CN105219861A - A kind ofly detect the method whether having contaminating genomic DNA in watermelon cDNA sample - Google Patents
A kind ofly detect the method whether having contaminating genomic DNA in watermelon cDNA sample Download PDFInfo
- Publication number
- CN105219861A CN105219861A CN201510678873.2A CN201510678873A CN105219861A CN 105219861 A CN105219861 A CN 105219861A CN 201510678873 A CN201510678873 A CN 201510678873A CN 105219861 A CN105219861 A CN 105219861A
- Authority
- CN
- China
- Prior art keywords
- genomic dna
- cdna
- watermelon
- primer
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to gene expression analysis technical field, when being a kind of watermelon gene expression analysis, detect the method that whether there is contaminating genomic DNA in cDNA sample.Principle of the present invention is structure according to gene and sequence information, adjacent two exons designs forward and reverse primer respectively, makes it amplified production on genomic DNA template and be greater than the amplified production in cDNA template.The Auele Specific Primer of the molecular chaperones DnaJ protein gene DNAJ extensively existed in principle design watermelon accordingly, with sample cDNA for template, this primer pair is utilized to carry out pcr amplification, the amplified production of 87bp is greater than as occurred, then show that this cDNA sample exists contaminating genomic DNA, as only there is the amplified production of 87bp, then show that this cDNA sample does not exist the pollution of genomic dna.Use method provided by the present invention, the accuracy that technology such as utilizing real-time fluorescence quantitative PCR carries out watermelon gene expression analysis can be improved further.
Description
Technical field
The invention belongs to gene expression analysis technical field, when being a kind of watermelon gene expression analysis, detect the method that whether there is contaminating genomic DNA in cDNA sample.
Background technology
Gene expression analysis has been widely used in the research in the field such as Functional identification of genes and transcriptional control.Gene expression analysis technology conventional at present has Semiquatitative RT-PCR assay and real-time fluorescence quantitative PCR, and wherein Real-Time Fluorescent Quantitative PCR Technique is because of advantages such as its quick, accurate and required sample size are few, has become main gene expression analysis technology.
No matter being carry out gene expression analysis with Semiquatitative RT-PCR assay or real-time fluorescence quantitative PCR, is all identical in sample preparation steps.First extract sample RNA, reverse transcription becomes cDNA, then carries out Semiquatitative RT-PCR assay or real-time fluorescence quantitative PCR analysis with the Auele Specific Primer of target gene.The RNA proposed in usual sample, can have genomic dna, so, before reverse transcription becomes cDNA, need to remove genomic dna.If genomic dna is removed unclean, namely there is the pollution of genomic dna in cDNA sample, when carrying out gene expression analysis, especially when carrying out real-time fluorescence quantitative PCR and analyzing, gene target fragment on genomic dna and cDNA will be increased simultaneously, now, the gene expression amount of acquisition has very large difference with actual gene expression amount, causes erroneous results.Therefore, before carrying out gene expression analysis, need the pollution guaranteeing to there is not genomic dna in cDNA sample.
The main method adopting enzyme to cut is before RNA reverse transcription becomes cDNA at present, decomposes genomic dna, thus avoids the impact of existence on gene expression analysis of genomic dna.But whether the genomic dna that the method that there is no detects in cDNA sample is completely removed.And in actually operating, the step of degrading genes group DNA likely can be missed, or due to the impact of the factor such as enzymic activity, reaction conditions, cause genomic dna not to be removed clean, so that have a strong impact on the accuracy of gene expression analysis subsequently.Therefore, before carrying out gene expression analysis, need a kind of method to detect the pollution that whether there is genomic dna in cDNA sample.
Summary of the invention
During for gene expression analysis, lack the method effectively detecting and whether there is contaminating genomic DNA in cDNA sample, for ensureing the accuracy of gene expression analysis, the invention provides and a kind ofly be exclusively used in the method detecting and whether there is contaminating genomic DNA in cDNA sample.
The present invention solves the principle that its technical problem adopts: gene, in expression process, is first that template is transcribed into Pre-mRNA with genomic dna, then forms the mRNA of maturation through processes such as editor, shearings.The Pre-mRNA of most of gene all has intron structure, and in shear history, these introns can be sheared, and adjacent exon links together, then forms ripe mRNA through adding the process such as cap, tailing.Therefore, the mRNA sequence of gene, compared with its sequence on genomic dna, has lacked intron sequences, shorter than the sequence of gene on the genomic dna of correspondence.The present invention utilizes the textural difference on genomic dna sequence that the mRNA of gene is corresponding with it, when designing the Auele Specific Primer of gene, forward and reverse primer are placed on respectively on two adjacent exons, when being respectively template with cDNA and genomic dna and carrying out pcr amplification, amplified production on genomic dna contains an intron, and the product that cDNA template amplifies does not comprise intron, so, be that the pcr amplification product of template is than length when taking cDNA as template with genomic dna.Therefore, present method, by comparing the size of pcr amplification product, just can detect the pollution that whether there is genomic dna in cDNA sample.
The technical solution adopted for the present invention to solve the technical problems is:
Sequence and the structural information of target gene is obtained from (http://www.icugi.org) watermelon genome, primer is designed with Primer3Plus, the binding site of forward and reverse primer is placed on respectively on two adjacent exons, amplified production size is set to 80-150bp, watermelon full-length genome detects the primer specificity of target gene, after determining that designed primer is the Auele Specific Primer of this gene, respectively with cDNA and genomic dna for template carries out pcr amplification, and detected by agarose gel electrophoresis, as on genomic DNA template, amplified production is greater than the target fragment increased in cDNA template, then design of primers is correct, as failure of increasing, other binding site is then selected to redesign primer according to the method described above.Meanwhile, if the fragment that when to have amplified with genomic dna in cDNA sample be template, size is identical, then show that this cDNA sample exists contaminating genomic DNA, otherwise without contaminating genomic DNA.
Feature of the present invention is: in the design of primers link of gene expression analysis, not only take into account the sequence of gene, also take into account the structure of gene, by the binding site of forward and reverse primer being designed specifically on adjacent two exons, according to the size being pcr amplification product during template with cDNA and genomic dna, carry out the pollution whether having genomic dna in rapid detection cDNA sample.This patent utilizes the Auele Specific Primer of the molecular chaperones DnaJ protein gene (DNAJ) extensively existed in the method successful design watermelon.
Advantage of the present invention is:
(1) testing cost is low: compared with the gene expression analysis process of routine, the present invention only needs in design of primers link by the artificial setting position of primer binding site on gene, and increase the pcr amplification link that a genomic dna is template, and do not need to increase other equipment and reagent, therefore testing cost is very low.
(2) highly sensitive: the susceptibility of PCR-based technology, even if the genomic dna that there is very low levels in cDNA sample also can be detected.
Accompanying drawing explanation
Fig. 1: watermelon DNAJ gene structure display.
Fig. 2: do not consider that the watermelon DNAJ gene primer that gene structure designs is combined and pcr amplification schematic diagram with cDNA template.
Fig. 3: do not consider that the watermelon DNAJ gene primer that gene structure designs is combined with genomic DNA template and pcr amplification schematic diagram.
Fig. 4: be combined and pcr amplification schematic diagram with cDNA template with the watermelon DNAJ gene primer of the inventive method design.
Fig. 5: be combined and pcr amplification schematic diagram with genomic DNA template with the watermelon DNAJ gene primer of the inventive method design.
The primer specificity agarose gel electrophoresis detected result of Fig. 6: watermelon DNAJ gene PCR amplification.
Embodiment
The expression analysis of embodiment 1 watermelon DNAJ gene
(1) acquisition of watermelon gene order and structural information:
DnaJ albumen is the molecular chaperones extensively existed in plant, large quantity research all shows that this albumen participates in regulate several biological processes, and play an important role (Overexpressionoftomatochloroplast-targetedDnaJproteinenh ancestolerancetodroughtstressandresistancetoPseudomonass olanacearumintransgenictobacco.GuodongWang in the growth and development process of organism; GuohuaCai; FanyingKong; YongshengDeng; NanaMa; QingweiMeng.PlantPhysiologyandBiochemistry.2014-05-22).Accession number (ID:AF124139.1) the reference Selectionofinternalcontrolgenesforquantitativereal-timeR T-PCRstudiesduringtomatodevelopmentprocess.MarinoExp ó sito-Rodr í guez of DNAJ gene, Andr é sABorges, Andr é sBorges-P é rez, Jos é AP é rez.BMCPlantBiol.2008; 8:131. downloads the mRNA sequence of this sequence on mode crop tomato from NCBI (http://www.ncbi.nlm.nih.gov/), blastn comparison is carried out afterwards in Curcurbitaceae genome database (http://www.icugi.org/), the gene I/D number obtained in watermelon is Cla022621, downloads sequence and the gene structure information of this gene from Curcurbitaceae genome database.The nucleotide sequence of this gene is shown in SEQIDNO.3, and structural information is shown in Fig. 1.
(2) design of primers of DNAJ gene when not considering gene structure:
When the primer of design objective gene, be normally put in primer-design software by the CDS sequence of gene, by software Automated Design, this method does not consider the structural information of gene, and the binding site of primer on gene has randomness.For reliability of the present invention is described, we utilize this general method to carry out design of primers to DNAJ gene, and in contrast.Design of primers process is: the CDS sequence of DNAJ gene is put into Primer3Plus software, and product length is set to 80-150bp, and click Pickprimers, select the primer pair made number one, sequence is in table 1.The CDS sequence of the primer sequence of acquisition and DNAJ gene compared, find that this primer pair is positioned on the 1st exon, namely the sequence of this primer pair amplifies is all in the inside of the 1st exon.For distinguishing, by this primer pair called after ClDNAJ ' with the middle primer designed of step (3).
Fig. 2 is that primer ClDNAJ ' is combined with cDNA template and increases schematic diagram, is now the target fragment that template amplification goes out 87bp with cDNA.Fig. 3 is that primer ClDNAJ ' is combined with genomic DNA template and increases schematic diagram, and now amplified production is similarly the target fragment of 87bp.As can be seen here, current general primer design method is utilized cannot to distinguish the difference of amplified production on cDNA and genomic dna.
(3) method in the present invention is utilized to carry out the design of primers of DNAJ gene:
According to the structural information of DNAJ gene, choose the 1st, 2nd exon and between intron sequences, by the base of this intron sequences head and the tail position " [] " mark on software Primer3Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cg i0), before representing, primer location is fixed on the 1st exon, rear primer location is fixed on the 2nd adjacent exon, product length is set to 80-150bp, GeneralSettings is set to qPCR parameter, click Pickprimers, select the primer pair made number one, called after ClDNAJ, primer sequence is in table 2, SEQNO.1, SEQNO.2.
Fig. 4 is that primer ClDNAJ is combined with template cDNA and increases schematic diagram, and now forward primer designs on the 1st exon, and reverse primer designs on the 2nd exon, take cDNA as the target fragment that template amplification goes out 87bp.Fig. 5 is that primer ClDNAJ is combined with genomic DNA template and increases schematic diagram, and now amplified production comprises intron sequences, therefore the fragment amplified on genomic DNA template is greater than the fragment amplified in cDNA template.
(4) extraction of RNA and DNA:
Choosing the red flesh watermelon pollination Meat Sample of latter 24 and 30 days is material, adopts Trizol method to extract RNA.Concentration and the quality of RNA is detected with NANODROP2000.The integrity of RNA adopts the agarose gel electrophoresis of 2% to detect.After RNA detection is qualified, then carry out reverse transcription reaction.Adopt CTAB method to extract genomic dna, detect concentration and the quality of DNA with NANODROP2000, packing is preserved.
(5) reverse transcription of cDNA:
Carry out removal genomic dna during reverse transcription and do not remove genomic dna two kinds process:
The first (not removing genomic dna): 2uL total serum IgE adopts PrimeScript
tMrTreagentKitwithgDNAEraser (TaKaRa) test kit directly carries out second step (37 DEG C of 15min of reverse transcription; 85 DEG C of 5s), form the cDNA not removing genomic dna of 40ul.Detect concentration and the quality of cDNA with Nanodrop2000, make a record, be sub-packed in 200ul centrifuge tube in-80 DEG C of preservations.
The second (removal genomic dna): 2uL total serum IgE adopts PrimeScript
tMfirst RTreagentKitwithgDNAEraser (TaKaRa) test kit carries out gDNA removal, then carries out reverse transcription (two-step approach: 42 DEG C of 2min and 37 DEG C 15min; 85 DEG C of 5s) form the cDNA of the removal genomic dna of 40 μ L.Detect concentration and the quality of cDNA with Nanodrop2000, make a record, be sub-packed in 200ul centrifuge tube in-80 DEG C of preservations.
(6) the pcr amplification specific detection of DNAJ gene primer:
Respectively with cDNA (point remove genomic dna and do not remove genomic dna two kinds) and genomic dna for template, carry out pcr amplification specific detection.PCR program is 95 DEG C of denaturation 5min, and 94 DEG C of sex change 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s carry out 30 circulations, and 72 DEG C extend 4min.Adopt 20ul amplification system, comprise: 1 × PCRmix (Tian Gen biochemical technology company limited), the primer of 0.5umol/L, 30ng genomic DNA template or 400ngcDNA template.Pcr amplification product 2% agarose gel electrophoresis detects, and the results are shown in Figure 6.In Fig. 6, the electrophoresis detection result of pcr amplification product when c representative is template with cDNA; The electrophoresis detection result that c (g) representative is pcr amplification product during template with the cDNA containing contaminating genomic DNA; The electrophoresis detection result of pcr amplification product when g representative is template with genomic dna.
Draw from Fig. 6, the primer ClDNAJ ' adopting current general primer design method to design has amplified the target fragment of formed objects when cDNA template, cDNA containing contaminating genomic DNA be template and genomic dna are template, cannot judge whether the pollution that there is genomic dna.And the ClDNAJ primer adopting the inventive method to design, cDNA template only amplifies 1 band, cDNA template containing contaminating genomic DNA amplifies 2 bands, the stripe size increased when wherein a band is template with genomic dna is consistent, be that template does not amplify the band of the same size with genomic dna with cDNA, fully showing the pollution that really there is genomic dna in this cDNA sample, proving that method used in the present invention is very effective for whether there is contaminating genomic DNA in detection cDNA sample.
The primer sequence that table 1 designs with current general primer design method
Table 2 utilizes the present invention to design primer sequence
Claims (3)
1. detect the method whether having contaminating genomic DNA in watermelon cDNA sample, it is characterized in that:
1) on adjacent two exons, forward and reverse primer is designed according to the structure of watermelon gene and sequence information respectively;
2) RNA of watermelon is extracted, reverse transcription becomes cDNA, be template afterwards with cDNA, by step 1) primer that designs carries out pcr amplification, and adopt agarose gel electrophoresis method for detecting to detect amplified production, if there is a fragment of being longer than target product in amplified production, then show the pollution having genomic dna in cDNA sample, as only amplified target fragment, then show the pollution without genomic dna in cDNA sample.
2. utilize the method whether having contaminating genomic DNA in watermelon DNAJ gene test Watermelon Fruit cDNA sample, its feature comprises the following steps:
1) on the 1st and the 2 two neighboring exons, forward and reverse primer is designed according to the structure of watermelon DNAJ gene and sequence information respectively;
2) extract the RNA of watermelon, reverse transcription becomes cDNA, is template afterwards, by step 1 with cDNA) primer that designs carries out pcr amplification, and adopts agarose gel electrophoresis method for detecting to detect amplified production.If there is a fragment of being longer than 87bp in amplified production, then showing the pollution having genomic dna in cDNA sample, as only amplified the fragment of 87bp, then showing in cDNA sample without contaminating genomic DNA.
3. utilize the method whether having contaminating genomic DNA in watermelon DNAJ gene test fruit cDNA sample as claimed in claim 2, it is characterized in that:
The nucleotide sequence of described forward and reverse primer is respectively:
Forward primer sequence: CCGCTATCAAGAACCATCCT
Reverse primer sequences: CTGGATCACTCAGCACCTCA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510678873.2A CN105219861A (en) | 2015-10-19 | 2015-10-19 | A kind ofly detect the method whether having contaminating genomic DNA in watermelon cDNA sample |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510678873.2A CN105219861A (en) | 2015-10-19 | 2015-10-19 | A kind ofly detect the method whether having contaminating genomic DNA in watermelon cDNA sample |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105219861A true CN105219861A (en) | 2016-01-06 |
Family
ID=54989127
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510678873.2A Pending CN105219861A (en) | 2015-10-19 | 2015-10-19 | A kind ofly detect the method whether having contaminating genomic DNA in watermelon cDNA sample |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105219861A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108754010A (en) * | 2018-06-14 | 2018-11-06 | 中国农业科学院蔬菜花卉研究所 | It is a kind of quickly to detect the remaining method of genomic DNA in total serum IgE sample |
| CN115472222A (en) * | 2022-11-02 | 2022-12-13 | 杭州链康医学检验实验室有限公司 | Single cell transcriptome RNA pollution identification method, medium and equipment |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342438A (en) * | 2014-09-28 | 2015-02-11 | 华中农业大学 | Application of ClCAC gene and ClSAND gene as reference genes in analysis of gene expression of watermelon fruits |
| CN104694631A (en) * | 2015-02-05 | 2015-06-10 | 华中农业大学 | Real-time fluorescence quantitative PCR analysis method for watermelon gene expression |
-
2015
- 2015-10-19 CN CN201510678873.2A patent/CN105219861A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342438A (en) * | 2014-09-28 | 2015-02-11 | 华中农业大学 | Application of ClCAC gene and ClSAND gene as reference genes in analysis of gene expression of watermelon fruits |
| CN104694631A (en) * | 2015-02-05 | 2015-06-10 | 华中农业大学 | Real-time fluorescence quantitative PCR analysis method for watermelon gene expression |
Non-Patent Citations (1)
| Title |
|---|
| 李燕等: "《细胞与分子生物学常用实验技术》", 31 July 2009 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108754010A (en) * | 2018-06-14 | 2018-11-06 | 中国农业科学院蔬菜花卉研究所 | It is a kind of quickly to detect the remaining method of genomic DNA in total serum IgE sample |
| CN108754010B (en) * | 2018-06-14 | 2022-05-13 | 中国农业科学院蔬菜花卉研究所 | Method for rapidly detecting genome DNA residues in total RNA sample |
| CN115472222A (en) * | 2022-11-02 | 2022-12-13 | 杭州链康医学检验实验室有限公司 | Single cell transcriptome RNA pollution identification method, medium and equipment |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108103235B (en) | SNP molecular marker and primer for identifying cold resistance of apple rootstock and application of SNP molecular marker and primer | |
| CN111378767B (en) | SNP (Single nucleotide polymorphism) marker for identifying Chinese red deer and red deer, detection primer pair, kit and application | |
| US20160115544A1 (en) | Molecular barcoding for multiplex sequencing | |
| CN106367491A (en) | Kit for detecting deafness susceptibility genes | |
| CN108384859A (en) | With the relevant SNP marker of tail type character of broadtail type sheep and application | |
| CN105219861A (en) | A kind ofly detect the method whether having contaminating genomic DNA in watermelon cDNA sample | |
| CN105368948A (en) | Primer for sex identification of Nile tilapia and PCR (polymerase chain reaction) identification method | |
| CN115094156A (en) | Development and application of KASP marker of rice high-temperature-resistant gene TT1 | |
| CN112176076B (en) | NFAT5 gene molecular marker related to goat growth traits and application thereof | |
| CN108754010B (en) | Method for rapidly detecting genome DNA residues in total RNA sample | |
| CN109136382B (en) | Method and system for identifying four human body fluid sources | |
| CN115637288A (en) | Method for detecting copy number change of SMN1 and SMN2 genes and application thereof | |
| CN110993022B (en) | Method and device for detecting copy number amplification and method and device for establishing dynamic base line for detecting copy number amplification | |
| CN112251519A (en) | Specific primer, probe, kit and method for identifying homozygote and heterozygote of Hulenbel short-tailed sheep | |
| CN109735646B (en) | CAPS molecular marker and method for identifying rice variety and application thereof | |
| CN109837355B (en) | Application of beckmannia syzigachne CYP704B1 gene | |
| CN104694631A (en) | Real-time fluorescence quantitative PCR analysis method for watermelon gene expression | |
| CN101781685B (en) | Codominant labeling method for identifying wheat polymer glutenin Dx5 and Dx2 subunits | |
| CN103181361B (en) | Method for breeding Ili horses, and kit employed in method | |
| CN110951924A (en) | One-step multiple RT-PCR detection method for simultaneously detecting 3 pathogens of sugarcane mosaic disease | |
| CN103602748A (en) | Pyrophosphoric acid sequencing method combined with fluorogenic quantitative PCR technology | |
| CN112553219B (en) | Method for detecting alternaria leaf spot based on ribosome 28s gene | |
| KR101716029B1 (en) | Sequence Characterized Amplified Region Molecular Marker Related to WMV and ZYMV resistance Characteristic in Squash and use thereof | |
| CN103343169B (en) | Meloidogyne molecular identification primer set, and preparation method and application thereof | |
| CN107012253A (en) | A kind of method for identifying that Avena sativa is maternal |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160106 |