CN105200058A - Cattle muscle enhanser and application thereof - Google Patents
Cattle muscle enhanser and application thereof Download PDFInfo
- Publication number
- CN105200058A CN105200058A CN201510671543.0A CN201510671543A CN105200058A CN 105200058 A CN105200058 A CN 105200058A CN 201510671543 A CN201510671543 A CN 201510671543A CN 105200058 A CN105200058 A CN 105200058A
- Authority
- CN
- China
- Prior art keywords
- enhanser
- pgl3
- carrier
- recombinant plasmid
- spend
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Saccharide Compounds (AREA)
Abstract
The invention relates to the field of biotechnology, and particularly discloses a cattle muscle enhanser and application thereof. A nucleotide sequence of the cattle muscle enhanser is shown as SEQ ID No.1 (in the description). The cattle muscle enhanser can specifically enhance the transcriptional activity of a promoter in a myoblast remarkably.
Description
Technical field
The present invention relates to biological technical field, specifically, relate to a kind of ox muscle enhanser and application thereof.
Background technology
In 1978, people's Late Cambrian such as Reddy have enhancer sequence in simian virus genome, the people such as Banerji in 1981 find that this section of sequence is required adjustment sequence for the existence of virus and breeding, have the effect that significant enhancing gene is transcribed, therefore are referred to as " enhanser ".
First eucaryon enhanser is Grosschedl and Birnstiel Late Cambrian.In eukaryotic gene expression regulation and control, enhanser is very important cis-acting elements, acts synergistically with promotor, to the expression tool vital role of regulation and control eukaryotic gene.Enhanser is generally made up of plural enhancer element, has the effect strengthening and transcribe.Enhanser has two large action character: (l) is non-directional, and namely no matter enhanser is positioned at promotor upstream or downstream, all can activate its corresponding promotor; (2) enhanser is to the effect of promotor, is not subject to the impact of distance between the two.
Since 1978, confirm there is enhanser in many biological genomes.Can infer that enhanser is a kind of universal phenomenon in generegulation thus.The regulating effect of enhanser in Gene Activity is not only relevant with the speed that regulatory gene is expressed, and its effect simultaneously also has tissue specificity, this reveals that the relation of " quality and quantity " in generegulation.Further research will mainly concentrate on the mechanism of action of enhanser, and how can better in conjunction with the feature application enhanser of enhanser effect.
Often need to add enhancer sequence in the carrier when preparing transgenic cattle and building gene overexpression carrier, to improve the expression of foreign gene in ox, but current applied enhanser mostly is the sequence of mouse, the sequence of Niu Benshen, does not reduce the security of transgenic cattle.
Summary of the invention
In order to solve problems of the prior art, the object of this invention is to provide a kind of ox muscle enhanser and application thereof.
In order to realize the object of the invention, first the present invention provides a kind of ox muscle enhanser, and its nucleotide sequence is as shown in SEQIDNo.1.
Present invention also offers the primer pair for the described enhanser that increases, the nucleotide sequence of described primer pair is respectively as shown in SEQIDNo.2 and SEQIDNo.3.
Present invention also offers the carrier containing described enhanser.
Present invention also offers the recombinant plasmid containing described enhanser.
Present invention also offers the construction process of described recombinant plasmid, comprise the steps:
1) by enhanser according to claim 1 and pGL3-promoter carrier BamHI and SalI digestion with restriction enzyme;
2) cut glue after electrophoresis and reclaim digestion products;
3) enhancer sequence and pGL3-promoter carrier are connected with T4 ligase enzyme spend the night;
4) the product conversion intestinal bacteria will connected, are inverted after coated plate and cultivate;
5) picking mono-clonal, rules in LB culture plate, is inverted and cultivates, and is detected carry out thalline qualification by PCR and agarose gel electrophoresis;
6) row DNA sequencing is dropped into PCR positive bacteria;
7) be transferred in LB substratum by the bacterium colony meeting expection, shaking table is cultivated;
8) make to spend intracellular toxin plasmid DNA to prepare test kit and prepare recombinant plasmid.
Further, described construction process comprises the steps:
1) by described enhanser and pGL3-promoter carrier (PromegaE1761) BamHI and SalI digestion with restriction enzyme;
2) cut glue after electrophoresis and reclaim digestion products;
3) enhancer sequence and pGL3-promoter carrier to be connected with T4 ligase enzyme (NEBM0202L) in 4 DEG C to spend the night;
4) the product conversion intestinal bacteria will connected, after coated plate, are inverted for 37 DEG C and cultivate 12h;
5) picking mono-clonal, rules in LB culture plate, after 8h is cultivated in 37 DEG C of inversions, is detected carry out thalline qualification by PCR and agarose gel electrophoresis;
6) row DNA sequencing is dropped into PCR positive bacteria;
7) bacterium colony meeting expection is transferred in LB substratum, cultivates at 37 DEG C of shaking table 220rpm;
8) make to spend intracellular toxin plasmid DNA to prepare test kit (OmegaD6950-01) and prepare recombinant plasmid.By the plasmid called after pGL3-1357 prepared.
Present invention also offers described enhanser strengthen in sarcoplast promoter transcription active in application.
Further, be applied as described in and aforementioned bearer or aforementioned recombinant plasmid are proceeded in sarcoplast.
Beneficial effect of the present invention is:
The present invention obtains the muscle enhanser of a kind of new Niu Yuan, and this enhanser can significantly strengthen promoter transcription activity in the C2C12 cell of differentiation to utilize luciferase assay to find, provides a kind of selection newly for preparing transgenic cattle from now on.
Accompanying drawing explanation
Fig. 1 uses after 6 days for the differentiation described in the embodiment of the present invention 3
luciferaseassay (PromegaE2920) test kit detects the detected result of Photinus pyralis LUC/sea cucumber luciferase relative fluorescence amount.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.
Embodiment 1PCR amplification ox Muscle enhancer sequence
Extract the genomic dna of Angus, with it for template (concentration is for 80ng/ul); Surpassing high-fidelity DNA polymerase (NEB, M0491L) and specificity amplification primer to carrying out pcr amplification with Q5, obtaining ox Muscle enhancer sequence (its nucleotide sequence is as shown in SEQIDNo.1).
Pcr amplification program is as shown in table 1, and PCR reaction system is as shown in table 2.
Described specificity amplification primer is to as follows:
Upstream primer sequence (containing BamHI restriction enzyme site and protection base): ATCGGGATCCGCCAAGATAAGGTTGGGACA;
Downstream primer sequence (containing SalI restriction enzyme site and protection base): ATCGGTCGACTTTAAACCCCCTCACCCTTC.
Table 1PCR amplification program
Table 2PCR reaction system
Embodiment 2 builds the PGL3 luciferase reporter vector containing enhancer sequence of the present invention
1) enhancer sequence embodiment 1 amplified and pGL3-promoter carrier (PromegaE1761) BamHI and SalI digestion with restriction enzyme;
2) cut glue after electrophoresis and reclaim digestion products;
3) enhancer sequence and carrier to be connected with T4 ligase enzyme (NEBM0202L) in 4 DEG C to spend the night;
4) use the product conversion intestinal bacteria connected, after coated plate, be inverted for 37 DEG C and cultivate about 12h;
5) picking mono-clonal, rules in LB culture plate, carries out thalline PCR qualification after 8h is cultivated in 37 DEG C of inversions.Amplification is detected by PCR and agarose electrophoresis;
6) row DNA sequencing is dropped into PCR positive bacteria;
7) bacterium colony meeting expection is transferred in LB substratum, cultivates at 37 DEG C of shaking table 220rpm;
8) spend intracellular toxin plasmid DNA to prepare test kit (OmegaD6950-01) and prepare plasmid.By the plasmid called after pGL3-1357 prepared.
The functional verification of embodiment 3 Ns of muscle enhansers
1, when the degree of converging of C2C12 cell is 60%-70%, utilize liposome 2000 (11668-019, Invitrogen) difference corotation pGL3-1357 and pRL-TK (E2241), pGL3-promoter and pRL-TK in C2C12 cell, when cell confluency degree reaches 90%, cell division culture medium is cultivated, Cell differentiation inducing activity 6 days.
Described division culture medium is the DMEM high glucose medium containing 2% horse serum and 1% penicillin/streptomycin.
By the condition that division culture medium is cultivated be: 37 DEG C, 5%CO2.
2, break up after 6 days and use
luciferaseassay (PromegaE2920) test kit detects Photinus pyralis LUC and sea cucumber luciferase, illustrate whether enhanser works with the ratio of Photinus pyralis LUC/sea cucumber luciferase, as shown in Figure 1, the enhanser that the present invention finds is had an appointment the reinforced effects of 11 times.
Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.
Claims (8)
1. an ox muscle enhanser, is characterized in that, its nucleotide sequence is as shown in SEQIDNo.1.
2. for the primer pair of the enhanser described in claim 1 that increases, it is characterized in that, the nucleotide sequence of described primer pair is respectively as shown in SEQIDNo.2 and SEQIDNo.3.
3. the carrier containing enhanser described in claim 1.
4. the recombinant plasmid containing enhanser described in claim 1.
5. the construction process of recombinant plasmid described in claim 4, is characterized in that, comprises the steps:
1) by enhanser according to claim 1 and pGL3-promoter carrier BamHI and SalI digestion with restriction enzyme;
2) cut glue after electrophoresis and reclaim digestion products;
3) enhancer sequence and pGL3-promoter carrier are connected with T4 ligase enzyme spend the night;
4) the product conversion intestinal bacteria will connected, are inverted after coated plate and cultivate;
5) picking mono-clonal, rules in LB culture plate, is inverted and cultivates, and is detected carry out thalline qualification by PCR and agarose gel electrophoresis;
6) row DNA sequencing is dropped into PCR positive bacteria;
7) be transferred in LB substratum by the bacterium colony meeting expection, shaking table is cultivated;
8) make to spend intracellular toxin plasmid DNA to prepare test kit and prepare recombinant plasmid.
6. construction process according to claim 5, is characterized in that, comprises the steps:
1) by enhanser according to claim 1 and pGL3-promoter carrier BamHI and SalI digestion with restriction enzyme;
2) cut glue after electrophoresis and reclaim digestion products;
3) enhancer sequence and pGL3-promoter carrier to be connected with T4 ligase enzyme in 4 DEG C to spend the night;
4) the product conversion intestinal bacteria will connected, after coated plate, are inverted for 37 DEG C and cultivate 12h;
5) picking mono-clonal, rules in LB culture plate, after 8h is cultivated in 37 DEG C of inversions, is detected carry out thalline qualification by PCR and agarose gel electrophoresis;
6) row DNA sequencing is dropped into PCR positive bacteria;
7) bacterium colony meeting expection is transferred in LB substratum, cultivates at 37 DEG C of shaking table 220rpm;
8) make to spend intracellular toxin plasmid DNA to prepare test kit and prepare recombinant plasmid.
7. enhanser described in claim 1 is strengthening the application in promoter transcription activity.
8. application according to claim 7, is characterized in that, carrier described in claim 3 or recombinant plasmid according to claim 4 is proceeded in sarcoplast.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510671543.0A CN105200058B (en) | 2015-10-16 | 2015-10-16 | A kind of ox muscle enhancer and its application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510671543.0A CN105200058B (en) | 2015-10-16 | 2015-10-16 | A kind of ox muscle enhancer and its application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105200058A true CN105200058A (en) | 2015-12-30 |
CN105200058B CN105200058B (en) | 2018-04-10 |
Family
ID=54948020
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510671543.0A Active CN105200058B (en) | 2015-10-16 | 2015-10-16 | A kind of ox muscle enhancer and its application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105200058B (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102127545A (en) * | 2010-11-24 | 2011-07-20 | 山东农业大学 | Skeletal muscle specificity CKM (Creatine Kinase Muscle) promoter and applications thereof |
CN102127546A (en) * | 2010-11-24 | 2011-07-20 | 山东农业大学 | Skeletal muscle specificity actin promoter and applications thereof |
CN103160510A (en) * | 2013-04-02 | 2013-06-19 | 东北农业大学 | Myogenin (MyoG) gene enhancer |
CN103834660A (en) * | 2014-03-07 | 2014-06-04 | 山东农业大学 | Lung tissue specific BPIFA3 (BPI fold-containing family A member 3) promoter and application thereof |
-
2015
- 2015-10-16 CN CN201510671543.0A patent/CN105200058B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102127545A (en) * | 2010-11-24 | 2011-07-20 | 山东农业大学 | Skeletal muscle specificity CKM (Creatine Kinase Muscle) promoter and applications thereof |
CN102127546A (en) * | 2010-11-24 | 2011-07-20 | 山东农业大学 | Skeletal muscle specificity actin promoter and applications thereof |
CN103160510A (en) * | 2013-04-02 | 2013-06-19 | 东北农业大学 | Myogenin (MyoG) gene enhancer |
CN103834660A (en) * | 2014-03-07 | 2014-06-04 | 山东农业大学 | Lung tissue specific BPIFA3 (BPI fold-containing family A member 3) promoter and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN105200058B (en) | 2018-04-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Jorba et al. | Genetic trans-complementation establishes a new model for influenza virus RNA transcription and replication | |
Li et al. | High-efficiency nuclear transformation of the oleaginous marine Nannochloropsis species using PCR product | |
NZ609903A (en) | Expression vector for high level expression of recombinant proteins | |
Gao et al. | Improvement of the CRISPR-Cpf1 system with ribozyme-processed crRNA | |
Viswanathan et al. | The homologous region sequence (hr1) of Autographa californica multinucleocapsid polyhedrosis virus can enhance transcription from non-baculoviral promoters in mammalian cells | |
Chen et al. | Development of RNA interference revertants in Trypanosoma brucei cell lines generated with a double stranded RNA expression construct driven by two opposing promoters | |
Lui et al. | SMRT sequencing revealed the diversity and characteristics of defective interfering RNAs in influenza A (H7N9) virus infection | |
Murakami et al. | Establishment of canine RNA polymerase I-driven reverse genetics for influenza A virus: its application for H5N1 vaccine production | |
CN106434733B (en) | A kind of expression vector and its application suitable for Corynebacterium glutamicum | |
Yang et al. | The DNA element controlling expression of the varicella-zoster virus open reading frame 28 and 29 genes consists of two divergent unidirectional promoters which have a common USF site | |
Oliviero et al. | RNA polymerase III promoter elements enhance transcription of RNA polymerase II genes | |
Wang et al. | Positional effects of the matrix attachment region on transgene expression in stably transfected CHO cells | |
CN103525940A (en) | Reporter gene testing method for enhancer and promoter functions of intron SNP of CYP3A4 | |
Ioannidis et al. | Bombyx mori nucleopolyhedrovirus lef8 gene: effects of deletion and implications for gene transduction applications | |
RU2017121232A (en) | PLASMIDES AND METHOD FOR PRODUCING VIRUS PARTICLES | |
Ichikawa et al. | Knock-in of the duck retinoic acid-inducible gene I (RIG-I) into the Mx gene in DF-1 cells enables both stable and immune response-dependent RIG-I expression | |
CN116286724B (en) | Lectin receptor protein TaLecRLK2 and encoding gene and application thereof | |
Suzuki et al. | Extracellular production of an RNA aptamer by ribonuclease-free marine bacteria harboring engineered plasmids: a proposal for industrial RNA drug production | |
CN105200058A (en) | Cattle muscle enhanser and application thereof | |
US20120244622A1 (en) | Regulated gene expression systems and constructs thereof | |
CN103820453B (en) | A kind of can by the Pif promoter of pteria martensii MSX gene activation and application thereof | |
Julien et al. | Development of a mariner-based transposon for use in Sorangium cellulosum | |
CN106544313B (en) | A kind of Escherichia coli MG1655 bacterial strain lacking sahn gene and construction method and application | |
CN102978202A (en) | Over-expression vector for muscle specific expression of pig IGF1 gene | |
CN104404070A (en) | Method for inhibiting mouse MSTN (myostatin) expression and corresponding MSTN shRNA (short hairpin Ribose Nucleic Acid) segment |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |