CN105219851A - A kind of methylated method of burnt order-checking detection by quantitative - Google Patents
A kind of methylated method of burnt order-checking detection by quantitative Download PDFInfo
- Publication number
- CN105219851A CN105219851A CN201510621381.XA CN201510621381A CN105219851A CN 105219851 A CN105219851 A CN 105219851A CN 201510621381 A CN201510621381 A CN 201510621381A CN 105219851 A CN105219851 A CN 105219851A
- Authority
- CN
- China
- Prior art keywords
- order
- checking
- nucleotide
- quantitative
- jiao
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Abstract
The invention discloses a kind of methylated method of burnt order-checking detection by quantitative.The method by the PCR primer of genomic dna after bisulfite conversion according to specific two Nucleotide quickly through " A " in DNA profiling sequence, " G ", " T " region, and dGTP " C " content mode in mensuration DNA profiling sequence that adds carries out Jiao's order-checking, the each sequencing reaction of continuous recording obtains information: namely obtain two Nucleotide composite number object codings and dGTP synthesis information of number, by to set in the sequence of fixed target area base C in all GC sites all in various degree change into T, recycling dGTP synthesizes information of number, the quantitative analysis of each methylation sites in realize target regional sequence.The present invention can increase substantially order-checking length, has widened the analyst coverage of traditional Jiao's order-checking, has been applicable to the quantitative analysis that methylates of single sample PCR primer and mixing sample PCR primer sequence.
Description
Technical field
The invention belongs to biological technical field, is a kind of PCR primer sequence analysis method, is specifically related to a kind of methylated method of synthesis Jiao order-checking detection by quantitative that specific nucleotide adds.
Background technology
The carrying out and complete of the Human Genome Project and various Model organism genome plan, the mankind are stepped into rear era gene, create tremendous influence to the biological study in the present age and medical research, molecular biology related discipline obtains swift and violent development.The rule be familiar with the difference of life from gene level, disease occurs, developing, and the interaction of medicine and life entity will become possibility.With regard to gene sequencing, the emphasis of rear era gene is measured the comparison transferred to idiogenetics difference and thing inter-species heritable difference in genome by whole genome sequence.Increasing evidence shows, DNA methylation take part in the process such as fetal development, gene imprinting.Meanwhile, it also plays a part very important in disease progression.The change of methylation state is considered to the important factor causing cancer, the exception of reduction and local, CpG island methylation level that this change comprises the overall methylation level of genome raises, thus causes not expressing of genomic instability (expression as chromosomal instability, proto-oncogene) and cancer suppressor gene.
DNA methylation analysis comprises quantification and qualification, and there is a lot of method at present can select.Genomic dna is after bisulf iotate-treated, and in original series, not methylated cytosine(Cyt) (C) residue is converted into uridylic (U), and occurs with thymus pyrimidine (T) in pcr amplification; Methylated cytosine(Cyt) then remains unchanged.From these major trunk roads of bisulfite conversion, afterwards can selectional restriction restriction analysis, real-time quantitative PCR, Sanger order-checking, Manganic pyrophosphate complex initiation and high-throughput DNA sequencing etc.But, and not all method can provide the quantitative data in single CpG site.The Sanger of sample PCR primer after bisulf iotate-treated checks order the gold standard be once considered in methylation analysis, if but to 5-10 cloning and sequencing, this method is just sxemiquantitative at most.High-throughput DNA sequencing, for the research that methylates, brings very sensitive DNA methylation collection of illustrative plates, covers whole CpG island with single-molecule resolution.High-throughput DNA technique achieves the covering more comprehensively on whole CpG island, and the heterogeneity that single-molecule resolution is methylation patterns provides unprecedented information.It can the multiple site of parallel study.But these advantages are also along with some inferior positions, and a such as sizable investment, expensive reagents, turnover time length, data analysis require high.These features make high-throughput DNA sequencing technology be more suitable for determination at genome range region of interest within, and to the quantitative analysis of different sample in the CpG site of target area because sample size is large, if each sample adopts high-throughput DNA sequencing, technology is analyzed, then cost will be too huge.
Traditional pyrosequencing techniques can detect methylated frequency rapidly, carries out qualitative and detection by quantitative to the methylation sites in sample.The PCR primer of sample after bisulf iotate-treated checks order in extension process Jiao, quantitatively determines the C-T ratio of Single locus according to the incorporation of C and T.Therefore, the variation that methylates of different loci just can accurately be detected.Because Manganic pyrophosphate complex initiation provides real sequence data, methylation state also just presents with sequence form.The research group that Hanoverian, Germany medical college AnnaPotapova leads has carried out the cross validation (BMCBiotechnology of system to high-throughput DNA sequencing and burnt order-checking, 2011,11:6), show the statistical study that analog value compares of checking order of methylation level in the single CpG site that high-throughput DNA sequencing obtains of the methylation patterns in 12 sites in 10 primary hepatocarcinoma samples and tradition Jiao, the methylation level in all single CpG sites has splendid consistence.Show that traditional Pyrosequencing is a kind of simple, low-cost analytical technology that can be used for the CpG site quantitative analysis of target area.
But traditional Pyrosequencing adds the dNTP of respective volume due to each reaction needed, and like this, along with the carrying out of sequencing reaction, the volume of reactant is increasing, the concentration of its reactant is also just fewer and feweri, and the accuracy of order-checking is also just more and more lower.The burnt order-checking of tradition generally also can only measure the fragment length (MashayekhiF of about 60bp under the prerequisite optimizing Nucleotide addition sequence, RonaghiM.A.Analyticalbiochemistry, 2007,363,275-28719), and this each methylation sites needs traditional Pyrosequencing of the realization of two sequencing reactions to be just more subject to checking order to the analysis of the PCR primer that methylates the restriction of length.A kind of method of accommodation the multiple sequencing primer segmentation of this segment length's sequence is carried out Jiao's order-checking.But, on the one hand, use multiple sequencing primer also can increase analysis cost; On the other hand, because cytosine(Cyt) methylated after bisulf iotate-treated then remains unchanged, therefore the methylated degree in each site is different, in PCR primer, the content of two kinds of DNA profilings is also just different, cause the complexity of DNA profiling type, its sequence segment measures by the general multiple sequencing primer of design that is difficult to.Thus the burnt order-checking of tradition Shortcomings in the methylated detection by quantitative of long segment sequence.The analysis conventional Pyrosequencing detection by quantitative that is used for methylating can find, CpG site (i.e. dGTP order-checking) information is only make use of in order-checking, and the order-checking information in other region does not use, therefore, according to our laboratory, a kind of method (Xiao Pengfeng etc. synthesizing order-checking based on two Nucleotide are in real time proposed, Chinese invention patent: ZL201210128597.6), the order-checking in other region Nucleotide synthesis order-checking that specific two nucleotide substitutions are single will be reduced the number of synthesis order-checking undoubtedly, thus increase the reading length of order-checking.
Summary of the invention
In order to overcome the deficiencies in the prior art, the invention provides a kind of methylated method of burnt order-checking detection by quantitative, for the PCR primer of sample after bisulf iotate-treated provides a kind of quick, efficient, sensitive quantitative analysis method that methylates.
For achieving the above object, the technical solution used in the present invention is:
A kind of methylated method of burnt order-checking detection by quantitative, step comprises: 1) DNA extraction; 2) bisulf iotate-treated; 3) pcr amplification; 4) check order; 5) association analysis;
Described step 4) sequence measurement be: according to specific two Nucleotide, dGTP feed postition carry out Jiao order-checking; Wherein, two Nucleotide mensuration serial responses obtain composite number object coded message, dGTP mensuration serial response obtains synthesizing information of number.
Described step 4) concrete grammar comprise the following steps:
4-1) prepare single-stranded DNA templates: reacted by the magnetic bead that pcr amplification product and Streptavidin wrap up, the DNA chain of biotin modification is fixed on described magnetic bead, sex change under 0.05-0.2MNaOH solution; Another DNA chain loose is removed; Then wash liquid is used, the single-stranded DNA templates be fixed;
4-2) sequencing primer hybridization: by sequencing primer and described single-stranded DNA templates in hybridization system, place 5-10min at 70-80 DEG C, naturally cool to room temperature, complete hybridization;
4-3) checking order: with sequencing reaction system, with described step 4-2) hybrid product that obtains mix, and burnt order-checking is instead carried out according to specific two Nucleotide, dGTP feed postition.
Described step 4-2) in, described sequencing primer be one section with one section of sequence of single-stranded DNA templates complete complementary.
Described step 4) in, the each sequencing reaction of two Nucleotide obtains the signal strength information of two Nucleotide synthesis order-checkings, the each sequencing reaction of dGTP obtains the signal strength information of single core thuja acid synthesis order-checking, described order-checking strength of signal is directly proportional to synthesizing ribonucleotide number, and namely the order-checking strength of signal of each sequencing reaction all can be converted into the number of Nucleotide synthesis.
Described step 5) in, the information of number of the Nucleotide synthesis that each sequencing reaction of the dGTP that obtains obtains of checking order according to Jiao, this information of number is 0≤x
i≤ 1;
Described association analysis is: assuming that the methylated degree of C is x in an easy GC site
i, wherein 0≤x
i≤ 1, so, in this base sequence of PCR primer through bisulf iotate-treated, the DNA profiling sequence content containing " C " is x
i, containing by not methylated " T " DNA profiling sequence content be transformed of this base is then (1-x
i); According to the information of number of the Nucleotide synthesis that dGTP sequencing reaction obtains, the numerical value of xi can be obtained.
Described step 2) in, adopt traditional bisulfite conversion method, or adopt commercially available test kit, implement according to its operating process.
Described step 3) in, pcr amplification PCR primer used is that 5 ' end is modified by vitamin H, amino or acrylamide group, react with the solid phase carrier of finishing streptavidin, carboxyl, or prepare single-stranded DNA templates with acrylamide monomer polyreaction.
It is characterized in that: described specific two Nucleotide are analyzed fragment according to DNA profiling and determined, comprise (dCTP+dTTP), (dATP α S+dCTP), (dATP α S+dTTP).
The invention has the beneficial effects as follows:
Compared with the present invention checks order with tradition Jiao, there is following beneficial effect:
1) the present invention is applicable to the methylation analysis of all PCR primer sequences through bisulfite conversion.Relative to traditional burnt sequencing analysis method, the present invention can increase substantially the measured length of DNA sequence dna, has widened the analyst coverage of burnt order-checking.
2) the present invention is applicable to the multi-template PCR primer analysis of multiple mixing sample, directly can measure the ratio of each DNA profiling in mixing sample, may be used for finding from extensive sample, screening nucleic acids marker.
3) the present invention directly adopts commercialization, cold natural nucleotide carries out synthesis order-checking, and it can carry out at existing any order-checking platform based in real time synthesis order-checking.
Accompanying drawing explanation
Fig. 1 be the inventive method to draft arbitrarily comprise multiple methylation sites PCR primer DNA profiling sequence (5 '-TTTTGGAG (C/T) TTG (C/T) AG (C/T) TTTG (C/T) GTTTTTG (C/T)-3 ', wherein (C/T) represents the possible base information after bisulfite conversion in PCR primer), the methylation content association analysis signal in burnt order-checking and each site thereof is carried out according to specific two Nucleotide, dGTP feed postition; The step of the numeral sequencing reaction of first, seven row in figure, the Nucleotide added of the letter representation sequencing reaction the second, in six row brackets write a Chinese character in simplified form that (" G " represents dGTP, " CA " representative " dCTP+dATP α S ", the rest may be inferred by analogy for it), the nucleotide number of the numeral sequencing reaction synthesis above bracket, the 3rd, the five-element represent 100% methylate (DNA sequence dna 1) and 100% not methylate (DNA sequence dna 2) sequence;
Fig. 2 carries out Jiao to 5 methylation sites of people's sample RAR β 2 Gene Promoter CpG Island according to specific two Nucleotide, dGTP feed postition (see table 1) and to check order to obtain collection of illustrative plates.
Embodiment
The methylated method of one provided by the invention new formed coke order-checking detection by quantitative, utilize two Nucleotide join simultaneously in reaction quickly through " A ", " G ", " T " region in DNA profiling sequence, and the sequencing reaction applying single core thuja acid measures " C " content in DNA profiling sequence.Then, the sequencing reaction according to single core thuja acid measures " C " content in DNA profiling sequence, can determine methylation.
Below in conjunction with specific embodiment, the present invention will be further described.
Embodiment 1:
5 methylation sites analytical procedures of people's sample RAR β 2 Gene Promoter CpG Island, concrete grammar comprises:
(1) traditional protein kinase K and phenol/chloroform extraction process blood sample is adopted to extract genomic dna in peripheral blood;
(2) sodium bisulfite modifying factor group DNA: the operating process provided according to CpGenomeTurboBisulfiteModificationKit (Millipore company) carries out sodium bisulfite process to genomic dna, and purifying, the rear DNA of recovery modification;
(3) pcr amplification: PCR primer: 5 '-biotin-GTTGTTTGAGGATTGGGATG-3 ', 5 '-ATACCCAAACAAACCCTACTC-3 ' and the genomic dna of 200mg through sodium bisulfite process process, 0.2mMdNTP, 1UTaqDNA polysaccharase, 1 × amplification buffer, 1.8mMMgCl
250 μ LPCR amplification systems carry out 0 increasing, amplification condition is: 95 DEG C of initial denaturation 5min; 40 thermal cyclings are: 94 DEG C of sex change 30s, 54 DEG C of annealing 45s, 72 DEG C of extension 45s; Last 72 DEG C extend 7min;
(4) magnetic bead that pcr amplification product and Streptavidin are modified reacts, and makes the DNA chain of modified biological element be fixed on magnetic bead, sex change under 0.1MNaOH solution, is removed by another DNA chain loose; Then washing lotion (10mMTris-Acetate, pH7.6) is used to wash, the single-stranded DNA templates be fixed;
(5) by a copy of it single-stranded DNA templates template fixing to sequencing primer 5 '-CCCAAACAAACCCTACT-3 ' and magnetic bead at reaction system ((10mMTris-HCl, 2MNaCl, 1mMEDTA (sodium ethylene diamine tetracetate), 0.1%Tween20, pH7.6) 5min is hybridized at 80 DEG C, then naturally cool to room temperature, complete hybridization;
(6) burnt sequencing reaction system comprises 0.1MTris-Ac (pH7.7), 2mMEDTA (sodium ethylene diamine tetracetate), 10mMMg (Ac)
20.2%BSA (bovin serum albumin), 10mMDTT (two mercapto threitols), 10mMAPS (phosphosulfate gland), 0.4mg/mLPVP (polyvinylpyrrolidone), 4mMD-luciferin (luciferin), 2U/mLATPsulfurylase (adenosine triphosphate sulfurylase), 0.4mMluciferase (luciferase), 2U/mLapyraseVII (apyrase VII), 2U/mLDNA polysaccharase I (Klenowfragment, exo –); Burnt sequencing reaction system and above-mentioned (4) hybrid product are mixed for sequencing reaction;
(7) reaction system of above-mentioned (6) is placed in burnt sequenator (PSQ96MAsystem (BiotageAB, Uppsala, Sweden)), add two Nucleotide successively respectively according to the order of table 1 and carry out Jiao's order-checking, obtain by the base fragment coding information pattern 2 of the single sequencing reaction arranged according to sequencing (according to the Theoretical Calculation of table 1, if the number of single step sequencing reaction synthesizing ribonucleotide is more than 5, then setting carries out two secondary responses, to avoid building-up reactions portion complete); F is extracted according to Fig. 2
1, F
3, F
5, F
7f
9be converted into few nucleotide object information (peak intensity of 5au is equivalent to a Nucleotide), just can obtain x
1=0.31, x
2=0.42, x
3=0.37, x
4=0.47, x
5=0.51, be the methylation in five sites.
Table 1.100% methylates or does not methylate the theoretical sequencing result of PCR primer DNA profiling
| Sequencing reaction | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 |
| Nucleotide | G | AT | AC | G | CT | G | AC | G | CT | G | AC |
| DNA1 | 1 | 3 | 1 | 1 | 3 | 1 | 1 | 1 | 5 | 1 | 3 |
| DNA2 | 0 | 4 | 3 | 0 | 2 | 0 | 3 | 0 | 5 | 0 | 4 |
Note: AT represents (dATP α S+dTTP), the like
DNA1 represents 100% methylated DNA fragments: CTTAGCGAGCGCAAGAGCTGTAGGGTTAG
DNA2 represents 100% non-methylated DNA fragments: TTTAGTGAGTGTAAGAGTTGTAGGGTTAG
The above is only the preferred embodiment of the present invention; be noted that for those skilled in the art; under the premise without departing from the principles of the invention, can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
Claims (8)
1. the methylated method of burnt order-checking detection by quantitative, is characterized in that: step comprises: 1) DNA extraction; 2) bisulf iotate-treated; 3) pcr amplification; 4) check order; 5) association analysis;
Described step 4) sequence measurement be: according to specific two Nucleotide, dGTP feed postition carry out Jiao order-checking; Wherein, two Nucleotide measure serial response and obtain composite number object coded message, and dGTP measures serial response and obtains synthesizing information of number.
2. Jiao's order-checking detection by quantitative methylated method according to claim 1, is characterized in that: described step 4) concrete grammar comprise the following steps:
4-1) prepare single-stranded DNA templates: reacted by the magnetic bead that pcr amplification product and Streptavidin wrap up, the DNA chain of biotin modification is fixed on described magnetic bead, sex change under 0.05-0.2MNaOH solution; Another DNA chain loose is removed; Then wash liquid is used, the single-stranded DNA templates be fixed;
4-2) sequencing primer hybridization: by sequencing primer and described single-stranded DNA templates in hybridization system, place 5-10min at 70-80 DEG C, naturally cool to room temperature, complete hybridization;
4-3) checking order: with sequencing reaction system, with described step 4-2) hybrid product that obtains mix, and burnt order-checking is instead carried out according to specific two Nucleotide, dGTP feed postition.
3. Jiao's order-checking detection by quantitative methylated method according to claim 2, is characterized in that: described step 4-2) in, described sequencing primer be one section with one section of sequence of single-stranded DNA templates complete complementary.
4. the methylated method of Jiao's order-checking detection by quantitative according to claim 1 and 2, it is characterized in that: described step 4) in, the each sequencing reaction of two Nucleotide obtains the signal strength information of two Nucleotide synthesis order-checkings, the each sequencing reaction of dGTP obtains the signal strength information of single core thuja acid synthesis order-checking, described order-checking strength of signal is directly proportional to synthesizing ribonucleotide number, and namely the order-checking strength of signal of each sequencing reaction all can be converted into the number of Nucleotide synthesis.
5. Jiao's order-checking detection by quantitative methylated method according to claim 1, is characterized in that: described step 5) in, the information of number of the Nucleotide synthesis that each sequencing reaction of dGTP that obtains obtains of check order according to Jiao, this information of number is that to wrap be 0≤x
i≤ 1;
Described association analysis is: assuming that the methylated degree of C is x in an easy GC site
i, wherein 0≤x
i≤ 1, so, in this base sequence of PCR primer through bisulf iotate-treated, the DNA profiling sequence content containing " C " is x
i, containing by not methylated " T " DNA profiling sequence content be transformed of this base is then (1-x
i); According to the information of number of the Nucleotide synthesis that dGTP sequencing reaction obtains, the numerical value of xi can be obtained.
6. Jiao's order-checking detection by quantitative methylated method according to claim 1, is characterized in that: described step 2) in, adopt traditional bisulfite conversion method, or adopt commercially available test kit, implement according to its operating process.
7. the methylated method of Jiao's order-checking detection by quantitative according to claim 1, it is characterized in that: described step 3) in, pcr amplification PCR primer used is that 5 ' end is modified by vitamin H, amino or acrylamide group, react with the solid phase carrier of finishing streptavidin, carboxyl, or prepare single-stranded DNA templates with acrylamide monomer polyreaction.
8. the methylated method of Jiao's order-checking detection by quantitative according to claim 1 and 2, it is characterized in that: it is characterized in that: described specific two Nucleotide are analyzed fragment according to DNA profiling and determined, comprise (dCTP+dTTP), (dATP α S+dCTP), (dATP α S+dTTP).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510621381.XA CN105219851B (en) | 2015-09-25 | 2015-09-25 | A kind of burnt sequencing quantitatively detects the method to methylate |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510621381.XA CN105219851B (en) | 2015-09-25 | 2015-09-25 | A kind of burnt sequencing quantitatively detects the method to methylate |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105219851A true CN105219851A (en) | 2016-01-06 |
| CN105219851B CN105219851B (en) | 2018-05-25 |
Family
ID=54989117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510621381.XA Active CN105219851B (en) | 2015-09-25 | 2015-09-25 | A kind of burnt sequencing quantitatively detects the method to methylate |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105219851B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108624685A (en) * | 2018-01-15 | 2018-10-09 | 新开源弗莱（武汉）生物科技有限公司 | A kind of ABCG2 genetic polymorphism detections kit |
| CN108753958A (en) * | 2018-08-30 | 2018-11-06 | 中国医科大学附属盛京医院 | Detection primer, detection kit based on peripheral blood Sox10 gene methylations and its application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103740824A (en) * | 2014-01-09 | 2014-04-23 | 东南大学 | Method for identifying microbial population by use of real-time synthesis sequencing map of two nucleotides |
| CN104894246A (en) * | 2015-05-21 | 2015-09-09 | 东南大学 | Two-nucleotide synthetic sequencing analysis method for multi-template PCR product |
-
2015
- 2015-09-25 CN CN201510621381.XA patent/CN105219851B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103740824A (en) * | 2014-01-09 | 2014-04-23 | 东南大学 | Method for identifying microbial population by use of real-time synthesis sequencing map of two nucleotides |
| CN104894246A (en) * | 2015-05-21 | 2015-09-09 | 东南大学 | Two-nucleotide synthetic sequencing analysis method for multi-template PCR product |
Non-Patent Citations (2)
| Title |
|---|
| 张晓丹等: "焦测序技术及其在遗传分析中的应用", 《分析化学》 * |
| 李金慧等: "DNA甲基化分析方法及相关应用", 《癌变.畸变.突变》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108624685A (en) * | 2018-01-15 | 2018-10-09 | 新开源弗莱（武汉）生物科技有限公司 | A kind of ABCG2 genetic polymorphism detections kit |
| CN108753958A (en) * | 2018-08-30 | 2018-11-06 | 中国医科大学附属盛京医院 | Detection primer, detection kit based on peripheral blood Sox10 gene methylations and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105219851B (en) | 2018-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111032881B (en) | Accurate and large-scale parallel quantification of nucleic acids | |
| EP3828291A1 (en) | Methylation modification-based tumor marker stamp-ep1 | |
| CN107177670A (en) | A kind of method of high flux detection Parkinson's Disease-causing gene mutation | |
| CN102892899A (en) | Methods and compositions for noninvasive prenatal diagnosis of fetal aneuploidies | |
| CN103958696B (en) | Multiplexed nucleic acid analysis | |
| CN109952381A (en) | Method for Multiple detection methylate DNA | |
| CN104894246B (en) | A kind of method of two nucleotides synthesis order-checking analysis multi-template PCR primer | |
| EP3916092A1 (en) | Tumor marker stamp-ep5 based on methylated modification | |
| CN102433376A (en) | Fluorescence quenching-based genetic variation detection method and probe | |
| CN103898226B (en) | A kind of plastosome SNP fluorescence labeling composite amplification test kit and application thereof | |
| CN104313168B (en) | A kind of method of Primer selection synthesis sequencing analysis PCR primer haplotype | |
| CN105219851A (en) | A kind of methylated method of burnt order-checking detection by quantitative | |
| CN101671726B (en) | Method for detecting single nucleotide polymorphism (SNP) of ox PRDM16 gene | |
| CN115109843A (en) | Functional marking method for detecting variation of multiple rice trait control genes | |
| CN105296471B (en) | DNA label, PCR primer and application thereof | |
| CN105316320B (en) | DNA label, PCR primer and application thereof | |
| CN114438233B (en) | Synchronous typing detection system of X chromosome Multi-DIP for genetic relationship identification | |
| CN105256030B (en) | The method that one kind finds new mutation/SNP site based on the burnt sequencing of two nucleotide synthesis | |
| CN102605088B (en) | Method for rapidly detecting copy number variation of alpha-globin gene cluster | |
| CN105132573A (en) | Method for quantitative determination on methylation by two-nucleotide synthesis pyrosequencing | |
| CN104152568B (en) | High-throughput STR sequence core repeat number detection method | |
| CN110438226B (en) | Kit for detecting cis-trans mutation, sample processing method and judgment method | |
| CN106047990A (en) | Method for detecting SNP genotype/mutation of PCR product based on sequencing by synthesis of double nucleotides | |
| CN110343757A (en) | A kind of short tandem repeat general probe and its design method and application | |
| KR20200066944A (en) | Composition, kit for predicting weight control according to exercise, and method using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |