody or its binding region generated to an SVA peptide, adding to the isolated antibody or its binding region a sample suspected of containing an amount of SVA peptide, and detecting the presence of a complex, including binding the isolated antibody or its binding region to SVA peptide.

Immunoglobulins, in particular antibodies (and their functionally active fragments), which bind to a particular molecule that is a member of the binding pair, can be used as a diagnosis and prognosis, as described in this document. In various embodiments, the present invention provides for the measurement of a member of a binding pair and the use of such measurements in clinical practice. The immunoglobulins of the present invention can be used, for example, in the detection of an antigen in a biological sample, wherein subjects can be tested for aberrant levels of the molecule to which the immunoglobulin binds and/or for the presence of abnormal forms of such molecules. By abnormal level is meant an increase or decrease in relation to the present, or a standard level representing the present, in a similar sample from a body part or from a subject without disease. The antibodies of this invention may also be included as a kit reagent for diagnostic and prognostic use.

In one aspect, an antibody of the invention that immunospecifically binds to an SVA peptide can be used to diagnose, predict, or screen for SVA infection.

In another aspect, the present invention relates to a method for diagnosing or screening for the presence of SVA infection or immunity to it, comprising measuring in a subject the level of immunospecific binding of an antibody to a sample obtained from a subject, in which the antibody immunospecifically binds to an SVA peptide, in which an increase in the level of said immunospecific binding relative to the level of said immunospecific binding in a similar sample from a subject without an infectious disease agent indicates the presence of SVA.

- 16 041112

Examples of suitable assays for detecting the presence of SVA peptides or their antagonists include, but are not limited to, solid phase ELISA, radioimmunoassay, diffuse gel precipitation assay, immunodiffusion assay, agglutination assay, fluorescent enzyme immunoassay, protein A immunoassay, or immunoelectrophoretic assay.

Molecule-specific immunoassays typically involve incubating a sample, such as a body fluid, tissue extract, freshly harvested cells, or cultured cell lysates, in the presence of a detectable labeled antibody and detecting the bound antibody by any of the methods well known in the art.

The binding activity of a given antibody can be determined according to well known methods. One skilled in the art will be able to determine the operating and optimal assay conditions for each determination using routine experimentation.

A further aspect of the present invention relates to diagnostic kits for detecting or measuring SVA. Kits are provided for diagnostic use that contain an anti-SVA peptibody in one or more containers, and optionally a labeled antibody binding partner. Alternatively, the anti-SVA peptibody may be labeled (with a detectable marker, such as a chemiluminescent, enzymatic, fluorescent, or radioactive moiety). Accordingly, the present invention provides a diagnostic kit comprising an anti-SVA peptibody and a control immunoglobulin. In a specific embodiment, one of the above container connections may be labeled with a detectable label. The kit may further contain in the container a predetermined amount of SVA peptide that is recognized by the antibody of the kit, for use as a standard or control.

Preferred routes of administration include, but are not limited to, oral, intranasal, intradermal, and intramuscular. Administration by intramuscular route, most preferably as a single dose, is desirable. The person skilled in the art will understand that the compositions of the present invention can also be administered in one, two or more doses, as well as by other routes of administration. For example, such other routes of administration include subcutaneous, intradermal, intravenous, intravascular, intraarterial, intraperitoneal, intrathecal, intratracheal, intradermal, intracardiac, intralobal, intramedullary, intrapulmonary, and intravaginal. Depending on the desired duration and effectiveness of the treatment, the compositions according to the invention may be administered one or more times, also intermittently, for example on a daily basis for several days, weeks or months, and in different dosages.

The following examples are included to demonstrate preferred embodiments of the present invention. It will be appreciated by those skilled in the art that the methods described in the examples are methods discovered by the inventors that also function in the practice of the present invention, and thus may be considered the preferred methods of practice. However, those skilled in the art will appreciate, in light of the present disclosure, that many changes can be made to the specific embodiments that are disclosed and still result in a similar or analogous result without departing from the spirit and scope. of the present invention.

Sequence listing.

This application contains a sequence listing. The sequence listing contains the following sequences:

SEQ ID NO: 1 denotes the RNA sequence of a substantially complete genome of the SVA strain of the present invention.

SEQ ID NO: 2 denotes a subset of the genomic RNA sequence that encodes a viral polyprotein (antigen; SEQ ID NO: 3).

SEQ ID NO: 3 denotes a subset of the genomic RNA sequence that encodes a viral polyprotein (antigen of SEQ ID NO: 2.

SEQ ID NO: 4 indicates GenBank KX377924.

SEQ ID NO: 5 indicates GenBank KT321458.

SEQ ID NO: 6 indicates GenBank KR063107.

SEQ ID NO: 7 indicates GenBank KR063108.

SEQ ID NO: 8 indicates GenBank KR063109.

SEQ ID NO: 9 indicates GenBank HJ999048.

SEQ ID NO: 10 indicates GenBank KC667560.

SEQ ID NO: 11 indicates GenBank GY488390.

SEQ ID NO: 12 indicates GenBank GV614995.

SEQ ID NO: 13 indicates GenBank DM060849.

SEQ ID NO: 14 indicates GenBank NC 011349.

SEQ ID NO: 15 indicates GenBank GY488390 CDS.

- 17 041112

SEQ ID NO: 16 denotes GenBank GV614995 CDS.

SEQ ID NO: 17 denotes GenBank DM060849 CDS.

SEQ ID NO: 18 denotes the nucleotide sequence of the SVVP13C insert in the BaculoFBU/SVVP13C construct (A).

SEQ ID NO: 19 denotes the amino acid sequence of the SVVP13C polyprotein expressed by BaculoFBU/SVVP13C.

SEQ ID NO: 20 denotes the nucleotide sequence of the SVVP13C insert in the BaculoFBU/SVVP13C-CO construct, wherein the SVV P1 region is codon-optimized for expression in insect cells (B).

SEQ ID NO: 21 denotes the amino acid sequence of the SVVP13C polyprotein expressed by BaculoFBU/SVVP13C-CO.

SEQ ID NO: 22 denotes BaculoFBU/VVP13C VP3/VP1.

SEQ ID NO: 23 denotes the nucleic acid sequence of the SVVP13C VP3/VP1 insert in the BaculoFBU/SVVP13C VP3/VP1 construct.

SEQ ID NO: 24 denotes the nucleic acid sequence of the SVVP13CD insert of the BaculoFBU/SVVP13CD construct.

SEQ ID NO: 25 denotes the amino acid sequence of the SVVP13CD polyprotein expressed by BaculoFBU/SVVP13CD.

SEQ ID NO: 26 denotes the nucleic acid sequence of the PCR product containing the sequence encoding SVVP1-His.

SEQ ID NO: 27 denotes the amino acid sequence of SVVP1-His expressed by the BaculoG/SVVP1-His-sIRES-SVV3C construct.

SEQ ID NO: 28 denotes the nucleic acid sequence of a PCR product containing a sequence encoding SVVP1-His codon-optimized for expression in insect cells (SVVP1CO-His).

SEQ ID NO: 29 denotes the amino acid sequence of SVVP1-His expressed by the BaculoG/SVVP1CO-His-sIRES-SVV3C construct.

SEQ ID NO: 30 denotes the nucleic acid sequence of the PCR product containing the sequence encoding SVV3C.

SEQ ID NO: 31 denotes the amino acid sequence of SVV3C expressed by the BaculoG/SVVP1-His-sIRES-SVV3C and BaculoG/SVVP1CO-His-sIRES-SVV3C constructs.

SEQ ID NO: 32 denotes the nucleic acid sequence of the SVVP1His-Sires-SVV3C expression cassette in pORB-SVVP1-His-sIRES-SVV3C.

SEQ ID NO: 33 denotes the nucleic acid sequence of the SVVP1CO-His-sIRES-SVV3C expression cassette in pORB-SVVP1CO-His-sIRES-SVV3C.

SEQ ID NO: 34 denotes PCR primer P3219012A (SVVP1 forward).

SEQ ID NO: 35 denotes PCR primer P3219039A (SVVP1 His reverse).

SEQ ID NO: 36 denotes PCR primer P3219012C (SVVP1-CO direct).

SEQ ID NO: 37 denotes PCR primer P3219039B (SVVP1-CO His reverse).

SEQ ID NO: 38 denotes PCR primer P3219012E (SVV3C forward).

SEQ ID NO: 39 denotes PCR primer P3219039C (SVV3C reverse).

SEQ ID NO: 40 denotes PCR primer P3219165A (VP3/VP1 forward).

SEQ ID NO: 41 denotes PCR primer P3219165B (VP3/VP1 reverse).

SEQ ID NO: 42 denotes PCR primer P3219166A (SVV3D forward).

SEQ ID NO: 43 denotes PCR primer P3219166B (SVV3C reverse).

SEQ ID NO: 44 denotes PCR primer P3219166C (SVV3D reverse).

SEQ ID NO: 45 indicates the sequence encoding SVV3D. The invention further includes the following items.

1) A method of eliciting an immune response in a mammal, comprising administering an immunologically effective amount of a killed Seneca Valley Virus A (SVA), comprising:

(a) a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or (b) a nucleic acid sequence 97% identical to SEQ ID NO: 1 that encodes a polypeptide having the immunologically effective activity of the polypeptide of SEQ ID NO: 3.

2) A method for eliciting an immune response in a mammal, comprising administering an immunologically effective amount of killed SVA, comprising:

(a) the amino acid sequence of SEQ ID NO: 3;

(b) an amino acid sequence 80% identical to SEQ ID NO: 3 and having a biologically or immunologically effective activity of the polypeptide encoded by SEQ ID NO: 3; or (c) a fragment of the amino acid sequence of SEQ ID NO: 3 containing at least 15 contiguous amino acids of SEQ ID NO: 3 and having an immunologically effective activity.

3) A method for eliciting an immune response in a mammal, comprising administering an immunologically effective amount of killed SVA, comprising:

- 18 041112 (a) the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2; or (b) a nucleic acid sequence 97% identical to SEQ ID NO: 1 or SEQ ID NO: 2 that encodes a polypeptide having the immunologically effective activity of the polypeptide of SEQ ID NO: 3.

4) A method of eliciting an immune response in a mammal, comprising administering an immunologically effective amount of the immunogenic compositions of claim 1.

5) A method of eliciting an immune response in a mammal, comprising administering an immunologically effective amount of the immunogenic compositions of claim 2.

6) A method of eliciting an immune response in a mammal, comprising administering an immunologically effective amount of an immunogenic composition according to claim 3.

7) The method of claim 1, wherein the mammal is a pig and the immune response provides protective immunity to the disease caused by SVA infection.

8) The method of claim 2, wherein the mammal is a pig and the immune response provides protective immunity to the disease caused by SVA infection.

9) The method of claim 3, wherein the mammal is a pig and the immune response provides protective immunity to the disease caused by SVA infection.

10) A vaccine containing one or more Senecavirus A (SVA) antigens, wherein SVA is any SVA containing:

(a) a nucleic acid encoded by SEQ ID NO: 1 and/or contains the sequence of SEQ ID NO: 1 and/or contains an RNA equivalent of SEQ ID NO: 1;

(b) a nucleic acid that is at least 99% identical to the sequence of SEQ ID NO: 1 and/or at least 99% identical to the RNA equivalent of SEQ ID NO: 1;

(c) a polypeptide that is encoded by a polynucleotide containing the sequence of SEQ ID NO: 1 or 2;

(d) a polypeptide that is encoded by a polynucleotide that is at least 80% homologous or identical to polynucleotides a);

(e) a protein fragment that is encoded by a polynucleotide that contains at least 15, preferably 24, more preferably 30, most preferably 45 contiguous nucleotides included in the sequence of SEQ ID NO: 1 or SEQ ID NO: 2;

(e) a polypeptide containing the amino acid sequence of SEQ ID NO: 3;

(g) a polypeptide that is at least 80% homologous and/or identical to polypeptide e);

(h) fragment of polypeptides f) and/or g);

(i) polypeptide e) or g); or (j) fragment h) or i) containing at least 5, preferably 8, more preferably 10, most preferably 15 contiguous amino acids included in the sequence of SEQ ID NO: 3.

11) The vaccine according to claim 10, wherein the vaccine is a recombinant vaccine or a killed vaccine.

12) The vaccine according to claim 10, wherein the vaccine is a killed vaccine.

13) The vaccine according to claim 10, wherein Senecavirus A (SVA) is chemically inactivated.

14) The vaccine of claim 13, wherein Senecavirus A (SVA) is chemically inactivated by treatment with a chemical inactivating agent that includes a compound selected from the group consisting of ethyleneimine, binary ethyleneimine, acetylethyleneimine, and mixtures thereof.

15) The vaccine according to claim 14, wherein Senecavirus A (SVA) is chemically inactivated by binary ethyleneimine treatment.

16) The vaccine according to claim 10, wherein the vaccine further comprises an adjuvant.

17) The vaccine according to claim 16, wherein the adjuvant is an EMULSIGEN® oil-in-water emulsion adjuvant.

18) The vaccine according to claim 6, characterized in that Senecavirus A (SVA) contains SEQ ID NO: 1 and/or contains an RNA equivalent of SEQ ID NO: 1.

19) The vaccine according to claim 11, wherein the vaccine is a recombinant vaccine.

20) The vaccine according to claim 11, characterized in that such a recombinant vaccine contains one or more immunogenic components selected from the group consisting of:

(a) an isolated nucleic acid encoding a Senecavirus A (SVA) antigen, wherein the recombinant polypeptide shares at least 90% homology with SEQ ID NO: 3;

(b) a vector containing the isolated nucleic acid a);

(c) a recombinant protein encoded by nucleic acid a); and (d) any combination thereof.

21) A vaccine according to claim 20, wherein such vaccine contains a pharmaceutically acceptable carrier and/or excipient.

- 19 041112

22) The vaccine according to claim 21, characterized in that the excipient is one or more adjuvants.

23) The vaccine according to claim 22, wherein the adjuvant is an EMULSIGEN® oil-in-water emulsion adjuvant.

24) The vaccine of claim 20, wherein the vaccine further comprises one or more additional antigens.

25) The vaccine of claim 20, wherein the immunogenic component is an isolated nucleic acid.

26) The vaccine of claim 20, wherein the immunogenic component is a vector.

27) The vaccine according to claim 11, wherein the immunogenic component is a recombinant Senecavirus A (SVA) P1 protein.

28) The vaccine of claim 20, wherein the immunogenic component is a combination.

Examples

Example 1.

This study used normal animals to determine the preliminary possibility of inducing a serological response after vaccine administration. The main objective of this study was to evaluate whether inactivated whole virus preparations using Senecavirus A (SVA) exhibit (SEQ ID NO: 1 or SEQ ID NO: 2, and/or a nucleic acid sequence 97% identical to SEQ ID NO: : 1, which encodes a polypeptide having immunologically effective activity of the polypeptide of SEQ ID NO: 3) seroconversion in normal pigs to the SVA vaccine.

For virus isolation, 0.5 ml of the vesicular fluid is filtered through a 0.2/0.8 μm filter syringe (Pall Acrodisc Cat 4658) and the filtrate is used to inoculate porcine testis cells (ST cells). ST cells are grown in 6-well plates with 80-100% confluency. The medium is aspirated and 0.25 ml of the filtrate is inoculated into the cells. After an hour of adsorption at 37°C, a simple serum-free medium is added to the cells. Plates were incubated at 37° C. under 5% CO2 and checked daily for cytopathic effects (CPE). CPE was usually completed in 24-28 hours. The harvested virus was passaged several times and used to obtain series.

Virus concentrate was obtained by inoculating flasks seeded with AI-ST cells with 5 ml of virus concentrate and 160 ml of medium (minimum culture medium+2.5% HEPES). The flasks were incubated for approximately 48 hours. The flasks were frozen and then thawed at room temperature. The material was filtered through 0.2 µm. The virus harvest was inactivated with a combination of 10 mM BEI and 0.2% formaldehyde with constant stirring at 37°C for 72 hours. The inactivation was neutralized with sodium thiosulfate (17% by volume of BEI was added) and sodium bisulfite. Inactivation was confirmed by two passages of the material into AI-ST cells. For the initial passage, 10 ml of inactivated material was inoculated into a T75 flask with AI-ST cells. The flasks were incubated for seven days at 37°C+5% CO2 and periodically evaluated for cytopathic effect. For the second passage, the flasks were frozen and then thawed. The material was centrifuged and 10 ml of the supernatant was inoculated into a T75 flask with AI-ST cells. Flasks were incubated for seven days at 37°C+5% CO ₂ and periodically evaluated for the presence of cytopathic effect. Positive and negative controls were included in the analysis. The results confirmed the absence of growth in both batches. The inactivated viral harvest was concentrated to 12.4x at 10k by ultrafiltration through a 650cm ² hollow fiber cartridge. The concentrated series was combined with EMULSIGEN® D (commercially available from Phibro Animal Health Corporation) to give a 12.5% formulation. The mixture was stirred for 30 minutes at room temperature and then aseptically dispensed into 30 ml vaccine vials and stored at 4°C. The material was tested for bacterial sterility by routine cultivation (anaerobic and aerobic) on blood agar plates at 37° C. for 48 hours. No bacterial contamination was detected.

Twenty pigs were randomized into two groups as shown in Table 1. 1. In the table. 1 below are group descriptions and placement structure. On day 0, pigs were injected intramuscularly with a 2 ml dose of SVA vaccine or placebo. On day 21, animals received a challenge vaccine SVA or placebo. Blood was collected from all pre-treatment pigs at each vaccination (day 0 and day 21) and on day 35. A subset of serum samples were analyzed for SVA seroconversion. General health observations were recorded throughout the study. The injection sites were observed for reactions for at least three days after the administration of the vaccine. Animals were humanely sacrificed at the end of the test.

- 20 041112

Table 1. Design of the study

Group room Number (p) Vaccination Dose/method 1 114 eleven Inactivated SVA prototype vaccine (Senecavirus A; x+10; filtered through 0.2 µm; inactivation titers (two batches pooled) = 6.95/6.51 log TCI50/mL; inactivate YumM BEI + 0.2% formaldehyde; neutralized with sodium bisulfite and sodium thiosulfate; concentrate 12.4X (hollow fiber 10 kDa); added as adjuvant 12.5% EMULSIGEN®D) 2 ml/in/m 2 114 7 Placebo (IxPBS (Gibco, catalog #10010-023, L#1793111) adjuvanted with 12.5% EMULSIGEN®D) 2 ml/in/m 219 2

This study showed 100% seroconversion (as measured by virus neutralization) to SVA following two doses of a BEI-inactivated SVA prototype adjuvanted with 12.5% EMULSIGEN® D. 2 is a timeline of key events and sampling.

Table 2. Timeline of key events and sampling

Research Day Research Event Day 3 Animal blood sampling Day 1 Transfer of animals from the study Day 0 - Vaccination #1 - Observations of the injection site for three days after vaccination - Animal blood sampling Day 14 - Animal blood sampling Day 21 - Vaccination #2 - Animal blood sampling - Observation of the injection site for three days after vaccination* Day 0 - Day 34 General health monitoring (1 time per day) Day 34 - Autopsy - Terminal blood sampling (1 x 250 ml vial) from all animals

*It should be noted that observations continued until the reactions were eliminated.

To avoid bias, treatment was administered on day 0 and day 21 by non-clinical animal monitoring personnel. On day 0, healthy pigs were injected with a 2 ml dose of vaccine into the neck muscles on the right side using a sterile needle and an appropriately sized syringe. On day 21, the process was identical except that the injection was given to the left side of the neck. Lot number, dosage size, animal identification numbers, and time of administration of vaccine material were recorded in the Vaccine Dose Confirmation Record.

During the vaccination period, animals were assessed daily using a general health monitoring form. In particular, if all animals were normal, N was administered to balance. In case an abnormal pig was found, A was entered for balance and given the identification number of the specific animal and the abnormality. The injection sites were checked for redness, swelling, warmth and pain (either present or absent) and size (cm) for at least three days after each vaccination. If lesions were visible, they were observed until they ceased.

On blood collection dates, the investigator or authorized representative collected three to eight ml of venous whole blood via the anterior vena cava from each pig using an appropriately sized VACUTAINER® needle, a VACUTAINER® needle holder (both commercially available from Becton Dickinson and Company), and separation tubes. serum (SST) of appropriate size.

Serum samples were kept at 2-8°C until testing. Processing was completed 48 hours after receipt. Tubes with blood were centrifuged at 1960xg for 10 min at 4°C. Serum was separated from the clot by centrifugation and decantation into two screw cap cryogenic vials labeled with at least study number, study day, and animal ID. Aliquots were stored at -70±10°C. Samples were stored for at least six months after completion of this study.

Selected sera were tested by virus neutralization assay using isolate SVA NAC # 20150909.

At the time of completion of the test, the animals were placed under deep anesthesia and a 1x250 ml centrifuge flask was taken from each animal's blood. The animal was sacrificed and the site of injection of palpir

-21 041112 li. All animals were provided in accordance with AUP and laboratory standard operating procedures.

The pig was considered the experimental unit. A list of available pigs born to sow numbers 9, 116, 787 and 895 (n=30) and from sow numbers 141 and 145 (n=6) was used for randomization. In particular, the pigs were assigned a random number (using random.org). Pigs were sorted into sows and then randomized. Specimens were assigned a random number (using random.org). The individuals were then sorted by random number and combined with a list of animals.

Statistical analyzes and data summaries were carried out by the study supervisor. All data was imported into JMP® version 11.1.1 for analysis. Data lists and summary statistics by vaccination group were obtained.

An in-house developed virus neutralizing assay was used to measure seroconversion in animals after vaccination. None of the animals had a detectable serological response prior to vaccination. By day 35, all vaccinated animals (Group 1) had a detectable response. The analysis was performed at a dilution of 1:80 and animals were considered positive or negative. In table. 3 below is a summary of the VN SVA results.

Table 3. VN SVA results by group and study day

Research Day

Group Description Day 0 Day 35 1 Prototype vaccine for inactivated SVA 0/11 11/11 2 placebo 0/9 0/9

The main purpose of this study was to evaluate whether conventional pigs seroconvert to SVA after vaccination with SVA vaccine.

With respect to the SVA vaccine, 100% of the pigs vaccinated with the prototype vaccine with inactivated SVA were able to generate an immune response with neutralizing antibodies. In conclusion, this study was able to demonstrate a reasonable expectation of efficacy for the inactivated SVA prototype vaccine.

Example 2

The two gene sequences were inserted into the pUCIDT-Amp vector (Integrated DNA Technologies). The SVVP13C gene (SEQ ID NO: 18) is a native sequence of a full-length P1 polyprotein with sequence 2A and partial sequences 2B and 3B linking the P1 polyprotein and the self-cleaving 3C protease. The SVVP13C-CO gene (SEQ ID NO: 20) is an optimized version of the insect codon SVVP13C with the P1, 2A and 2B sequences codon-optimized using the IDT codon optimization tool while 3B and 3C remained native sequences. Both genes have a Kozak sequence before the start codon, as well as BamHI and NotI restriction sites at the 5' and 3' ends, respectively. Inserts SVVP13C (SEQ ID NO: 18) and SVVP13C-CO (SEQ ID NO: 20) were excised from the midpoints of pUCIDT-AMP-SVVP13C and pUCIDT-AMP-SVVP13C-CO plasmids with BamHI and NotI digestion, respectively, and ligated into the vector pVL1393 (BD Biosciences). In FIG. 1 shows the construct diagram for the native and codon-optimized pVL1393 construct.

PCR amplification was performed to amplify the SVVP1-His (SEQ ID NO: 26) and SVVP1CO-His (SEQ ID NO: 27) sequences from pIDT-AMP-SVVP13C and pIDT-AMP-SVVP13C-CO, respectively, using primers that the coding sequence for the 6XHis tag is added at the 3' end of each gene (SEQ ID NOS: 34, 35, 36 and 37). The SVV3C sequence (SEQ ID NO: 30) was amplified from pIDT-AMP-SVVP13C using primers to add a SpeI 5' site and a SacI 3' site (SEQ ID NO: 38 and 39). (See primers in Table 4).

Table 4. Primer sequences for SVVP1-His-SVV3C and SVVP1CO-His-SVV3C

primer Sequence (5' - 3') SEQID NO: Р3219012А (SVVP1 Direct) GGATCCGCCACCATGGGTAATGTTCA 34 P3219039A (SVVP1 His Reverse) GCGGCCGCTCAGTGGTGGTGGTGGTGGTGTTGCATCAGC ATCTTTTGCTTGTAGCTGC 35 Р3219012С (SVVP1-CO Direct) GGATCCGCCACCATGGGCAACG 36 P3219039B (SVVP1-CO His Reverse) GCGGCCGCTCAGTGGTGGTGGTGGTGGTGTTGCATAAGC ATCTTCTGTTTATAGCTACGG 37 R3219012E (SVV3C Straight) ACTAGTATGCAGCCCAACGTGGACATGGGCTTT 38 Р3219039С (SVV3C Reverse) GAGCTCTCATTGCATTGTAGCCAGAGGCTCACCGA 39

- 22 041112

Table 5. Primer sequences for SVVP13C VP3/VP1 and SVVP13CD

primer Sequence(5' - 3') SEQID NO: P3219165A (VP3/VP1 Straight) CTTCCTACGTGCCTCAGGGGGTTGACAACGCCGAGACTGGG 40 P3219165B (VP3/VP1 Reverse) CCAGTCTCGGCGTTGTCAACCCCCTGAGGCACGTAGGAAG 41 Р3219166А (SVV3D Straight) TACAATGCAAGGACTGATGACTGAGCTAGAGCCTG 42 Р3219166В (SVV3C Reverse) TCAGTCATCAGTCCTTGCATTGTAGCCAGAG 43 Р3219166С (SVV3D Reverse) GCGGCCGCTCAGTCGAACAAGGCCCTCCATCT 44

The SVV3C insert (SEQ ID NO: 30) was ligated into the second multiple cloning site (MCS2) of the Porb-MCS1-Sires-MCS2 vector (Allele Biotechnology) using the SpeI and SacI restriction sites. Next, either SVVP1-His or SVVP1CO-His was ligated into MCS1 Porb-MCS1-Sires-SVV3C using BamHI and NotI restriction sites to give Porb-SVVP1-His-Sires-SVV3C (SEQ ID NO: 32) and pORB-SVVP1CO -His-Sires-SVV3C (SEQ ID NO: 33), respectively.

The primers were designed to mutate the VP3/VP1 cleavage site (nucleotides 17861797) of the SVVP13C sequence (SEQ ID NO: 18) in pUCIDT-AMP-SVVP13C from FH/ST to PQ/GV (Table 5 above shows the primers, SEQ ID NO: : 40 and 41) using the Lightning Quik site-directed mutagenesis kit (Stratagene). The mutated SVVP13C VP3/VP1 sequence (SEQ ID NO: 22) was excised from pUCIDT-AMP-SVVP13C VP3/VP1 and ligated into the pVL1393 vector to generate pVL1393-SVVP13C VP3/VP1. An additional construct was fused from the SVV3D coding sequence (SEQ ID NO: 45) to the 3' end of the SVVP13C sequence (SEQ ID NO: 18) by overlapping primer-PCR (OE-PCR) using overlapping primer sets (SEQ ID NO: 34, 42, 43 and 44). The resulting PCR product, SVVP13CD (SEQ ID NO: 24) was cloned into pVL1393 using BamHI and NotI restriction sites. (Figure 3 shows diagrams of constructs SVVP13C VP3/VP1 (SEQ ID NO: 22) and SVVP13CD (SEQ ID NO: 24)).

Recombinant SVV capsid constructs in pVL1393-based plasmids were co-transfected with baculovirus DNA (Oxford Expression Technologies) FlashBAC ULTRA (FBU) into Sf9 cells, while pORB-based plasmids were co-transfected with BaculoGold baculovirus DNA (BD Biosciences) into Sf9 insect cells using the ESCORT transfection reagent (Sigma Aldrich) according to the manufacturer's instructions. Cell culture supernatants from transfected Sf9 cells were harvested and purified by centrifugation at 1000xg for 5 min to pellet cell debris. The purified supernatant was collected, filtered through 0.2 μM and stored as a P1 transfection harvest. Sf9 insect cells were used to create P2 concentrates, and P2 concentrates were then used to generate amplifications of SVV P3 and P4 constructs to determine protein expression in SF+ insect cells. Baculovirus-infected SF+ cells were harvested and purified at 10,000xg for 10 min at 4°C. Cultures of baculovirus-infected SF+ cells were sampled daily to monitor total cells/mL, viable cells/mL, percent cell viability, and cell diameter by Vi-Cell assay. Amplifications were collected when the viability was <30% viability or when the number of viable cells was <1x10 ⁶ cells/ml. An additional one ml daily samples were taken to assess protein expression as infections progressed and were processed as described above. The collected supernatant and cell pellet samples were stored at -70° C. until determination.

Lysis of insect cell sediments to separate soluble and insoluble fractions.

The SF+ insect cell culture samples were centrifuged to pellet the cells, after which the medium was removed and the cell pellets were frozen until lysis. The pellets were resuspended in lysis buffer containing the following: 20 mM Tris, 1% Triton X-100, mixture of protease inhibitors for His-tagged proteins (10 μl/ml) and benzonase (250 units/ml) in deionized water pH 7 ,4. The resuspended insect cell lysates were vortexed for 10 s, incubated at room temperature for 5 min, vortexed again for 10 s, then centrifuged at 19090xg for 10 min at 4°C to precipitate insoluble material. Soluble lysates were aspirated with a pipette from insoluble fractions and stored in test tubes at -70°C.

Purification of recombinant SVV capsid proteins.

Harvests of supernatants containing expressed recombinant SVV capsid proteins were filtered through 0.2 μm, dispensed into ultracentrifuge tubes and centrifuged at 100,000xg for two hours at 4°C to precipitate protein and possible VLPs. Purified supernatant carefully

- 23 041112 was decanted and the precipitated material was resuspended in TBS and stored at 4°C. Stepwise 10-60% sucrose gradients were used to further purify the recombinant SVV capsid proteins for the respective constructs. Appropriate resuspended materials were added to the top of the gradient and centrifuged at 100,000xg for two hours at 4°C. Fractions from the sucrose gradients were collected in equal parts in tubes (with fraction 1 starting from the top of the gradient surface) and stored at 4°C.

DNS-PAGE and Western blotting.

DNS-PAGE was performed using the NuPAGE electrophoresis system and 4-12% Bis-Tris MES mini gels. Samples were separated under reducing conditions using 0.05 M DTT at 175 V for the appropriate time. Gels were stained for total protein using an eStain 2.0 protein stainer or transferred to nitrocellulose membranes using an iBlot Western blotting system. Western blotting was performed with polyclonal rabbit antibodies to the SVV peptide (anti-VP1-2, anti-VP2-2 and anti-VP3-1, in various dilutions) and goat anti-rabbit peroxidase labeled secondary antibodies (1:500) using a detection system Snap ID protein (EMD Millipore) using baculovirus antigen as negative control in diluted antibody solution and detected using TMB membrane peroxidase substrate.

Dialysis and concentration of purified recombinant SVV capsid proteins.

Sucrose gradient fractions containing the recombinant protein, as determined by Western blotting, were pooled together and dispensed into cellulose membrane dialysis cassettes at 10,000 MWCO or 50,000 MWCO. The dialysis cassette was placed in 3.5 L TBS with magnetic stirrer, covered, and placed on the stirrer at 4° C. for at least 6 hours. The dialysis cassette is then placed in a fresh beaker with 3.5 L of TBS and then subjected to dialysis with stirring overnight or longer. The sample was removed from the dialysis cassette and concentrated, if necessary, depending on the volume of the dialyzed sample. Concentration was carried out using a gel filtration and centrifugation unit according to the manufacturer's instructions until the desired sample volume was reached.

Electron microscopy (EM).

Sucrose gradient purified and dialyzed recombinant SVV capsid protein samples were evaluated by transmission electron microscopy (EM) at the USDA NADC facility for VLP imaging. The expected size of the icosahedral viral capsid for native SVV was approximately 27 nm in diameter.

Results and discussion.

Native SVV P1 polyprotein (SEQ ID NO: 19, amino acids 1-859) was treated with a self-cleaving protease to form single subunits of the VP1-VP4 viral capsid proteins. The SVV baculovirus constructs described herein were designed in the same manner as used for the FMDV baculovirus constructs using self-cleavage of an expressed polyprotein into individual protein subunits to form an empty capsid or VLP. Constructs encoding full-length SVV P1 polyprotein, 2A, partials 2B and 3B, and 3C (SEQ ID NO: 18) were prepared with native coding sequence or with codon-optimized sequences P1, 2A and 2B (SEQ ID NO: 20) for insect cells . Previous studies with similar FMDV baculovirus pVL1393 constructs have shown toxicity to SF+ cells attributable to 3C expression. Concerns about the potential toxicity of 3C SVV have also led to pORB-based baculovirus constructs for detection. The pORB-based constructs use an internal ribosome binding site (WSSV sIRES) (SEQ ID NO: 32, nucleic acids 2647-2826), which allows initiation of a cap-independent mRNA translation that differs from the 5'-cap-dependent translation of the sequence closest to 3' end of the polyhedrin promoter. Several studies have shown that the use of sIRES, for example from WSSV, often results in a decrease in protein expression of the translated sequence downstream of the sIRES. In the context of the described SVV baculovirus constructs (SEQ ID NOs: 32 and 33), the use of sIRES can result in downregulation of SVV's self-cleaving 3C protease, which in turn can alleviate 3C toxicity problems without downregulation of SVVP1 expression. The pORB and pVL1393 based constructs were similar in that they both use the same SVVP1 sequence and include a 6x-His C-terminal tag. However, the main difference between the pORB-based constructs and pVL1393 is that in the pORB-based constructs, the SVV3C protease sequence is located after the sIRES site. After these initial sets of constructs were identified, two more constructs were generated by modifying the original SVV DNA sequence. One construct modified the VP3/VP1 cleavage site sequence (SEQ ID NO: 22) and the other construct further included an SVV3D DNA sequence at the end of the SVV3C sequence (SEQ ID NO: 24). All constructs were evaluated for capsid subunit expression as well as VLP production.

- 24 041112

Expression of SVV capsid proteins in baculovirus-infected insect cells.

The BaculoFBU/SVVP13C (SEQ ID NO: 18) and BaculoFBU/SVVP13C-CO (SEQ ID NO: 20) constructs were used to infect SF+ cells with samples collected to evaluate the expression of SVV capsid proteins. Protein bands of expected sizes for the VP1 (SEQ ID NO: 19, amino acids 596-859), VP2 (SEQ ID NO: 19, amino acids 73-356), and VP3 (SEQ ID NO: 19, amino acids 357-595) capsid subunits were found by Western blotting with anti-SVV P1 subunit-specific antibodies in the supernatant of baculovirus-infected insect cells that were similar in size to native SVV capsid proteins (FIG. 4). Interestingly, an additional ∼55 kDa protein band was detected on Western blots of alpha-SVV VP1 and alpha-SVV VP3. The ~55 kDa band was not detected in the native SVV antigen sample or the negative control (FIG. 4). The presence of an additional ~55 kDa protein suggests that it may contain an uncleaved VP3-VP1 protein product.

Fig. 4 also provides a comparison of SVV capsid protein expression levels between native (A) (SEQ ID NO: 18) and codon-optimized (B) (SEQ ID NO: 20) SVV DNA sequences in baculovirus-infected SF+ cells. Based on these Western blots, there were no apparent differences in SVV capsid protein expression levels between the codon-optimized BaculoFBU/SVVP13C-CO (SEQ ID NO: 20) and the original, native BaculoFBU/SVVP13C (SEQ ID NO: 18), so only construct BaculoFBU/SVVP13C (SEQ ID NO: 18) was evaluated further. The second set of constructs with 3C protease placed after sIRES does not produce detectable subunits of SVV capsid proteins during infection of insect cells with SF+. Not only did the sIRES constructs not produce detectable SVV capsid protein subunits, but no SF+ cytotoxicity problems were found. Therefore, the sIRES constructs were not further evaluated. Based on these general observations, harvesting the supernatant with BaculoFBU/SVVP13C-infected SF+ insect cells was the most promising construct for further purification in a sucrose gradient and determination of the presence of VLP.

In order to determine the expected mobility of the BaculoFBU/SVVP13C-derived SVV capsid proteins in the sucrose gradient, the precipitated native SVV virus was isolated in the sucrose gradient and analyzed by Western blotting (FIG. 5A). Most native SVV protein subunits were found in fractions 5 and 6 after sucrose gradient purification of native SVV. It was expected that if VLPs were formed in baculovirus-infected SF+ cells, they would be present in a similar or slightly higher range of collected gradient fractions.

Harvest of the BaculoFBU/SVVP13C construct supernatant was also subjected to sucrose gradient purification. Western blots of the sucrose gradient fractions detected only a small amount of recombinant SVV VP2 capsid protein in the first sucrose fraction (Fig. 5B). VP1 and VP3 were not detected in the sucrose fractions, although a weak protein band at ~55 kDa, which was considered uncleaved by VP3VP1, was detected in all sucrose fractions by Western blotting of VP1 α-SVV. No recombinant SVV capsid protein was detected in fractions 5 and 6, in contrast to the detection of expected native SVV proteins. These results indicate that the capsid protein subunits expressed in BaculoFBU/SVVP13C-infected insect cells do not form VLPs.

Even though BaculoFBU/SVVP13C (SEQ ID NO: 18) produces recombinant SVV capsid proteins found as protein subunits with SVV alpha antibodies, VLPs were not observed. The subunits of the capsid proteins were similar in size to native SVV proteins, but several other protein bands were also found in baculovirus-infected SF+ cells, including a protein band at ~55 kDa in alpha-SVV VP1 and alpha-SVV VP3 western blots. , suggesting an uncleaved VP3-VP1 protein product not present in native SVV. This may be indicative of a problem with efficient cleavage and separation of VP3VP1 subunits, which in turn may interfere with VLP formation in baculovirus-infected insect cells.

Definition of modified BaculoFBU/SVVP13C constructs.

To explore the possibility of not completely separating the subunits of the SVV VP1 and VP3 capsid proteins, two new constructs were developed based on previous publications. In a 2008 publication, Hales et al. stated that the SVV P1 VP3/VP1 cleavage site, FH/ST, was atypical for picornaviruses, including the Cardiovirus genus most closely related to SVV. In comparison, the typical PQ/GV cleavage site is conserved in many known picornaviruses. Thus, mutation of the VP3/VP1 cleavage site into a typical picornavirus cleavage sequence can increase cleavage of the VP3 and VP1 capsid subunits. The BaculoFBU/SVVP13C construct (SEQ ID NO: 18) was mutated to contain the PQ/GV sequence at the VP3/VP1 border to give the construct designated BaculoFBU/SVVP13C VP3/VP1 (SEQ ID NO: 22). This new construct was used to infect SF+ cells and protein expression was evaluated in the same manner as for the BaculoFBU/SVVP13C construct (SEQ ID NO: 18). Western blotting of BaculoFBU/SVVP13C VP3/VP1-derived supernatant samples using alpha-SVV VP1 or alpha-SVV VP3 antibodies detected a putative uncleaved VP3-VP1 protein product and single subunit bands.

- 25 041112 nits VP3 or VP1 in the same amount as observed for BaculoFBU/SVVP13C (SEQ ID NO: 18) (Fig. 6). A protein band at the expected full-length SVV P1 polyprotein, ˜95 kDa, was also found in harvests of BaculoFBU/SVVP13C VP3/VP1 supernatants.

In addition, Western blot determinations of the supernatant harvest sucrose gradient fractions (FIG. 7) were comparable to those of BaculoFBU/SVVP13C (SEQ ID NO: 18). Western blotting of α-SVV VP2 detected the recombinant SVV VP2 capsid protein in all sucrose fractions with the majority in fractions one and nine. The VP1 and VP3 protein subunits were not detected in the sucrose fractions, although a protein band at ~55 kDa was found in all sucrose fractions of the a-VP1 Western blot and in sucrose fractions one and nine of the a-VP3 Western blot, possibly consistent with uncleaved VP3-VP1 proteins. All three Western blots had several protein bands found in the most recent sucrose fraction, which appeared to be similar to the original sucrose gradient sample. This suggests that SVV capsid proteins can aggregate and precipitate to the bottom of the gradient. No capsid proteins were detected in the Western blot of the last fraction of the BaculoFBU/SVVP13C sucrose gradient (SEQ ID NO: 18) in FIG. 5B, but were also observed in previous determinations (NB 3219123). As seen from these Western blot determinations, mutation of the cleavage sequence from FH/ST to PQ/GV has no effect on the presence of the ~55 kDa band, which is considered uncleaved VP3-VP1. Compared to the original construct, no increase in the number of VP3 and VP1 protein subunits was detected, and no VLP formation was observed.

Other genera of picornavirus, including enteroviruses and aphthoviruses, have shown more efficient cleavage of VP3-VP1 when the 3CD protease is present in the native virus; thus, a second Senecavirus construct, BaculoFBU/SVVP13CD (SEQ ID NO: 24) was developed. BaculoFBU/SVVP13CD (SEQ ID NO: 24) was expressed in SF+ cells and supernatant harvest was determined by Western blotting (FIG. 8). Results comparable to previous VLP assessments were observed, with detection of VP1, VP2 and VP3 subunits, as well as a putative uncleaved VP3-VP1 protein of ~55 kDa in a-SVV VP1 and a-SVV VP3 Western blots.

In contrast to the assessment of SVV protein expression with other SVV baculovirus constructs, Western blot determination of BaculoFBU/SVVP13CD sucrose fractions (SEQ ID NO: 24) showed the presence in sucrose fractions 1 and 2 of monomeric subunits of SVV capsid proteins VP1, VP2 and VP3 with VP1 and VP2 found in all sucrose fractions. The ˜55 kDa protein band was present in the αSVV VP1 and α-SVV VP3 Western blot in sucrose fractions 1 and 2, but not in the negative control or α-SVV VP2 Western blot (FIG. 9). Similar to the BaculoFBU/SVVP13C VP3/VP1 sucrose fraction determinations (SeQ ID NO: 22), most of the SVV capsid proteins aggregated and precipitated at the bottom of the BaculoFBU/SVVP13CD sucrose gradient (SEQ ID NO: 24). However, the detection of SVV VP1 and VP2 protein subunits in all fractions derived from construct BaculoFBU/SVVP13CD-infected SF+ cells suggests the possibility of VLP formation.

Despite unclear results from the sucrose gradient determinations of each construct, fractions with expected VLP content were determined by electron microscopy (EM) at the USDA NADC. Pooled sucrose fractions of harvests of BaculoFBU/SVVP13C (SEQ ID NO: 18), BaculoFBU/SVVP13C VP3/VP1 (SEQ ID NO: 22), and BaculoFBU/SVVP13CD (SEQ ID NO: 24) supernatants were dialyzed in TBS and concentrated in preparation for EM . The samples had a strong background, making it difficult to clearly visualize the VLP with EM negative staining. Some spherical shapes were rarely seen in the combined BaculoFBU/SVVP13C VP3/VP1 (SEQ ID NO: 22) and BaculoFBU/SVVP13CD (SEQ ID NO: 24) sucrose fractions, which were similar in size to the expected SVV VLPs, but were not sufficient in all samples to confirm the presence of VLP.

Recombinant SVV proteins were expressed in SF+ insect cells.

One possibility why individual recombinant SVV capsid proteins are found in the supernatant but do not appear to form VLPs is that VLPs may dissociate shortly after release into the supernatant due to the low pH of the insect cell environment. To test this hypothesis, day 3 cell pellet samples, when cell viability was still relatively high, infected with BaculoFBU/SVVP13C (SEQ ID NO: 18), BaculoFBU/SVVP13C VP3/VP1 (SEQ ID NO: 22) and BaculoFBU/SVVP13CD (SEQ ID NO: 24) were lysed in physiological pH buffer to obtain a soluble protein fraction for detection of recombinant SVV protein subunits by Western blotting (FIG. 10). As can be seen, the levels of the VP1, VP2, and VP3 capsid protein subunit in day 3 soluble fractions were detected for the baculovirus SVV construct supernatant samples. A ˜55 kDa band of putatively uncleaved VP3-VP1 proteins was also detected in α-SVV VP1 and α-SVV VP3 Western blot samples of baculovirus SVV bands as noted above. Day 3 soluble fraction samples were purified in a sucrose gradient and determined by Western blotting to see if VLP was present in the cells prior to lysis (FIG. 11).

The sucrose fractions of day 3 soluble fractions had comparable results as shown for the sucrose fractions of harvest supernatant of insect cells infected with BaculoFBU/SVVP13C (SEQ ID NO: 18), BaculoFBU/SVVP13C VP3/VP1 (SEQ ID NO: 22) and BaculoFBU/SVVP13CD (SEQID

- 26 041112

NO: 24), respectively. Protein bands putatively corresponding to SVV capsid proteins were found mainly in fractions one and two and/or precipitated to the bottom, suggesting that subunits of SVV proteins inside insect cells do not form VLPs until cell lysis. EM was performed on pooled sucrose fractions of the soluble BaculoFBU/SVVP13C VP3/VP1 (SEQ ID NO: 22) day 3 sample, in which no VLP was observed. Soluble BaculoFBU/SVVP13C (SEQ ID NO: 18) and BaculoFBU/SVVP13CD (SEQ ID NO: 24) day 3 sucrose fractions were not determined by EM.

Conclusions.

Although the recombinant SVV capsid proteins VP1, VP2 and VP3 were found to be expressed to some extent as fully digested proteins, they did not result in VLP formation according to sucrose and EO gradient purification. In the Western blot determination of the sucrose gradient fractions, recombinant SVV capsid proteins were detected in the first few fractions and/or in the last fractions of the gradient. These results indicate that proteins do not assemble into VLPs but remain unassociated monomers or form large aggregates indicative of misfolded or misassembled proteins. Electron microscopy supports these results, namely that VLPs were not detected in pooled sucrose fractions that contained subunits of SVV capsid proteins.

Example 3

This study uses normal animals to determine the preliminary possibility of induction of a serological response after the introduction of the vaccine. The main purpose of this study is to determine whether administration of the BaculoFBU/SVVP13C (SEQ ID NO: 18), BaculoFBU/SVVP13C VP3/VP1 (SEQ ID NO: 22), and BaculoFBU/SVVP13CD (SEQ ID NO: 24) prototype vaccines results in to seroconversion in normal pigs.

Forty pigs were randomized into four groups as shown in Table 1. 1. In the table. 6 below are group descriptions and placement structure. On day 0, pigs were injected intramuscularly with a 2 ml dose of the prototype vaccine or placebo. On day 21, animals receive challenge administration of the prototype vaccine or placebo. Blood is collected from all pigs prior to treatment at each vaccination (day 0 and day 21) and on day 35. A subset of serum samples are analyzed for SVA seroconversion. General health observations are recorded throughout the study. Injection sites are monitored for reactions for at least three days after vaccine administration. Animals are humanely sacrificed at the end of the test. In table. 7 is a timeline of key events and sampling.

Table 6. Design of the study

Group Number (p) Vaccination Dose/method 1 10 BaculoFBU/SVVP13C (SEQ ID NO: 18); inactivated 5-10 mm BEI; added as adjuvant 12.5% EMULSIGEN®D) 2 ml/in/m 2 10 BaculoFBU/SVVP13C VP3/VP1 (SEQ ID NO:22) inactivated 5-10 mM BEI; added as adjuvant 12.5% EMULSIGEN®D) 2 ml/in/m 3 10 BaculoFBU/SVVP13CD (SEQ ID NO:24); inactivated 5-10 mm BEI; added as adjuvant 12.5% EMULSIGEN®D) 2 ml/in/m 4 10 Placebo (BaculoFBU/blank); inactivated 5-10 mm BEI; added as adjuvant 12.5% EMULSIGEN®D) 2 ml/in/m

Table 7. Timeline of Key Events and Sampling

Research Day Research event Day 3 Animal blood sampling Day 1 Transfer of animals from the study Day 0 - Vaccination #1 - Observations of the injection site for three days after vaccination - Animal blood sampling Day 14 - Animal blood sampling Day 21 - Vaccination #2 - Animal blood sampling - Observation of the injection site for three days after vaccination* Day 0 - Day 34 General health monitoring (1 time per day) Day 34 - Autopsy - Terminal blood sampling (1 x 250 ml vial) from all animals

*It should be noted that observations continued until the reactions were eliminated.

- 27 041112

To avoid bias, treatment is administered on day 0 and day 21 by non-clinical animal monitoring personnel. On day 0, healthy pigs are injected with a 2 ml dose of vaccine into the neck muscles on the right side using a sterile needle and an appropriately sized syringe. On day 21, the process is identical except that the injection was given to the left side of the neck. The lot number, dosage size, animal identification numbers, and time of administration of the vaccine material are recorded in the vaccine dose confirmation record.

During the vaccination period, animals are assessed daily using a general health monitoring form. In particular, if all animals are normal, N is administered for balance. In case an abnormal pig is found, A is entered for balance and the identification number of the specific animal and the abnormality are given. The injection sites are checked for redness, swelling, warmth and pain (either present or absent) and size (cm) for at least three days after each vaccination. If damage is visible, they are observed until they stop.

On blood collection dates, the investigator or authorized representative draws three to eight ml of venous whole blood via the anterior vena cava from each pig using an appropriately sized VACUTAINER® needle, a VACUTAINER® needle holder (both commercially available from Becton Dickinson and Company), and separation tubes. serum (SST) of appropriate size.

Serum samples are kept at 2-8°C until testing. Processing completed 48 hours after receipt. Blood tubes are centrifuged at 1960xg for 10 min at 4°C. The serum is separated from the clot by centrifugation and decantation into two screw cap cryogenic vials labeled with at least the study number, study day, and animal ID. Aliquots are stored at -70°C±10°C. Samples are stored for at least six months after completion of this study.

Example 4

This study uses conventional animals to evaluate the efficacy of a two-dose inactivated whole virus Senecavirus A vaccine compared to heterologous challenge with a heterologous field isolate of Senecavirus A. A total of 25 pigs were used for the study. Animals were randomized into two experimental groups. On day 0, thirteen pigs in the SVA-Vx group were inoculated intramuscularly (IM) with inactivated Senecavirus A whole virus vaccine, while the remaining twelve pigs in the placebo group received the control product. On day 14, the challenge vaccine was administered intramuscularly to all pigs using the appropriate material. On day 35, all pigs were challenged with 8.36 log TCID ₅₀ /dose with a heterologous field isolate of Senecavirus A (viral harvest) in a total volume of 5 ml (2 ml po 3 ml and intranasal). All pigs were placed mixed in one room. Pigs were monitored for general health daily from day 0 to day 33. From day 34 to day 49, pigs were monitored daily for clinical signs associated with SVA infection. Blood and rectal temperatures were measured periodically throughout the study. All animals were autopsied on day 49 (14 days post infection). In table. 8 shows a brief description of the experimental setup.

Table 8. Design of the study

Group P room Vaccine (Day 0, Day 14) Contagion (Day 35) Completion of the test SVA-Vx 13 316 Senecavirus A Inactivated Whole Virus Vaccine 8.36 log TCID50/5 ml dose; heterologous field isolate of Senecavirus A (viral collection). Day 49 placebo 12 316 placebo

In table. 9 below is a summary of the vaccine and control product formulations. Routine cultivation and PCR of Mycoplasma sp. performed for vaccine material; no growth (anaerobic or aerobic on blood agar) or contamination of mycoplasma DNA was detected. Vaccines were administered on day 0 intramuscularly in the right side of the neck midway between the base of the ear and the upper arm, using appropriately sized sterile needles and syringes. On day 14, the vaccine was administered at the same site as described above, but on the left side of the neck. All groups received a dose of 2 ml.

Table 9. Vaccine and control

Group Vaccination SVA-Vx Senecavirus A; pre-MSV; filtered through 0.2 μm; titers before inactivation = 7.71 log TCU ₅₀ /ml; inactivate 10 mm BEI -ΙΟ, 2% formaldehyde; neutralized with sodium bisulfite and sodium thiosulfate; add as an adjuvant 12.5% Emulsigen D; Lot#3423-022. placebo Pseudo-infection with the environment; inactivate 10 mm BEI + 0.2% formaldehyde; neutralized with sodium bisulfite and sodium thiosulfate; add as an adjuvant 12.5% Emulsigen D; Lot#3423-023.

Based on field reports and previous publications, animals were monitored for lameness, hoof lesions, and the presence of vesicles. If an animal had any clinical abnormality throughout the study, it was considered affected. In table. 10 shows the frequency of affected animals by groups. A prophylactic fraction estimate of 0.322 (0.004, 0.539; 95% CI) indicates that vaccination reduces the number of affected animals. Light fraction analysis was also done on days when the animal showed abnormal clinical signs. A cutoff score of 0.710 (0.333, 0.935; 95% CI) indicates that vaccination will reduce the number of days the animal was considered affected.

Table 10. Frequency distribution of the presence/absence of clinical signs by group during the infection phase

Group Struck? * Total Qty No Yes Qty (N) % Qty (N) % SVA-Vx 4 31 9 69 13 placebo 0 0 eleven 100 1G

*affected=had a clinical sign at least once during the study; t animal No. 648 was removed from the analysis.

Rectal temperatures were collected during the infection period; the mean least squares of rectal temperatures versus study day and group are presented in FIG. 12. Vaccination leads to significantly lower temperatures on day 40 and day 42.

Serum samples of days 0, 14, 35 and 49 were determined using a neutralizing assay. The geometric mean values of titers depending on the group and the day of the study are presented in table. 11. After two doses of vaccine, 13/13 (100%) animals had neutralizing titers greater than 400.

Table 11 Summary of Virus Neutralization Titers Statistics by Study Day and Group

Group Research Day Number (p) Geometric mean values Minimum Maximum % positive animals (>40) SVA-Vx 0 13 20.00 20 20 0.00 14 13 68.17 20 160 69.23 35 13 440.64 80 1280 100.00 49 13 640.76 80 2560 100.00 placebo 0 12 20.00 20 20 0.00 14 12 20.00 20 20 0.00 35 12 21.19 20 40 0.00 49 AND 2256.9 640 2560 100.00

values <40 were reported as 20; values >2560 have been adjusted to 2560.

The presence of viral RNA in serum was detected by quantitative real-time PCR. In FIG. 13 shows group means (log ₁₀ genomic copies/ml) of serum SVA RNA. SVA RNA was not detected in vaccinated animals at any time during the course of the study. For comparison, viremia was found in the placebo group from day 36 to day 42.

In conclusion, vaccination with two doses of inactivated Senecavirus A whole virus vaccine resulted in a complete reduction in viremia, a statistically significant reduction in clinical signs (PF=0.322; 95% CI=0.004, 0.539), and greater than four-fold virus neutralization titers in 13/13 vaccinated animals to infections.

All compositions and methods described and claimed herein can be made and practiced without undue experimentation in light of the present disclosure. Although the composition and methods of this invention have been described as preferred embodiments, it will be apparent to a person skilled in the art that changes can be applied to the compositions and methods, and to the steps or sequences of steps of the method described herein, without departing from the concept, essence and scope of the present invention. More specifically, it will be apparent that certain agents that are chemically and physiologically similar can be substituted for the agents described herein to achieve the same or a similar result. All such similar substitutions and modifications obvious to those skilled in the art are considered to be within the spirit, scope and concept of the invention as defined by the following claims.

Claims (10)

1. Nucleic acid encoding Senecavirus A (SVA) containing a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2; (b) a nucleotide sequence of at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6% , at least 99.7%, at least 99.8%, at least 99.9% identical to SEQ ID NO: 1 or SEQ ID NO: 2; (c) a nucleotide sequence encoding a polypeptide having an amino acid sequence selected from the group consisting of: SEQ ID NO: 3; (d) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9% identical to SEQ ID NO: 3; (e) a complementary chain of any of the nucleotide sequences from (a) to (d). 2. Nucleic acid according to claim 1, characterized in that Senecavirus A (SVA) is capable of inducing an infection in a subject, in particular an infection in a subject with clinical signs associated with or caused by such an infection, which is selected from the group consisting of: idiopathic vesicular disease, vesicular disease such as open or closed blisters or lesions located on the muzzle, oral mucosa and/or at the junction where the skin and the wall of the hoof meet (corolla), hemorrhages in the nail bed, sudden/acute lameness with redness and swelling on or around the coronet of the hoof; formation of ulcers on the corolla of the hoof and exfoliation of the hoof; and in breeding females causes sudden food refusal, lethargy, loss of appetite and/or fever up to 105°F (~40.6°C); preferably the subject is a pig. 3. Senecavirus A (SVA) for preventing or treating a subject against an infection caused by Senecavirus A (SVA), or for stimulating an immune response to said infection in a subject whose genome contains a ribonucleic acid according to claim 1 from (a) to (e) . 4. Senecavirus A (SVA) according to claim 3, characterized in that the Senecavirus is attenuated or inactivated. 5. An expression vector containing a nucleic acid according to any one of claims 1, 2. 6. Host cell containing the vector according to claim 5, intended for obtaining the nucleic acid according to claims 1, 2. 7. A Senecavirus A (SVA) polypeptide having an amino acid sequence selected from the group consisting of: (a) the amino acid sequence that is encoded by the nucleotide according to claim 1 from (a) to (b); (b) an amino acid sequence selected from the group consisting of SEQ ID NO: 3; (c) an amino acid sequence that is at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9 % identical to SEQ ID NO: 3; (d) the sequence of a polypeptide that is a P1-2A-P3 polypeptide having an amino acid sequence encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO : 24, SEQ ID NO: 32, SEQ ID NO: 33; (e) the sequence of a polypeptide that is a P1-2A-P3 polypeptide having an amino acid sequence that is encoded by a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95% %, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 32 and/or SEQ ID NO: 33; (e) the sequence of a polypeptide that is a P1-2A-P3 polypeptide having an amino acid sequence selected from the group consisting of: SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29; (g) the sequence of a polypeptide that is a P1-2A-P3 polypeptide having an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least - 30 041112 at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9% identical to SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27 and/or SEQ ID NO : 29. 8. An antibody that specifically binds to the polypeptide of claim 7. 9. A method for detecting Senecavirus A (SVA) according to claim 3 or 4 in a sample, including the steps: (I) contacting the sample with one or more oligonucleotide primers and/or probes that are specific for a nucleic acid according to any one of claims 1 to 2, and (II) detecting binding between said Senecavirus A (SVA) and said one or multiple oligonucleotide primers and/or probes; or (III) contacting the sample with the antibody of claim 8, and (IV) detecting binding between said Senecavirus A (SVA) and said antibody; or (V) detecting the presence or absence of an antibody against said Senecavirus A (SVA) in said sample. 10. A method for diagnosing Senecavirus A (SVA) infection according to claim 3 or 4 in a sample from a subject, preferably a pig, comprising a method for detecting Senecavirus A (SVA) according to claim 9, wherein the presence of said Senecavirus A (SVA) is indicative of infection, or comprising a method for detecting an antibody against said Senecavirus A (SVA) according to claim 9, wherein the presence of said antibodies is indicative of infection from said Senecavirus A (SVA).