CN103898226B - A kind of plastosome SNP fluorescence labeling composite amplification test kit and application thereof - Google Patents
A kind of plastosome SNP fluorescence labeling composite amplification test kit and application thereof Download PDFInfo
- Publication number
- CN103898226B CN103898226B CN201410145409.2A CN201410145409A CN103898226B CN 103898226 B CN103898226 B CN 103898226B CN 201410145409 A CN201410145409 A CN 201410145409A CN 103898226 B CN103898226 B CN 103898226B
- Authority
- CN
- China
- Prior art keywords
- seqidno
- dna
- artificial sequence
- primer
- site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Chemical Kinetics & Catalysis (AREA)
Abstract
The present invention relates to a kind of plastosome SNP fluorescence labeling composite amplification test kit that simultaneously can detect 61 SNP site.This test kit, according to plastosome phylogenetic tree, in conjunction with the genetic characteristics of Chinese population, chooses 61 polymorphisms high, mutation rate is low, the SNP site that somatotype ability is strong, comprises 54, site, coding region, 7, site, control region, adopts Auele Specific Primer to detect these 61 SNP site.This test kit, as a plastosome detection system, is divided into three pipes to increase simultaneously, simultaneously electrophoresis, and haplotype diversity reaches 98.6%, can as the same maternal identification kit after euchromosome STR, Y chromosome STR.
Description
Technical field
The invention belongs in vitro diagnostic techniques field, what embody a concentrated reflection of is third generation genetic marker SNP(single nucleotide polymorphism, and the combined utilization of detection technique of fluorescence singlenucleotidepolymorphism), the DNA profiling of trace relatively can be utilized to determine the mtDNA Haplogroup of sample fast, be applicable to the maternal qualification of Mitochondrial DNA.
Background technology
Current medical jurisprudence is all detect euchromosome STR genetic marker for the test kit of individual recognition, owing to there is not linkage relationship between them and there is not association between the allelotrope of different genetic marker, so autosomal total matching probability is the product of the matching probability of each genetic marker when individual identifies, do not need ad infinitum to increase genetic marker when therefore carrying out individual recognition, the genetic marker of some amount just can meet the requirement of Forensic detection.And be applied to mitochondrial inheritance mark heredity in haplotype of medicolegal practice, whole Mitochondrial Genome Overview is equivalent to a genetic marker, therefore the individual recognition capability of inheritance of mitochondrion DNA mark does not calculate by product, improve mitochondrial individual recognition capability, only way finds exactly and applies more polymorphic genetic marker to cover more single times of realm type in mtDNA.
At present, SnaPshot detection method, probe hybridization development process, direct sequencing etc. are mainly contained for mtDNASNP detection method, SnaPshot detection technique refers to based on Cambridge standard sequence, each SNP designs 3 primers, wherein 2 is the amplification of object fragment, length in about 200-500bp, Tm value at about 60 degree.Article 3, primer be extend ddNTP, design in the upstream of SNP site or reverse downstream.First enrichment obtains object fragment, removes unnecessary dNTP through enzymic digestion, carries out single base extension again after primer and other single-stranded DNA product, and reaction product is again carried out capillary electrophoresis and detected the SNP information obtaining site after ferment treatment.This method design of primers is simple, synthesizes easy low price.But this method also has obvious limitation: the digestive ferment of partial purification is expensive; Complex operation step, workload is large; It is low that the site that PBR exists unknown mutation is detected as power, is in particular in that mitochondria control region site is detected as power low.
Current medical jurisprudence mainly adopts direct sequencing to the research of plastosome SNP, main detection mtDNA control region (HVI and HVII district), this section of sequence is in mtDNA copy-controlled areas length and is about 1122bp, due to its not coded protein, therefore selective pressure is little during evolution, determines that it is compared other regions and has more much higher state property.Obviously can obtain a large amount of information to this section of hypervariable region sequence order-checking, but because this region is originally as mutantional hotspot district, there is genetic instability, so specificity is still not aobvious.Research finds the specific pleomorphism site increasing coding region, effectively can expand the sensing range of plastosome single times of group, can significantly improve mitochondrial same maternal identification capacity.Complete sequence order-checking is the best way in theory, but carries out the order-checking of mtDNA complete sequence, and workload is large, and technical requirements is higher, is difficult to promote, and is not suitable in existing forensic laboratory, launch large-scale application.
The patent of Mitochondrial DNA research almost concentrates in the discussion to mitochondrial disease, and seldom relate in maternal qualification, the method of what only one section " a kind of method of detection line mitochondrial genes Haplogroup and application " adopted is oligonucleotide probe, Real_time quantitative detection method has highly sensitive, specificity is good, but it is low to there is flux simultaneously, the shortcomings such as primed probe design is complicated, are not suitable for carrying out large sample detection.
Summary of the invention
The appearance of plastosome SNP fluorescence labeling composite amplification test kit, for efficient rapid detection single nucleotide mutation provides approach.By setting up the pattern of mtDNA hypervariable region and coding region joint-detection, a kind of quick, efficient, reliable mtDNA Haplotyping A strategy and detection method can be set up.Identical with existing STR test kit working method, meet current forensic laboratory Personnel Skill Levels, and be applicable to large sample detection, have great application prospect.
The object of this invention is to provide a kind of plastosome SNP fluorescence labeling composite amplification test kit, adopt four look fluorescent labelling techniques, specificity fluorescent primer amplification detects, with FAM, HEX, TAMRA, SIZ fluorescent signal for detection signal in conjunction with capillary electrophoresis.Detect specific mtDNA by the collection of hereditary sequenator to fluorescent signal to suddenly change, therefore the present invention is increased to 61 sites on the basis of 35 SNP site (patent publication No.: CN103290108A) of applying for before, effectively can cover more single times of realm type.
Technical scheme is:
A kind of plastosome SNP fluorescence labeling composite amplification test kit, include the primer for following 61 SNP site that increase: G10398A, Norm9bpDel, C10873T, A3010G, A709G, C7196A, C12705T, C3970T, G13104A, G10310A, C5178A, G13928C, G6446A, C8414T, C8794T, C8793T, C16126T, G16129A, A15043G, C16311T, A8701G, A8697G, C4883T, C10400T, (CA) n, G1719A, C14668T, C12811T, C, T9824A, C9698T, A9123G, C7028T, G11719A, G8584A, A11251G, G8020A, G5460A, G2706A, C11215T, T4216C, G12372A, C16362T, C1541T, C8684T, G9477A, A4491G, G1811A, G16316A, A16319G, G9545A, C11944T, C152T, G14569A, C8964T, G10397A, G3348A, G4833A, G7600A, G5417A, C5442T, C15784T.
Further, above-mentioned primer is preferably as follows:
A709G, SEQIDNO.1-3; A3010G, SEQIDNO.4-6; C5178A, SEQIDNO.7-9; Norm9bpDel, SEQIDNO.10-11; G10398A, SEQIDNO.12-14; C10873T, SEQIDNO.15-17; C12705T, SEQIDNO.18-20; G13928C, SEQIDNO.21-23; C16311T, SEQIDNO.24-26; A15043G, SEQIDNO.27-29; C3970T, SEQIDNO.30-32; C8414T, SEQIDNO.33-35; G6446A, SEQIDNO.36-38; C7196A, SEQIDNO.39-41; G10310A, SEQIDNO.42-44; G13104A, SEQIDNO.45-47; C8793T and C8794T, SEQIDNO.48-51; C16126T and G16129A, SEQIDNO.52-55; C4883T, SEQIDNO.56-58; C10400T, SEQIDNO.59-61; (CA) n, SEQIDNO.62-63; G11719A, SEQIDNO.64-66; G1719A and C1541T, SEQIDNO.67-71; G8584A and A8701G and A8697G, SEQIDNO.72-77; A9123G, SEQIDNO.78-80; C7028T, SEQIDNO.81-83; C14668T, SEQIDNO.84-86; G2706A, SEQIDNO.87-89; G12372A, SEQIDNO.90-92; T4216C, SEQIDNO.93-95; A11251G and C11215T, SEQIDNO.96-100; G5460A, SEQIDNO.101-103; C12811T, SEQIDNO.104-106; G8020A, SEQIDNO.107-109; C, T9824A, SEQIDNO.110-112; C9698T, SEQIDNO.113-115; C16362T, SEQIDNO.116-118; C152T, SEQIDNO.119-121; G1811A, SEQIDNO.122-124; A4491G, SEQIDNO.125-127; G4833A, SEQIDNO.128-130; G5417A and C5442T, SEQIDNO.131-135; G7600A, SEQIDNO.136-138; C8684T, SEQIDNO.139-141; C8964T, SEQIDNO.142-144; G9477A and G9545A, SEQIDNO.145-149; G10397A, SEQIDNO.150-152; G3348A, SEQIDNO.153-155; C11944T, SEQIDNO.156-158; G14569A, SEQIDNO.159-161; C15784T, SEQIDNO.162-164; G16316A and A16319G, SEQIDNO.165-168.
In above primer, C8793T and C8794T, C16126T and G16129A, G16316A and A16319G, G11719A and G1719A, G8584A and A8701G and A8697G, A11251G and C11215T, C, T9824A and C9698T, G5417A and C5442T, G9477A and G9545A site share same forward primer.
Further, above primer is packet marking, and primer corresponding to G10398A, Norm9bpDel, C10873T, A3010G, A709G, C7196A, C12705T, C3970T, G13104A, G10310A, C5178A, G13928C, G6446A, C8414T, C8794T, C8793T, C16126T, G16129A, A15043G, C16311T site is first group; A8701G, A8697G, C4883T, C10400T, (CA) n, G1719A, C14668T, C12811T, C, primer corresponding to T9824A, C9698T, A9123G, C7028T, G11719A, G8584A, A11251G, G8020A, G5460A, G2706A, C11215T, T4216C, G12372A, C16362T, C1541T site is second group; Primer corresponding to C8684T, G9477A, A4491G, G1811A, G16316A, A16319G, G9545A, C11944T, C152T, G14569A, C8964T, G10397A, G3348A, G4833A, G7600A, G5417A, C5442T, C15784T site is the 3rd group.Above-described " first ", " second " and " the 3rd " do not form the restriction to precedence.
Wherein, 9824 sites have the situation that base is C, T or A, are described as C in the present invention, T9824A.
Further, the forward primer in above primer is fluorescently-labeled.
Further, in above primer, the forward primer of first group is marked by FAM; The forward primer of second group is marked by HEX; The forward primer of the 3rd group is marked by TAMRA.
Present invention also offers the using method of mentioned reagent box, concrete technical scheme is:
A using method for plastosome SNP fluorescence labeling composite amplification test kit, comprises the steps:
S1: extract Mitochondrial DNA, as mtDNA template from biological material; Described biological material can be hair, stub, tooth, cast-off cells, bone, blood, seminal stain, saliva etc.; The method of above DNA extraction method DNA can be paramagnetic particle method, Chelex-100 extraction method, silicon fiml method etc. are diluted to suitable concn after simply quantitatively;
S2: preparation PCR reaction solution, adds reaction buffer, Taq enzyme, composite primer, water, DNA profiling, adopts three step TRAP, increase to sample;
S3: carry out electrophoresis to amplified production, software analysis electrophoresis result also carries out Haplogroup somatotype.Need add in deionized formamide, molecular weight in race model hole during electrophoresis and mark; Interior target effect marks instruction in electrophoresis process.Can also allelic ladder be added, be used for and unknown sample comparison determination genotype.
The application of above test kit in case investigation, paternity test and corpse source are assert.
Beneficial effect
1, Mitochondrial DNA is divided into control region and coding region, wherein HVI and the HVII region mutation rate of control region is higher, for the part that current legal medical expert's plastosome mainly detects, but there are some researches show, the random coupling probability of HVI is 2%, HVII is 4%, control region is only relied on sometimes to be difficult to two independent individuals to make a distinction, therefore the present invention rationally avoids this shortcoming choosing of site, have employed 54 coding regions and site, 7 control regions joint-detection, the feature of the site high mutation rate of control region and site, coding region genetic stability is combined, greatly increase the distinguishing ability of test kit, optimize the multiplex PCR system of composite amplification SNP site, and DNA composite amplification is combined with capillary electrophoresis technique, drastically increase inspection speed and efficiency, surmounted the detection speed of existing detection method completely, the main detection method of case inspection and database establishment can be become.
2, the inventive method is reasonable in design, establishes a kind ofly novel to utilize fluorescent dye primer specific amplification in conjunction with the mtDNA Haplogroup classifying method of capillary electrophoresis technique;
3, sample strong adaptability, for the sample that some DNA extraction amounts are little, as bone, tooth and hair, this test kit still can detect preferably.Even when sample extraordinary obsolescence or severely degrade, the mtDNA in tenuigenin remains reliable detection material, and it is many that this has benefited from mtDNA copy number in cell, and be wrapped in by double-layer cell wall, not easily degrades;
4, the detection clip size of this test kit to SNP controls within 325bp, makes to be detected as power and greatly improves.Tradition STR detects failed situation still can successful somatotype;
5, apply plastosome SNP fluorescence detection reagent kit of the present invention and carry out maternal qualification, more traditional sequence measurement cost is low, easy and simple to handle, data analysis is simple, experimental result can be drawn in 3 ~ 4 hours, therefore can be used widely in the identification of extensive corpse source, paternity test, human origin and Study on Evolution.
Accompanying drawing explanation
Fig. 1 is the position view of plastosome SNP61 site layout viewing and interior mark siz-500 clip size;
Fig. 2 is the corresponding design of primers principle schematic of SNP site and contiguous site;
Fig. 3 a is that heterogeneity points test kit detects collection of illustrative plates;
Fig. 3 b is heterogeneity points test kit Sequencing chromatogram;
Fig. 4 a is sisterI sisterhood qualification collection of illustrative plates;
Fig. 4 b is sisterII sisterhood qualification collection of illustrative plates;
Fig. 5 a is that standard substance 9947A detects collection of illustrative plates;
Fig. 5 b is through the artificial reconstructed detection collection of illustrative plates with the DNA profiling of 9947A somatotype complementation.
Embodiment
By reference to the accompanying drawings the present invention is described in further detail below by embodiment.But it will be understood to those of skill in the art that the following example only for illustration of the present invention, and should not be considered as limiting scope of the present invention.Unreceipted concrete technology or condition person in embodiment, (such as show with reference to J. Pehanorm Brooker etc. according to the technology described by the document in this area or condition, " Molecular Cloning: A Laboratory guide " that Huang Peitang etc. translate, the third edition, Science Press) or carry out according to product description.Agents useful for same or the unreceipted production firm person of instrument, being can by the conventional products of commercial acquisition.
The choosing of embodiment 1 plastosome SNP site of the present invention, divide into groups, the foundation of design of primers and reaction system
1, SNP site screening
Reference line plastochondria phylogenetic tree (mtDNAtreeBuild16 (19Feb2014)), in conjunction with Chinese population inheritance of mitochondrion DNA feature, filters out the characteristic site of main chondriogen Haplogroup and hypotype thereof; 61 mtDNA characteristic sites are finally filtered out according to the polymorphism investigation of Chinese population mtDNA Haplogroup somatotype tree joint line plastochondria in Chinese population and literature survey, database analysis, all there is higher GD value, cover the main mtDNA Haplogroup of Chinese population and Main Subtype thereof.Wherein the site GD value of 73.7% is positioned at more than 0.2, and maximum value reaches 0.5.Ensure the distinguishing ability (selected 61 sites of the present invention and GD value see attached list 3) of human mtdna checking system.
Gene diversity (GD), by formula GD=N(1-∑ P
i 2)/(N-1) calculate, n is Sample size, P
ifor gene frequency.
The allelotrope in all 61 sites that table 1 the present invention relates to and site GD value
| SNP site | Allelotrope | GD value | SNP site | Allelotrope | GD value |
| 10398 | G,A | 0.50 | 11719 | G,A | 0.22 |
| 9bp | DEL,NORM | 0.30 | 8584 | G,A | 0.24 |
| 10873 | T,C | 0.45 | 11251 | A,G | 0.09 |
| 3010 | G,A | 0.32 | 8020 | G,A | 0.28 |
| 709 | G,A | 0.27 | 5460 | G,A | 0.22 |
| 7196 | C,A | 0.03 | 2706 | G,A | 0.19 |
| 12705 | C,T | 0.50 | 11215 | C,T | 0.23 |
| 3970 | C,T | 0.21 | 4216 | T,C | 0.09 |
| 13104 | G,A | 0.12 | 12372 | G,A | 0.14 |
| 10310 | G,A | 0.13 | 16362 | C,T | 0.36 |
| 5178 | C,A | 0.20 | 1541 | C,T | 0.30 |
| 13928 | G,C | 0.21 | 9698 | C,T | 0.17 |
| 6446 | G,A | 0.25 | 8684 | T,C | 0.23 |
| 8414 | C,T | 0.18 | 9477 | G,A | 0.23 |
| 8794 | C,T | 0.34 | 4491 | A,G | 0.14 |
| 8793 | C,T | 0.30 | 1811 | G,A | 0.16 |
| 15043 | A,G | 0.41 | 16319 | G,A | 0.18 |
| 16311 | C,T | 0.30 | 16316 | G,A | 0.19 |
| 16129 | A,G | 0.27 | 9545 | G,A | 0.40 |
| 16126 | C,T | 0.25 | 11944 | C,T | 0.12 |
| 8701 | A,G | 0.45 | 152 | C,T | 0.43 |
| 8697 | A,G | 0.50 | 14569 | G,A | 0.14 |
| 4883 | C,T | 0.20 | 8964 | C,T | 0.16 |
| 10400 | C,T | 0.39 | 10397 | G,A | 0.44 |
| CA | 3,4,5,6,7,8 | 0.51 | 3348 | G,A | 0.04 |
| 1719 | G,A | 0.34 | 4833 | G,A | 0.11 |
| 14668 | C,T | 0.18 | 7600 | G,A | 0.12 |
| 12811 | C,T | 0.42 | 5417 | G,A | 0.14 |
| 9824 | T,C,A | 0.35 | 5442 | C,T | 0.18 |
| 9123 | A,G | 0.11 | 15784 | C,T | 0.24 |
| 7028 | CT | 0.19 |
Note: Norm refers to the normal allelotrope of sequence length, and Del refers to the allelotrope lacking 9bp base.
2, design of primers
After determining SNP site, according to mutational site design specific detection primer (test kit characteristic site primer sequence is in table 2).By arranging artificial mutation, carry out groping one by one to the artificial mutation optimum position of every bar primer, and constructed plasmid corresponding to each SNP site and carry out primer test and screening, finally retained the high and primer of high specificity of efficiency, be used for assembly composite amplification system.
Each design of primers principle as shown in Figure 2, except indivedual contiguous site is as (C8793T and C8794T), (C16126T and G16129A), (G11719A and G1719A), (G8584A and A8701G and A8697G), (A11251G and C11215T), (C, T9824A and C9698T), (G5417A and C5442T), outside employing shared labeled primer in (G9477A and G9545A) site detects simultaneously, all there is each self-corresponding labeled primer in all the other sites, the primer of each SNP site is according to revised Cambridge reference sequences (revisedCambridgeReferenceSequence, rCRS) NC_012920.1 designs, wherein 5 ' the end of a F-primer marks with corresponding fluorescein, 3 ' end of two other non-marked primer is to allelic sequences specific recognition, article two, the wherein introducing 3 ~ 4 of arbitrary 5 ' end and the unpaired Nucleotide of template of nonstandard primer, general interpolation " TATA " base, minimum on the impact of primer TM value.Length difference due to two non-marked primers causes amplified production length different, and electrophoretic migration speed is different, finally reaches the object of detection.
Polymorphism both 9bp disappearance and (CA) n repeat shows as length polymorphism, and only need to design a F-primer and non-marked primer respectively, just can vary in size according to product is added on differentiation.
For most site, each site comprises two non-marked primers and a fluorescent dye primer, 3 ' of above-mentioned two primers hold last base pair allelotrope template to carry out specific recognition, in order to improve specific amplification further, artificial mismatches is being introduced apart from 3 ' end 2 ~ 7 base places, artificial mismatches position is also different from the specificity of 3 ' end distance different primers, through repeatedly groping to find, for the FAM that fluorescence efficiency is higher, the fluorescein-labeled primer of HEX, when artificial mismatches is best from primer mispairing specificity during 3 ' end the 2nd base place, the fluorescein-labeled primer of TAMRA for fluorescence efficiency difference, then artificial mismatches is placed in from 3 ' end the 3rd base place effect better.Following principle is then followed: if 3 ' end is strong mispairing (T-C, A-G match), then should introduce weak mispairing (A-C, G-T match) as the base introducing what type; If 3 ' end is moderate mispairing (A-A, G-G, C-C, T-T match), then just introduce moderate mispairing; If 3 ' end is weak mispairing, then should introduce strong mispairing.In addition, in order to improve allelic resolution, two non-marked primers are by holding plug-in 3 ~ 4 bases to make amplified production there is difference in length 5 ', and the allelotrope in each site then can reach the object of differentiation by amplified production length difference.Consider the needs of follow-up primer composite amplification, at this primer Tm designed all between 62 ~ 64 DEG C (TM value calculating method is nearest neighbor algorithm (thenearestneighbormethod)).
The primer that each site of table 2 is corresponding
Owing to there are differences between every bar primer efficiency, different to the dosage during amplification peak value making every bar primer will reach same in system, the proper operation concentration of each primer adopts primer concentration grads experiment to grope, and finally obtains the working concentration of each primer, as shown in table 3.
In composite primer, the working concentration of every bar primer is obtained by primer concentration grads experiment, every bar primer concentration does concentration gradient from 0.01 μM to 0.2 μM, spacing gradient is 0.02 μM, do single larger primer concentration scope of acquisition one that expands then to organize the examination of multiple expansion primer repetition measurement and finely tune primer concentration further, most important index to occur non-specific peak; According to detected result, select the peak height RFU primer concentration between 2000 ~ 2500 as preferably.
The final concentration in amplification system of the primer in each site of table 3 test kit
3, the SNP assembled scheme design of fluorescence labeling composite amplification system
In test kit provided by the invention, the upstream primer (F-primer) of the correspondence of each SNP site can be marked by isotropic substance, fluorescein, compares and finds that fluorescein-labelled effect is better.Corresponding downstream primer (R-primer) is the primer be not labeled.
The present invention has carried out discriminating to fluorescence dye, has selected, and has selected blue, green, black, orange four kinds of fluorescent markers, has constructed four look fluorescence assembled schemes.
On the basis determining 4 look fluorescence assembled schemes, by repeatedly testing in a large number, follow low fluorescein-labelled as TAMRA of the high use fluorescence efficiency of primer efficiency, high fluorescein-labelled as FAM of primer inefficient use fluorescence efficiency, primer efficiency hold in the principle being labeled as HEX.Find out the fluorescent mark type in 61 SNP site array modes and each site, 61 SNP site are divided into 3 groups, in molecular weight, mark marks with orange fluorescence dye SIZ.Being combined as of the fluorochrome label finally determined: wherein the F-primer in these 20 sites of G10398A, Norm9bpDel, C10873T, A3010G, A709G, C7196A, C12705T, C3970T, G13104A, G10310A, C5178A, G13928C, G6446A, C8414T, C8794T, C8793T, C16126T, G16129A, A15043G, C16311T is marked by FAM.A8701G, A8697G, C4883T, C10400T, (CA) n, G1719A, C14668T, C12811T, C, the F-primer in these 23 sites of T9824A, C9698T, A9123G, C7028T, G11719A, G8584A, A11251G, G8020A, G5460A, G2706A, C11215T, T4216C, G12372A, C16362T, C1541T is marked by HEX.The F-primer in these 18 sites of C8684T, G9477A, A4491G, G1811A, G16316A, A16319G, G9545A, C11944T, C152T, G14569A, C8964T, G10397A, G3348A, G4833A, G7600A, G5417A, C5442T, C15784T is marked by TAMRA.On the one hand can arrangement site as much as possible by this packet mode, cover more Haplogroup; Can make the non-object band produced because of the interphase interaction of primer outside software monitors scope on the other hand, in actual use, the primer of FAM color marker and corresponding nonstandard primer thereof are formulated as FAM look composite primer; In like manner prepare HEX look composite primer and TAMRA look composite primer.Interior mark selects fluorescent orange to mark, fluorescent marker is SIZ (preparation method marks with reference in the siz500 fluorescent mark of our company's independent research disclosed in patent CN101307226,13 fluorescent mark fragments altogether: 75bp, 100bp, 139bp, 150bp, 160bp, 200bp, 250bp, 300bp, 340bp, 350bp, 400bp, 450bp, 500bp).This SNP site array mode makes only to need mark 4 kinds of fluorescence just can realize these 61 SNP site and detects analysis simultaneously.Four look layout viewings are shown in Fig. 1.
Two cover positive controls are also included in test kit, a set of is 9947A, and another set of is the engineered DNA sequence dna of each site somatotype complementation with 9947A, and positive control is as the positive quality control product of each experiment, for monitoring the exactness of PCR amplification system, get rid of false negative; Negative control, for controlling the pollution condition preparing plant process, gets rid of false positive.As follows with the artificial sequence preparation method of 9947A somatotype complementation: successively to adopt rite-directed mutagenesis, fusion DNA vaccine and clone technology obtain, first according to each site allelic information of 9947A, design another allelic rite-directed mutagenesis primer of each site, catastrophe point is placed in the middle of primer, primer TM value about 78 DEG C and upstream and downstream primer just reverse complemental, amplify each fragment like this due to containing complementary sequence, can be directly used in next step and merge the fusion product that amplification obtains each fragment, fusion product is proceeded in DH5 α preserve through being cloned into pMD18-T, extract plasmid and be standard substance.
Primer in test kit of the present invention, through strict design and checking, has specific amplification and the species specificity of height.3, amplification and product detect
(1) preparation of the PCR reaction system outside removing template is first completed on ice, finally add template, positive control and negative control after the first sample to be checked of template addition sequence, the Taq enzyme in the present embodiment test kit adopts the warm start high temperature resistant enzyme disclosed in patent publication No. CN101050453; When extracting Mitochondrial DNA template, the DNA dilution 50 ~ 100 times preferably will will extracted, in actually operating, the mtDNA template generally can getting 1 ~ 2 μ l increases.Concrete dosage is as shown in table 4.
Table 4 test kit amplification system
(2) brief centrifugation after above-mentioned system preparation, is placed on thermal cycler, increases according to the program shown in table 5.
Table 5 plastosome SNP detection kit amplification amplification program
(3) amplified production detects and interpretation of result
Adopt that the supporting molecular weight of DNA denaturing agent deionized formamide and test kit is interior to be marked (AGCUMarkerSIZ-500) and form loading mixed solution for 12:0.5 mixes by volume.12.5 μ L loading mixed solutions and 1 μ L amplified production and the supporting alleles analysis standard substance of test kit are mixed, after mixing, brief centrifugation removes bubble.Place 3min on ice immediately after 98 DEG C of sex change 5min, carry out electrophoresis detection with genetic analyzer ABI3100, GeneMapperIDv3.2 software is analyzed result.
To standard substance 9947A and through the artificial reconstructed result increased respectively with the DNA profiling of 9947A somatotype complementation as shown in figure 5 a and 5b, can find out that the amplified production peak between each site is obvious, occur without other non-specific amplification product.
In fig 5 a, each site detected of the first row is:
10398,9bp, 10873,3010,709,7196,12705,3970,13104,10310,5178,13928,6446,8414,8794,15043,16311, (16126 and 16129).
Each site detected of second row is:
8701、4883、10400、(CA)n、1719、14668、12811、9824、9123、7028、11719、8584、11251、8020、5460、2706、11215、4216、12372、16362、9698、1541。
Each site detected of the third line is:
8684,9477,4491,1811, (16316 and 16319), 9545,11944,152,14569,8964,10397,3348,4833,7600,5417,5442,15784.
The Accuracy Verification of embodiment 2 plastosome SNP of the present invention detection kit and large sample test
Adopt the primer in embodiment 1, grouping fluorescent mark and amplification system and parameter, carry out large sample plastosome SNP and detect, altogether random selecting 200 Han nationality and 200 Uygur nationality crowd samples, sample increases with test kit after extracting, and shows: Han nationality main genotyping result D4*, B5 through electrophoresis detection result, D5a, and D4b2 accounts for 7% respectively, 6.5%, 4.5%, and 4.5%, D4* in Uygur nationality crowd equally, T, 7.5%, 7% is accounted for respectively with W, and 6%.Han nationality is as the offspring of ancient race of China, and its diffusion profile meets De meter Qi diffusion model.At population Onset, between it and multiple nationality, there is gene exchange; For the Uygur nationality, their somatotype has at least 12 haplotypes and European and other ethnic groups common, and this demonstrates the Uygur nationality and has European and gook mixes blood lineage.400 increments originally divide into 106 kinds of haplotypes altogether, and resolving power reaches 98.6%.In order to verify the accuracy of test kit, random choose three samples in each site use the BigDye sequencing kit direct Sequencing of AB companies, both result displays are completely the same, the sufficient proof accuracy of this test kit, can be used in mtDNASNP and detect and analyze.
Embodiment 3 test kit provided by the present invention is to the detection of mtDNASNP site heterogeneity
The existence of mtDNA heterogeneity, brings uncertainty to medicolegal same maternal qualification, should evaluate accordingly in actual case.International medicolegal genetics meeting (InternationalSocietyforForensicGenetics, ISFG) specifies, if run into two samples to occur a base difference, and this base positions to be recognized be heterogeneous focus, then can not get rid of; When running into two base positions and being different, if two positions are all heterogeneous focuses, then can not get rid of, otherwise can not judge; When appearance three positions are different, eliminating conclusion can be made.Test kit provided by the present invention, not only can realize the detection of general SNP site, and still can successfully detect when site exists heterogeneous.In actual sample detects, find that in the Uygur nationality 200 increment basis, some sample 16319 site exists heterogeneous, and adopt direct Sequencing method validation, the two result is consistent, test kit detects electrophoretogram and Sequencing chromatogram is shown in accompanying drawing 3, wherein 3a is that heterogeneity points test kit detects collection of illustrative plates, and 3b is heterogeneity points Sequencing chromatogram.
The application of embodiment 4 test kit provided by the present invention in maternal relation qualification
Test kit provided by the present invention serves booster action in the relation qualification case of a routine doubtful sister, improves the confidence level of this routine maternal relation qualification case from matrilinear inheritance angle.
1, determination step is as follows:
(1) hair swatch in case to be identified is collected: sisterhood qualification sample is provided by certain forensic science laboratory.
(2) sample Mitochondrial DNA extracts: take DTT to digest and extract in conjunction with Chelex method.
(3) augmentation detection: the SNP carrying out Mitochondrial DNA according to test kit implementation step in embodiment 1 detects, the genotyping result of sisterI is shown in Fig. 4 a, the genotyping result of sisterII is shown in Fig. 4 b, and its comparing result sees the following form 6, and different sites is shown by bold Italic.
Plastosome 61 Genotypings of table 6sisterI and sisterII
Result shows: there are 7 differences in detected result 61 sites of the plastosome SNP of sisterI and sisterII, carrying out haplotype analysis display sisterI according to plastosome phylogenetic tree is G type, sisterII is C type, can to get rid of their possibility from same maternal family in conjunction with these 2.
The explanation of above embodiment just understands method of the present invention and core concept thereof for helping.It should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention, can also carry out some improvement and modification to the present invention, these improve and modify and also fall in the protection domain of the claims in the present invention.To the above-mentioned explanation of the disclosed embodiments, professional and technical personnel in the field are realized or uses the present invention.To be apparent for those skilled in the art to the multiple amendment of these embodiments, General Principle as defined herein can without departing from the spirit or scope of the present invention, realize in other embodiments.Therefore, the present invention can not be restricted in these embodiments shown in this article, but can be applied to and meet the wider scope consistent with principle disclosed herein and features of novelty.
SEQUENCELISTING
<110> Shanghai Jin Bo Bioisystech Co., Ltd
Zhongde Meilian Biotech Co., Ltd. Wuxi
Shanghai City science and technology concerning criminal matters research institute
<120> plastosome SNP fluorescence labeling composite amplification test kit and application thereof
<130>none
<160>168
<170>PatentInversion3.5
<210>1
<211>25
<212>DNA
<213> artificial sequence
<400>1
tatattacacatgcaagcatccaca25
<210>2
<211>21
<212>DNA
<213> artificial sequence
<400>2
ttacacatgcaagcatcccag21
<210>3
<211>28
<212>DNA
<213> artificial sequence
<400>3
tttattgctaaaggttaatcactgctgt28
<210>4
<211>22
<212>DNA
<213> artificial sequence
<400>4
ggtgttggatcaggacatcgcg22
<210>5
<211>26
<212>DNA
<213> artificial sequence
<400>5
attagatgttggatcaggacatctca26
<210>6
<211>23
<212>DNA
<213> artificial sequence
<400>6
gtcctttcgtacagggaggaatt23
<210>7
<211>29
<212>DNA
<213> artificial sequence
<400>7
attactactatctcgcacctgaaacatga29
<210>8
<211>25
<212>DNA
<213> artificial sequence
<400>8
ctactatctcgcacctgaaacaacc25
<210>9
<211>28
<212>DNA
<213> artificial sequence
<400>9
ggcgtaggtagaagtagaggttaaggag28
<210>10
<211>27
<212>DNA
<213> artificial sequence
<400>10
ttaatgctaagttagctttacagtggg27
<210>11
<211>22
<212>DNA
<213> artificial sequence
<400>11
aaaccacagtttcatgcccatc22
<210>12
<211>27
<212>DNA
<213> artificial sequence
<400>12
agtgactacaaaaaggattagactgcg27
<210>13
<211>30
<212>DNA
<213> artificial sequence
<400>13
acatgtgactacaataaggattagacttra30
<210>14
<211>28
<212>DNA
<213> artificial sequence
<400>14
gagagtagctataatgaacagcgatagt28
<210>15
<211>28
<212>DNA
<213> artificial sequence
<400>15
ttacagcctaattattagaatcatgctc28
<210>16
<211>25
<212>DNA
<213> artificial sequence
<400>16
cagcataattattagcatcagcctt25
<210>17
<211>29
<212>DNA
<213> artificial sequence
<400>17
ggggtaggagtcaggtagttagtattagg29
<210>18
<211>31
<212>DNA
<213> artificial sequence
<400>18
cattaatcagttcttcaaatatctactcctc31
<210>19
<211>35
<212>DNA
<213> artificial sequence
<400>19
catacattaatcagttcttcaaatatctactaatt35
<210>20
<211>19
<212>DNA
<213> artificial sequence
<400>20
gaatggctgctgtgttggc19
<210>21
<211>25
<212>DNA
<213> artificial sequence
<400>21
ccaacatactcggattctacccaag25
<210>22
<211>29
<212>DNA
<213> artificial sequence
<400>22
attaccaacatactcggattctaccatac29
<210>23
<211>28
<212>DNA
<213> artificial sequence
<400>23
gggaagaagaaagagaggaagtaaagtt28
<210>24
<211>30
<212>DNA
<213> artificial sequence
<400>24
tatacctactcacccttaacagtacatcgt30
<210>25
<211>26
<212>DNA
<213> artificial sequence
<400>25
cctactcacccttaacagtacctagc26
<210>26
<211>24
<212>DNA
<213> artificial sequence
<400>26
tgtcttatttaaggggaacgtgtg24
<210>27
<211>23
<212>DNA
<213> artificial sequence
<400>27
cctgcctcttcctagacatctga23
<210>28
<211>27
<212>DNA
<213> artificial sequence
<400>28
atattctacctcttcctacacatcgtg27
<210>29
<211>25
<212>DNA
<213> artificial sequence
<400>29
taaagaatcgtgtgagggtgggact25
<210>30
<211>31
<212>DNA
<213> artificial sequence
<400>30
attagtttatgtattcggctatgaagaatta31
<210>31
<211>27
<212>DNA
<213> artificial sequence
<400>31
gtttatgtattcggctataaagaatcg27
<210>32
<211>26
<212>DNA
<213> artificial sequence
<400>32
acaagaacacctctgattactcctgc26
<210>33
<211>29
<212>DNA
<213> artificial sequence
<400>33
tatagggtgatgaggaatagtgtaagtaa29
<210>34
<211>25
<212>DNA
<213> artificial sequence
<400>34
atatgatgaggaatagtgtaaggcg25
<210>35
<211>27
<212>DNA
<213> artificial sequence
<400>35
aagttaaagattaagagaaccaacacc27
<210>36
<211>23
<212>DNA
<213> artificial sequence
<400>36
ctgccataacccaataccacacg23
<210>37
<211>27
<212>DNA
<213> artificial sequence
<400>37
tatactgccataacccaataccataca27
<210>38
<211>28
<212>DNA
<213> artificial sequence
<400>38
gtaggataagaatataaacttcagggtg28
<210>39
<211>25
<212>DNA
<213> artificial sequence
<400>39
aactttcttcccacaacactttcac25
<210>40
<211>29
<212>DNA
<213> artificial sequence
<400>40
attaaactttcttcccacaacactttata29
<210>41
<211>25
<212>DNA
<213> artificial sequence
<400>41
cgaaggcttctcaaatcatgaaaat25
<210>42
<211>25
<212>DNA
<213> artificial sequence
<400>42
atgagccctacaaacaactaacgtg25
<210>43
<211>29
<212>DNA
<213> artificial sequence
<400>43
atatatgagccctacaaacaactaacata29
<210>44
<211>24
<212>DNA
<213> artificial sequence
<400>44
taaatgaggggcatttggtaaata24
<210>45
<211>24
<212>DNA
<213> artificial sequence
<400>45
tcaagcactatagttgtagcacgg24
<210>46
<211>27
<212>DNA
<213> artificial sequence
<400>46
cactcaagcactatagttgtagctcga27
<210>47
<211>25
<212>DNA
<213> artificial sequence
<400>47
gtcctagttgacttgaagtggagaa25
<210>48
<211>19
<212>DNA
<213> artificial sequence
<400>48
cctcctcggactcctgcgc19
<210>49
<211>21
<212>DNA
<213> artificial sequence
<400>49
acctcctcggactcctgcatc21
<210>50
<211>23
<212>DNA
<213> artificial sequence
<400>50
atacctcctcggactcctgactt23
<210>51
<211>23
<212>DNA
<213> artificial sequence
<400>51
agtaatgttagcggttaggcgta23
<210>52
<211>25
<212>DNA
<213> artificial sequence
<400>52
ggtggtcaagtatttatggtagcgt25
<210>53
<211>28
<212>DNA
<213> artificial sequence
<400>53
caggtggtcaagtatttatggtactgga28
<210>54
<211>30
<212>DNA
<213> artificial sequence
<400>54
attaggtggtcaagtatttatggtagtgtg30
<210>55
<211>28
<212>DNA
<213> artificial sequence
<400>55
acctaattgaaaacaaaatactcaaatg28
<210>56
<211>25
<212>DNA
<213> artificial sequence
<400>56
tctcacatgacaataactagccgac25
<210>57
<211>29
<212>DNA
<213> artificial sequence
<400>57
attatataacatgacaaatactagcccgt29
<210>58
<211>25
<212>DNA
<213> artificial sequence
<400>58
ctgcctgctatgatggataagattg25
<210>59
<211>30
<212>DNA
<213> artificial sequence
<400>59
ggcgttttgtttaaactatataccaatacg30
<210>60
<211>34
<212>DNA
<213> artificial sequence
<400>60
attattagttttgtttaaactatataccaaatca34
<210>61
<211>29
<212>DNA
<213> artificial sequence
<400>61
gccactaatagttatgtcatccctcttat29
<210>62
<211>22
<212>DNA
<213> artificial sequence
<400>62
ttcccctcccactcccatacta22
<210>63
<211>24
<212>DNA
<213> artificial sequence
<400>63
atgtgagcccgtctaaacattttc24
<210>64
<211>30
<212>DNA
<213> artificial sequence
<400>64
tataggcagaatagtaatgaggatgtaatt30
<210>65
<211>26
<212>DNA
<213> artificial sequence
<400>65
ggcagaatagtaatgaggatgtaacc26
<210>66
<211>25
<212>DNA
<213> artificial sequence
<400>66
cccttccttgtactatccctatgag25
<210>67
<211>25
<212>DNA
<213> artificial sequence
<400>67
tcaccttactaccagacaacctgag25
<210>68
<211>29
<212>DNA
<213> artificial sequence
<400>68
tataccaccttactaccagacaaccgtaa29
<210>69
<211>25
<212>DNA
<213> artificial sequence
<400>69
acatttaactaaaacccctacggac25
<210>70
<211>29
<212>DNA
<213> artificial sequence
<400>70
taggacatttaactaaaacccctactcat29
<210>71
<211>27
<212>DNA
<213> artificial sequence
<400>71
agtccttgctatattatgcttggttat27
<210>72
<211>20
<212>DNA
<213> artificial sequence
<400>72
aatcctaggcctacccgtcg20
<210>73
<211>24
<212>DNA
<213> artificial sequence
<400>73
atataatcctargcctaccctcca24
<210>74
<211>26
<212>DNA
<213> artificial sequence
<400>74
caaactaacctcaaaacaaatgatcg26
<210>75
<211>29
<212>DNA
<213> artificial sequence
<400>75
atacaaactaacctcaaaacaaatgagaa29
<210>76
<211>27
<212>DNA
<213> artificial sequence
<400>76
ctaatcaaactaacctcaaaacaacta27
<210>77
<211>25
<212>DNA
<213> artificial sequence
<400>77
ggttagttgtggcaataaaaatgat25
<210>78
<211>28
<212>DNA
<213> artificial sequence
<400>78
tatagcgacagcgatttctaggatattc28
<210>79
<211>24
<212>DNA
<213> artificial sequence
<400>79
gcgacagcgatttctaggatactt24
<210>80
<211>26
<212>DNA
<213> artificial sequence
<400>80
gaaaccatcagcctactcattcaacc26
<210>81
<211>24
<212>DNA
<213> artificial sequence
<400>81
cgagaaagtgttgtgggaagaaag24
<210>82
<211>29
<212>DNA
<213> artificial sequence
<400>82
aaaaacacgacacgtactacgttctagct29
<210>83
<211>25
<212>DNA
<213> artificial sequence
<400>83
acacgacacgtactacgttgtttcc25
<210>84
<211>26
<212>DNA
<213> artificial sequence
<400>84
ttttcagaataataacacacccgacc26
<210>85
<211>29
<212>DNA
<213> artificial sequence
<400>85
aaaatgtagtccgtgcgagaataatgata29
<210>86
<211>25
<212>DNA
<213> artificial sequence
<400>86
tgtagtccgtgcgagaatattgatg25
<210>87
<211>24
<212>DNA
<213> artificial sequence
<400>87
ataatattctcgtcttgctgtggc24
<210>88
<211>28
<212>DNA
<213> artificial sequence
<400>88
attaatagtcttctcgtattgctgtgat28
<210>89
<211>24
<212>DNA
<213> artificial sequence
<400>89
aaaggaactcggcaaatcttaccc24
<210>90
<211>26
<212>DNA
<213> artificial sequence
<400>90
tatagatggggggaattagggaactc26
<210>91
<211>22
<212>DNA
<213> artificial sequence
<400>91
gatggggggaattagggatgtt22
<210>92
<211>22
<212>DNA
<213> artificial sequence
<400>92
ccgacatcatyaccgggttttc22
<210>93
<211>27
<212>DNA
<213> artificial sequence
<400>93
ccctcaccctagcattacttatatcat27
<210>94
<211>31
<212>DNA
<213> artificial sequence
<400>94
atttcactcaccctagcattacttatataac31
<210>95
<211>22
<212>DNA
<213> artificial sequence
<400>95
gggtataaccaacattttcggg22
<210>96
<211>21
<212>DNA
<213> artificial sequence
<400>96
cttcccctactcatcgcccta21
<210>97
<211>25
<212>DNA
<213> artificial sequence
<400>97
tatacttcccctactcatcgctctg25
<210>98
<211>25
<212>DNA
<213> artificial sequence
<400>98
agcaggcacatacttcctattcttc25
<210>99
<211>27
<212>DNA
<213> artificial sequence
<400>99
atcgcaggcacatacttcctattatat27
<210>100
<211>22
<212>DNA
<213> artificial sequence
<400>100
cggcaagtactattgacccagc22
<210>101
<211>25
<212>DNA
<213> artificial sequence
<400>101
tatacattcctccccacactcacca25
<210>102
<211>21
<212>DNA
<213> artificial sequence
<400>102
cattcctccccacactcttcg21
<210>103
<211>24
<212>DNA
<213> artificial sequence
<400>103
agtgtttgtgggtttaagtcccat24
<210>104
<211>22
<212>DNA
<213> artificial sequence
<400>104
attaggcatctgctcgggccta22
<210>105
<211>19
<212>DNA
<213> artificial sequence
<400>105
aggcatctgctcgggggtg19
<210>106
<211>24
<212>DNA
<213> artificial sequence
<400>106
cccaaacattaatcagttcttcaa24
<210>107
<211>30
<212>DNA
<213> artificial sequence
<400>107
tataacgttgacaatcgagtagtacttcca30
<210>108
<211>26
<212>DNA
<213> artificial sequence
<400>108
acgttgacaatcgagtagtactctcg26
<210>109
<211>25
<212>DNA
<213> artificial sequence
<400>109
aggggaattaattctaggacgatgg25
<210>110
<211>25
<212>DNA
<213> artificial sequence
<400>110
ataatacacaggcttccacggtcta25
<210>111
<211>23
<212>DNA
<213> artificial sequence
<400>111
tatacacaggcttccacggcctc23
<210>112
<211>20
<212>DNA
<213> artificial sequence
<400>112
atacaggcttccacgggctt20
<210>113
<211>28
<212>DNA
<213> artificial sequence
<400>113
caaatagagacccagtaaaattgtattg28
<210>114
<211>32
<212>DNA
<213> artificial sequence
<400>114
tagtaaaatagagacccagtaaaattgtcata32
<210>115
<211>28
<212>DNA
<213> artificial sequence
<400>115
gagacatacagaaatagtcaaaccacat28
<210>116
<211>25
<212>DNA
<213> artificial sequence
<400>116
acattacagtcaaatcccttcttgt25
<210>117
<211>28
<212>DNA
<213> artificial sequence
<400>117
atatcattacagtcaaatcccttctagc28
<210>118
<211>23
<212>DNA
<213> artificial sequence
<400>118
ataccaaatgcatggagagctcc23
<210>119
<211>28
<212>DNA
<213> artificial sequence
<400>119
atattgaacgtaggtgcgataaatatta28
<210>120
<211>25
<212>DNA
<213> artificial sequence
<400>120
ttgaacgtaggtgcgataaatactg25
<210>121
<211>25
<212>DNA
<213> artificial sequence
<400>121
ataagacatcacgatggatcacagg25
<210>122
<211>29
<212>DNA
<213> artificial sequence
<400>122
atgttagtccttgctatattatgctttgc29
<210>123
<211>32
<212>DNA
<213> artificial sequence
<400>123
tataggttagtccttgctatattatgctaggt32
<210>124
<211>25
<212>DNA
<213> artificial sequence
<400>124
accttactaccagacaaccttagcc25
<210>125
<211>25
<212>DNA
<213> artificial sequence
<400>125
ctgcaaagatggtagagtagacgat25
<210>126
<211>29
<212>DNA
<213> artificial sequence
<400>126
attcctgcaaagatggtagagtagattac29
<210>127
<211>24
<212>DNA
<213> artificial sequence
<400>127
accccatcctaaagtaaggtcagc24
<210>128
<211>21
<212>DNA
<213> artificial sequence
<400>128
acccagaggttacccaagtcg21
<210>129
<211>24
<212>DNA
<213> artificial sequence
<400>129
tatacccagaggttacccaatgca24
<210>130
<211>26
<212>DNA
<213> artificial sequence
<400>130
tatgttagggttgtacggtagaactg26
<210>131
<211>23
<212>DNA
<213> artificial sequence
<400>131
gggtgggttttgtatgttcatac23
<210>132
<211>26
<212>DNA
<213> artificial sequence
<400>132
tataggtgggttttgtatgttctaat26
<210>133
<211>21
<212>DNA
<213> artificial sequence
<400>133
agcgatgagtgtggggagcag21
<210>134
<211>23
<212>DNA
<213> artificial sequence
<400>134
atagtgatgagtgtggggacgaa23
<210>135
<211>23
<212>DNA
<213> artificial sequence
<400>135
gcacctgaaacaagctaacatga23
<210>136
<211>27
<212>DNA
<213> artificial sequence
<400>136
gaagtagcgtcttgtagacctactagt27
<210>137
<211>24
<212>DNA
<213> artificial sequence
<400>137
gtagcgtcttgtagacctactggc24
<210>138
<211>24
<212>DNA
<213> artificial sequence
<400>138
gtagaagaaccctccataaacctg24
<210>139
<211>27
<212>DNA
<213> artificial sequence
<400>139
tacccaacaatgactaatcaaactcac27
<210>140
<211>24
<212>DNA
<213> artificial sequence
<400>140
ccaacaatgactaatcaaacgaat24
<210>141
<211>25
<212>DNA
<213> artificial sequence
<400>141
catttttaatcttagagcgaaagcc25
<210>142
<211>22
<212>DNA
<213> artificial sequence
<400>142
aggttgaatgagtaggctgttg22
<210>143
<211>25
<212>DNA
<213> artificial sequence
<400>143
atttggttgaatgagtaggcttata25
<210>144
<211>24
<212>DNA
<213> artificial sequence
<400>144
tttattgccacaactaacctcctc24
<210>145
<211>24
<212>DNA
<213> artificial sequence
<400>145
ataaaatcctgcgaagaaaaacac24
<210>146
<211>27
<212>DNA
<213> artificial sequence
<400>146
atagaaaaatcctgcgaagaaaacaat27
<210>147
<211>20
<212>DNA
<213> artificial sequence
<400>147
atgttgggggccagtgaccc20
<210>148
<211>23
<212>DNA
<213> artificial sequence
<400>148
ataatattgggggccagtgtcct23
<210>149
<211>21
<212>DNA
<213> artificial sequence
<400>149
caaagcacataccaaggccac21
<210>150
<211>27
<212>DNA
<213> artificial sequence
<400>150
gagtgactacaaaaaggattagacttg27
<210>151
<211>30
<212>DNA
<213> artificial sequence
<400>151
atagagtgactacaaaaaggattagactca30
<210>152
<211>28
<212>DNA
<213> artificial sequence
<400>152
gagagtagctataatgaacagcgatagt28
<210>153
<211>28
<212>DNA
<213> artificial sequence
<400>153
attcctactcctcattgtacccatacta28
<210>154
<211>25
<212>DNA
<213> artificial sequence
<400>154
cctactcctcattgtacccattgtg25
<210>155
<211>23
<212>DNA
<213> artificial sequence
<400>155
ggggttcatagtagaagagcgat23
<210>156
<211>27
<212>DNA
<213> artificial sequence
<400>156
tcctgatcaaatatcactctcctaatc27
<210>157
<211>30
<212>DNA
<213> artificial sequence
<400>157
tatacctgatcaaatatcactctcctcctt30
<210>158
<211>24
<212>DNA
<213> artificial sequence
<400>158
agaatgggggataggtgtatgaac24
<210>159
<211>24
<212>DNA
<213> artificial sequence
<400>159
aggggtttagtattgattgttcgc24
<210>160
<211>27
<212>DNA
<213> artificial sequence
<400>160
tatcggggtttagtattgattgtgagt27
<210>161
<211>24
<212>DNA
<213> artificial sequence
<400>161
ctaaccccactaaaacactcacca24
<210>162
<211>25
<212>DNA
<213> artificial sequence
<400>162
tgctacttgtccaatgatggtaatg25
<210>163
<211>28
<212>DNA
<213> artificial sequence
<400>163
atatgctacttgtccaatgatggtcaaa28
<210>164
<211>21
<212>DNA
<213> artificial sequence
<400>164
ggcgacccagacaattatacc21
<210>165
<211>23
<212>DNA
<213> artificial sequence
<400>165
tgctatgtacggtaaatggctgc23
<210>166
<211>27
<212>DNA
<213> artificial sequence
<400>166
attgtgctatgtacggtaaatggttgt27
<210>167
<211>25
<212>DNA
<213> artificial sequence
<400>167
tatgctatgtacgataaatggtgtc25
<210>168
<211>23
<212>DNA
<213> artificial sequence
<400>168
ccccatgcttacaagcaagtaca23
Claims (4)
1. a plastosome SNP fluorescence labeling composite amplification test kit, is characterized in that: include the primer for following 61 SNP site that increase: G10398A, Norm9bpDel, C10873T, A3010G, A709G, C7196A, C12705T, C3970T, G13104A, G10310A, C5178A, G13928C, G6446A, C8414T, C8794T, C8793T, C16126T, G16129A, A15043G, C16311T, A8701G, A8697G, C4883T, C10400T, (CA) n, G1719A, C14668T, C12811T, C, T9824A, C9698T, A9123G, C7028T, G11719A, G8584A, A11251G, G8020A, G5460A, G2706A, C11215T, T4216C, G12372A, C16362T, C1541T, C8684T, G9477A, A4491G, G1811A, G16316A, A16319G, G9545A, C11944T, C152T, G14569A, C8964T, G10397A, G3348A, G4833A, G7600A, G5417A, C5442T, C15784T,
The sequence of described primer is as follows: A709G, SEQIDNO.1-3; A3010G, SEQIDNO.4-6; C5178A, SEQIDNO.7-9; Norm9bpDel, SEQIDNO.10-11; G10398A, SEQIDNO.12-14; C10873T, SEQIDNO.15-17; C12705T, SEQIDNO.18-20; G13928C, SEQIDNO.21-23; C16311T, SEQIDNO.24-26; A15043G, SEQIDNO.27-29; C3970T, SEQIDNO.30-32; C8414T, SEQIDNO.33-35; G6446A, SEQIDNO.36-38; C7196A, SEQIDNO.39-41; G10310A, SEQIDNO.42-44; G13104A, SEQIDNO.45-47; C8793T and C8794T, SEQIDNO.48-51; C16126T and G16129A, SEQIDNO.52-55; C4883T, SEQIDNO.56-58; C10400T, SEQIDNO.59-61; (CA) n, SEQIDNO.62-63; G11719A, SEQIDNO.64-66; G1719A and C1541T, SEQIDNO.67-71; G8584A and A8701G and A8697G, SEQIDNO.72-77; A9123G, SEQIDNO.78-80; C7028T, SEQIDNO.81-83; C14668T, SEQIDNO.84-86; G2706A, SEQIDNO.87-89; G12372A, SEQIDNO.90-92; T4216C, SEQIDNO.93-95; A11251G and C11215T, SEQIDNO.96-100; G5460A, SEQIDNO.101-103; C12811T, SEQIDNO.104-106; G8020A, SEQIDNO.107-109; C, T9824A, SEQIDNO.110-112; C9698T, SEQIDNO.113-115; C16362T, SEQIDNO.116-118; C152T, SEQIDNO.119-121; G1811A, SEQIDNO.122-124; A4491G, SEQIDNO.125-127; G4833A, SEQIDNO.128-130; G5417A and C5442T, SEQIDNO.131-135; G7600A, SEQIDNO.136-138; C8684T, SEQIDNO.139-141; C8964T, SEQIDNO.142-144; G9477A and G9545A, SEQIDNO.145-149; G10397A, SEQIDNO.150-152; G3348A, SEQIDNO.153-155; C11944T, SEQIDNO.156-158; G14569A, SEQIDNO.159-161; C15784T, SEQIDNO.162-164; G16316A and A16319G, SEQIDNO.165-168;
The final concentration of primer in amplification system is:
2. plastosome SNP fluorescence labeling composite amplification test kit according to claim 1, it is characterized in that, described primer is packet marking, and primer corresponding to G10398A, Norm9bpDel, C10873T, A3010G, A709G, C7196A, C12705T, C3970T, G13104A, G10310A, C5178A, G13928C, G6446A, C8414T, C8794T, C8793T, C16126T, G16129A, A15043G, C16311T site is first group; A8701G, A8697G, C4883T, C10400T, (CA) n, G1719A, C14668T, C12811T, C, primer corresponding to T9824A, C9698T, A9123G, C7028T, G11719A, G8584A, A11251G, G8020A, G5460A, G2706A, C11215T, T4216C, G12372A, C16362T, C1541T site is second group; Primer corresponding to C8684T, G9477A, A4491G, G1811A, G16316A, A16319G, G9545A, C11944T, C152T, G14569A, C8964T, G10397A, G3348A, G4833A, G7600A, G5417A, C5442T, C15784T site is the 3rd group.
3. plastosome SNP fluorescence labeling composite amplification test kit according to claim 1, it is characterized in that, the forward primer in described primer is fluorescently-labeled.
4. the application of plastosome SNP fluorescence labeling composite amplification test kit according to claim 1 in case investigation, paternity test and corpse source are assert.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410145409.2A CN103898226B (en) | 2014-04-11 | 2014-04-11 | A kind of plastosome SNP fluorescence labeling composite amplification test kit and application thereof |
| PCT/CN2014/077784 WO2015154332A1 (en) | 2014-04-11 | 2014-05-19 | Mitochondria snp fluorescence-labeling multiple amplification kit and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410145409.2A CN103898226B (en) | 2014-04-11 | 2014-04-11 | A kind of plastosome SNP fluorescence labeling composite amplification test kit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103898226A CN103898226A (en) | 2014-07-02 |
| CN103898226B true CN103898226B (en) | 2016-02-10 |
Family
ID=50989791
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410145409.2A Active CN103898226B (en) | 2014-04-11 | 2014-04-11 | A kind of plastosome SNP fluorescence labeling composite amplification test kit and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN103898226B (en) |
| WO (1) | WO2015154332A1 (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104212894B (en) * | 2014-08-25 | 2016-02-10 | 四川大学 | Based on the Forensic medicine composite detection kit of 26 plastosome SNP genetic markers |
| CN107326075A (en) * | 2017-07-05 | 2017-11-07 | 公安部第研究所 | Target preparation method in a kind of fluorescence molecule amount |
| CN109280696B (en) * | 2017-07-21 | 2021-03-09 | 安塞斯（北京）生物技术有限公司 | Method for splitting mixed sample by SNP detection technology |
| CN109706248A (en) * | 2018-07-06 | 2019-05-03 | 四川大学 | Forensic medicine composite detection kit and its application based on SNP-STR genetic marker |
| CN108998507B (en) * | 2018-07-24 | 2022-03-29 | 广州万德基因医学科技有限公司 | Noninvasive high-throughput detection method applied to crowd complex genetic relationship identification |
| CN109439765B (en) * | 2018-11-20 | 2021-12-21 | 江苏苏博生物医学科技南京有限公司 | Composite amplification detection kit for simultaneously detecting 60 autosomal and Y chromosome loci |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1970791A (en) * | 2006-12-08 | 2007-05-30 | 武汉大学 | Membrane chip for detecting 45 gene locus of mitochondria diabetes |
| CN101469345A (en) * | 2007-10-01 | 2009-07-01 | 中国人民解放军第三军医大学 | Reagent kit for detecting plateau pneumochysis susceptibility based on mitochondria DNA G709A mononucleotide polymorphism |
| CN103290108A (en) * | 2013-04-08 | 2013-09-11 | 上海锦博生物技术有限公司 | Mitochondrial SNP fluorescence labeling composite amplification kit and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090233292A1 (en) * | 2007-11-30 | 2009-09-17 | Daniele Podini | Method and kit for identification of genetic polymorphisms |
-
2014
- 2014-04-11 CN CN201410145409.2A patent/CN103898226B/en active Active
- 2014-05-19 WO PCT/CN2014/077784 patent/WO2015154332A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1970791A (en) * | 2006-12-08 | 2007-05-30 | 武汉大学 | Membrane chip for detecting 45 gene locus of mitochondria diabetes |
| CN101469345A (en) * | 2007-10-01 | 2009-07-01 | 中国人民解放军第三军医大学 | Reagent kit for detecting plateau pneumochysis susceptibility based on mitochondria DNA G709A mononucleotide polymorphism |
| CN103290108A (en) * | 2013-04-08 | 2013-09-11 | 上海锦博生物技术有限公司 | Mitochondrial SNP fluorescence labeling composite amplification kit and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103898226A (en) | 2014-07-02 |
| WO2015154332A1 (en) | 2015-10-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898226B (en) | A kind of plastosome SNP fluorescence labeling composite amplification test kit and application thereof | |
| CN103352080B (en) | Gene detection kit for hereditary hearing loss | |
| CN104975105B (en) | SNP marker, primer pair and its application for mouse metallothionein-Ⅰ identification | |
| CN102337338B (en) | Method for simultaneously and quickly detecting number of five types of chromosomes, and kit and application thereof | |
| CN105177146B (en) | The fluorescence labeling composite amplification kit of 27 str locus seats of human Y-chromosome and its application | |
| CN106350590A (en) | DNA library construction method for high-throughput sequencing | |
| CN106480198B (en) | A kind of method and system carrying out individual identification to unknown sample | |
| CN108060237B (en) | Forensic medicine composite detection kit based on 55Y chromosome SNP genetic markers | |
| CN110004222A (en) | A kind of multiple gene detection kit and its application method for antipsychotics medication guide | |
| CN108642208A (en) | A kind of Cinnamomum and its general SSR molecular marker of relative genus plant and its development approach and application | |
| CN104862312A (en) | Primer pair for screening mammalian experiment animal SNP (Single Nucleotide Polymorphism) markers and application thereof | |
| CN106939334B (en) | Method for detecting fetal DNA content in plasma of pregnant woman | |
| CN103290108B (en) | Mitochondrial SNP fluorescence labeling composite amplification kit and application thereof | |
| CN108823294B (en) | Forensic medicine composite detection kit based on Y-SNP genetic markers of 20 haplotype groups D | |
| CN102399900B (en) | Gene polymorphism detection method and kit | |
| CN104031989B (en) | The test kit of the composite amplification of a kind of human gene group DNA 26 locus | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN102191308B (en) | Wild ginseng and cultivated ginseng multiple polymerase chain reaction (PCR) test kit and identification method | |
| CN101177702B (en) | Mitochondrial diseases MELAS and MERRF syndrome related mtDNA mutation site detecting gene chip and detecting method | |
| CN108546762A (en) | A kind of kit in 35 insertion/deletion sites for medical jurisprudence individual identification | |
| CN102719537A (en) | Multidrug-resistant mycobacterium tuberculosis non-fluorescent DNA (deoxyribonucleic acid) microarray detection method and kit | |
| CN109929936B (en) | Fluorescence labeling multiplex amplification kit for detecting human Y chromosome rapid mutation STR locus and application | |
| CN109762909A (en) | A kind of 44 site InDels composite amplification detection kits for sample medical jurisprudence individual appreciation of degrading | |
| CN108517364B (en) | Forensic medicine composite detection kit based on 56Y chromosome SNP genetic markers | |
| CN108642190B (en) | Forensic medicine composite detection kit based on 14 autosomal SNP genetic markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |