CN105177154A - Test and quality control kit of Norovirus in shellfish and non-diagnostic test method - Google Patents
Test and quality control kit of Norovirus in shellfish and non-diagnostic test method Download PDFInfo
- Publication number
- CN105177154A CN105177154A CN201510651084.XA CN201510651084A CN105177154A CN 105177154 A CN105177154 A CN 105177154A CN 201510651084 A CN201510651084 A CN 201510651084A CN 105177154 A CN105177154 A CN 105177154A
- Authority
- CN
- China
- Prior art keywords
- norovirus
- shellfish
- phage
- escherichia coli
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Abstract
The invention discloses a test and quality control kit of Norovirus in shellfish and a non-diagnostic test method. The kit comprises one tube of NVGI+GII parting 2*RT-PCR mix, MS2 2*RT-PCR mix, RNase free water, NV GI+GII positive control and coliphage MS2 (2.5*1010 pfu/mL) respectively. The non-diagnostic test method comprises the following steps: (1) enrichment of Norovirus in shellfish; (2) extraction of virus RNA; (3) establishment of a coliphage MS2 standard curve; (4) test of the Norovirus and the coliphage MS2; (5) determination of the recovery rate of the virus RNA; (6) determination of results. According to the test and quality control kit of the Norovirus in shellfish and the non-diagnostic test method, the quality is effectively guaranteed in the whole virus detection process of critical steps of sample pretreatment, virus concentration, quality control, test, result determination and the like, stability, accuracy and controllability of the test process are enhanced, and the detection technology blank in the field is filled.
Description
Technical field:
The present invention relates to norovirus in a kind of shellfish and detect quality control reagent box and nondiagnostic nondiagnostic detection method, belong to the technical field that food safety, environmental monitoring and food-borne virus detect.
Background technology:
Norovirus is Caliciviridae is the spherical single strand plus RNA virus of icosahedral symmetry, be also called norovirus, Norwalk virus or purulence and melt virus, a kind of main virus causing non-bacterial acute gastroenteritis, based on intestinal transmitted, by the propagation such as water source, food, article, air of polluting.Norovirus full-length genome is about 7.7kb, and comprise 3 open reading frame (ORFs), ORF1 encodes nonstructural proteins, comprises RNA polymerase (RNA-dependentRNApolymerase, RdRp); ORF2 and ORF3 encodes mainly (VP1) and secondary (VP2) capsid protein respectively; According to the homology of VP1 sequence, norovirus can be divided into GI ~ GV five gene groups (Genogroup), wherein causes mainly G I and the G II crowd of human infection
Due to this virus mainly with food especially filter-feeding bivalve shellfish if the fishery products such as oyster are as transmitting carrier, in addition people to eat the custom of shellfish raw long-standing, the food safety question caused by the norovirus in shellfish is more and more subject to the attention of countries in the world.Carry out rapid detection and the deactivation research of norovirus in shellfish, to guarantee our people food safety, improve export food quality and create economic worth all most important.In China and most countries in the world, detect lack the standard quality hierarchy of control for norovirus in foodstuff product, reason is mainly to lack effectively, simple, fast, reliably technology be used for concentrated and detect these cause of diseases.Real-time fluorescence RT-PCR equimolecular detection method, due to its High sensitivity, special, is at present for detecting the most effectual way of food-borne virus in sample,
Summary of the invention:
Technical problem to be solved by this invention to be to provide in a kind of shellfish norovirus and to detect quality control reagent box and nondiagnostic nondiagnostic detection method, can monitor whole testing process and ensure the validity of detected result.
For solving the problems of the technologies described above, the technical solution used in the present invention is as follows:
In shellfish provided by the invention, norovirus detection quality control reagent box comprises NVG I+G II somatotype 2 × RT-PCRmix, MS22 × RT-PCRmix, without RNase water, NVG I+G II positive control, Escherichia coli MS 2 phage (2.5 × 10
10pfu/mL) each pipe.
The detection primer related in NVG I+G II somatotype 2 × RT-PCRmix, MS22 × RT-PCRmix and probe as follows:
(1) norovirus detects primer and probe
Norovirus G I:
Forward primer NVG1-F:5 '-CGYTGGATGCGNTTYCAT-3 '
Reverse primer NVG1-R:5 '-CCTTAGACGCCATCATCATTYAC-3 '
Probe NVG1-P:5 '-Cy5-TGGACAGGAGAYCGCRATCT-BHQ-3 '
G 2 norovirus:
Forward primer NVG2-F:5 '-ATGTTCYGRTGGATGAGRTTCTCWGA-3 '
Reverse primer NVG2-R:5 '-TCGACGCCATCTTCATTCACA-3 '
Probe NVG2-P:5 '-FAM-AGCACGTGGGAGGGCGATCG-BHQ-3 '
(2) Escherichia coli MS 2 phage detects primer and probe
MS2-TM3-F：5'-GGCTGCTCGCGGATACCC-3
MS2-TM3-R：5'-TGAGGGAATGTGGGAACCG-3
MS2-TM2JOE：5'-JOE-ACCTCGGGTTTCCGTCTTGCTCGT-NFQ-3'
Except primer, NVG I+G II somatotype 2 × RT ?PCRmix, Escherichia coli MS 2 phage 2 × RT ?other reagent in PCRmix, such as enzyme, dNTP etc. are existing known reagent.
The present invention also provides a kind of and utilizes test kit of the present invention to detect the method for norovirus in shellfish, comprises the following steps:
1. the enrichment of norovirus in shellfish
A, shellfish samples must be alive or freezing destructions, and earth etc. must remove, and can not again be immersed in water.Operate on ice, open shellfish shell with tweezers, scalpel etc., separating digesting gland (digestiveglands), get the sample of 10 shellfishes (less than 10 gross samples), by sterile scissors, visceral mass is shredded mixing; Get as the sample extracting RNA in compound sample 2g ± 0.2g to 50mL centrifuge tube (or other sterile centrifugation tube), all the other-80 DEG C retentions.
B, the Proteinase K working fluid adding 1mL respectively and 100 μ L process control material Escherichia coli MS 2 phages, whirlpool mixes.
C, 37 DEG C of shaking tables hatch 1h, 320r/min; 60 DEG C of water-bath 15min.
D, 4 DEG C, the centrifugal 5min of 3000 × g, gets supernatant, and to record supernatant volume be V1, and packing 500 μ L extracts RNA, and-80 DEG C of preservations of all the other supernatant liquors keep sample.
2. viral RNA extracts
3. the foundation of Escherichia coli MS 2 phage typical curve
Get the Escherichia coli MS 2 phage quality-control sample prepared, be diluted to 2.5 × 10
10pfu/mL, gets 100 μ L and carries out extraction viral RNA, is finally diluted in 100 μ L without RNA enzyme H
2in O; Get 20 μ L and be diluted in 180 μ L without RNA enzyme H
2o, gradient dilution 10 times, 100 times, 1000 times, 10000 times, 100000 times, then virus concentration represents 2.5 × 10 respectively
9, 2.5 × 10
8, 2.5 × 10
7, 2.5 × 10
6, 2.5 × 10
5, 2.5 × 10
4pfu/mL, carries out fluorescence quantitative RT-RCR reaction respectively, and application Ct value and phage concentration are set up and returned typical curve.
4. norovirus, Escherichia coli MS 2 phage detect
Norovirus, Escherichia coli MS 2 phage two kinds of targets detect respectively, each detection goal response system comprises: 2 × RT-PCRmix12.5 μ L, sample 5 μ L, water polishing to 25 μ L, each sample makees former times of extracting solution and 10 × dilution extracting solution, arranges positive control and negative control simultaneously.
5. the viral RNA rate of recovery is determined
According to MS2 fluorescent quantitation RT ?PCR reaction obtain Ct value and typical curve regression equation, calculate MS2 concentration, divided by virus concentration during application of sample, be multiplied by 100% and be the rate of recovery, by reclaiming divided by 0.5, and being multiplied by total detection homogenate volume, calculating extraction efficiency
6. result judges
Detected result judges to do following judgement when positive control and negative control are set up:
According to the validity of the organic efficiency result of determination of MS2; If it is effective that the viral RNA rate of recovery is more than or equal to 1% test, judge hepatitis A virus and norovirus result according to detection case; If the viral RNA rate of recovery is less than 1%, then need to re-start detection.
Escherichia coli MS 2 phage of the present invention and Escherichia coli MS 2 phage quality-control sample thereof are 2015102273402 according to patent of invention number, and denomination of invention is the disclosure preparation of " Escherichia coli MS 2 phage standard model and preparation method thereof ".
Beneficial effect of the present invention:
The RT-PCR that the present invention devises Escherichia coli MS 2 phage and norovirus G I and G II detects primer.
The present invention utilizes Escherichia coli MS 2 phage and norovirus in form, size, to the tolerance of environment similar to virus particle and to human body without the characteristic such as endangering, construct norovirus in shellfish and detect quality control reagent box and nondiagnostic nondiagnostic detection method, namely whole process and testing process is monitored by the Escherichia coli MS 2 phage of certain concentration, and sample preparation concentration method and the real-time fluorescence RT-PCR method of standard are provided, viral concentration from sample, viral RNA extracts, the steps such as organic efficiency and result judgement carry out the quality control of whole process, make detected result more accurate, more effective, more stable, the quality control standard system of the whole testing processes such as accurate monitoring virion lysis efficiency and nucleic acid extraction, to the monitoring of shellfish processing enterprise product and food-borne virus and quality control significant, compensate for the deficiency of existing detection technique.
Accompanying drawing or subordinate list illustrate:
Fig. 1 is the typical curve of Escherichia coli MS 2 phage in the embodiment of the present invention 1, and in figure, X-coordinate is the concentration (pfu/mL) of Escherichia coli MS 2 phage, and ordinate zou is real-time fluorescence RT-PCR Ct value.
Fig. 2 is the typical curve of Escherichia coli MS 2 phage in the embodiment of the present invention 1, and in figure, X-coordinate is real-time fluorescence RT-PCR Ct value, and ordinate zou is real-time fluorescence RT-PCR fluorescence intensity.
Fig. 3 is the organic efficiency measurement result that in the embodiment of the present invention 2, shellfish samples adds Escherichia coli MS 2 phage, and in figure, X-coordinate is real-time fluorescence RT-PCR Ct value, and ordinate zou is real-time fluorescence RT-PCR fluorescence intensity.
Fig. 4 is the detected result of shellfish samples norovirus G I in the embodiment of the present invention 3; In figure, X-coordinate is real-time fluorescence RT-PCR Ct value, and ordinate zou is real-time fluorescence RT-PCR fluorescence intensity.
Fig. 5 is the detected result of shellfish samples G 2 norovirus in the embodiment of the present invention 3; In figure, X-coordinate is real-time fluorescence RT-PCR Ct value, and ordinate zou is real-time fluorescence RT-PCR fluorescence intensity.
Embodiment:
Below by specific embodiment and by reference to the accompanying drawings or subordinate list set forth the present invention further.
Embodiment 1: the foundation of Escherichia coli MS 2 phage typical curve
1, the Escherichia coli MS 2 phage quality-control sample (2.5 × 10 in test kit is got
10pfu/mL), get 100 μ L and carry out extraction viral RNA, be finally diluted in 100 μ L without RNA enzyme H
2in O; Get 20 μ LRNA extracting solutions and be diluted in 180 μ L without RNA enzyme H
2o, gradient dilution 10 times, 100 times, 1000 times, 10000 times, 100000 times, then virus concentration represents 2.5 × 10 respectively
9, 2.5 × 10
8, 2.5 × 10
7, 2.5 × 10
6, 2.5 × 10
5, 2.5 × 10
4pfu/mL, carries out fluorescence quantitative RT-RCR reaction respectively.
2, recurrence typical curve is set up to Ct value and phage concentration.Instrument generates typical curve (see Fig. 1 and 2) automatically according to assignment and Ct value: y=58.716-3.352lnx (y is Ct value, and x is Escherichia coli MS 2 phage concentration (pfu/mL)), R
2=0.982, amplification efficiency is 98.74%.
Embodiment 2: the organic efficiency that shellfish samples adds Escherichia coli MS 2 phage measures
1, materials and methods
(1) bacterial strain and strain
Escherichia coli MS 2 phage standard model: derive from ATCC, laboratory is prepared in a large number.
(2) reagent
PBS damping fluid (pH7.0).
Proteinase K working solution (Proteinase K (30U/mg), 20 ± 0.1mg; Water, 200 ± 2mL; Proteinase K is dissolved in the water, mixing; Yu ?20 DEG C store conventional working volume, preservation period 6 months; Once thaw, be stored in 4 DEG C, 1 week quality guaranteed period).
Viral RNA extracts test kit: QIAGENRNeasyminiKit (CatNo74106).
RT ?PCR kit: THERNACOMPANYAMBIONAgPath ?ID
tMone ?stepRT ?PCRKit (P/N:AM1005).
(3) laboratory apparatus and material
Quantitative real time PCR Instrument: ABI7500;
Centrifuge tube: 50mL, 2mL, 1.5mL, WHATSON company;
DK ?8D type electric heating constant temperature tank: Shanghai is gloomy reliablely tests Instrument Ltd.;
ZD ?85 constant temperature oscillators: state China;
Ark Shell sample: Tuan Dao fish market, Qingdao City is bought.
(4) method
1. the enrichment of norovirus in shellfish
A, shellfish samples must be alive or freezing destructions, and earth etc. must remove, and can not again be immersed in water.Operate on ice, open shellfish shell with tweezers, scalpel etc., separating digesting gland (digestiveglands), get the sample of 10 shellfishes (less than 10 gross samples), by sterile scissors, visceral mass is shredded mixing; Get as the sample extracting RNA in compound sample 2g ± 0.2g to 50mL centrifuge tube (or other sterile centrifugation tube), all the other-80 DEG C retentions.
B, the Proteinase K working fluid adding 1mL respectively and 100 μ L process control material Escherichia coli MS 2 phages, whirlpool mixes.
C, 37 DEG C of shaking tables hatch 1h, 320r/min; 60 DEG C of water-bath 15min.
D, 4 DEG C, the centrifugal 5min of 3000 × g, gets supernatant, and to record supernatant volume be V1, and packing 500 μ L extracts RNA, and-80 DEG C of preservations of all the other supernatant liquors keep sample.
2. viral RNA extracts
3. the foundation of Escherichia coli MS 2 phage typical curve
Get the Escherichia coli MS 2 phage quality-control sample prepared, be diluted to 2.5 × 10
10pfu/mL, gets 100 μ L and carries out extraction viral RNA, is finally diluted in 100 μ L without RNA enzyme H
2in O; Get 20 μ L and be diluted in 180 μ L without RNA enzyme H
2o, gradient dilution 10 times, 100 times, 1000 times, 10000 times, 100000 times, then virus concentration represents 2.5 × 10 respectively
9, 2.5 × 10
8, 2.5 × 10
7, 2.5 × 10
6, 2.5 × 10
5, 2.5 × 10
4pfu/mL, carries out fluorescence quantitative RT-RCR reaction respectively, and application Ct value and phage concentration are set up and returned typical curve.
4. norovirus, Escherichia coli MS 2 phage detect
Norovirus, Escherichia coli MS 2 phage two kinds of targets detect respectively, each detection goal response system comprises: 2 × RT-PCRmix12.5 μ L, sample 5 μ L, water polishing to 25 μ L, each sample makees former times of extracting solution and 10 × dilution extracting solution, arranges positive control and negative control simultaneously.
5. the viral RNA rate of recovery is determined
According to MS2 fluorescent quantitation RT ?PCR reaction obtain Ct value and typical curve regression equation, calculate MS2 concentration, divided by virus concentration during application of sample, be multiplied by 100% and be the rate of recovery, by reclaiming divided by 0.5, and being multiplied by total detection homogenate volume, calculating extraction efficiency.
6. result judges
Detected result judges to do following judgement when positive control and negative control are set up:
According to the validity of the organic efficiency result of determination of MS2; If it is effective that the viral RNA rate of recovery is more than or equal to 1% test, judge hepatitis A virus and norovirus result according to detection case; If the viral RNA rate of recovery is less than 1%, then need to re-start detection.
2, the foundation of Escherichia coli MS 2 phage
Instrument generates typical curve (see Fig. 1 and 2) automatically according to assignment and Ct value: y=58.716 ?3.352lnx (y is Ct value, and x is Escherichia coli MS 2 phage concentration (pfu/mL)), R
2=0.982, amplification efficiency is 98.74%.
3, viral organic efficiency measures
According to the Escherichia coli MS 2 phage typical curve set up, the concentration of the Escherichia coli MS 2 phage of recovery can be calculated, thus calculate the rate of recovery of Viral extraction, the rate of recovery of Escherichia coli MS 2 phage, from 1.62% ?11.09% (Fig. 3 and table 1), meets the testing requirement of real time fluorescent quantitative RT ?PCR.
Table 1 Escherichia coli MS 2 phage extraction efficiency measures
| Sequence number | Ct value | Alluvial | Reclaim supernatant volume V1 (mL) | The rate of recovery |
| 1 | 34.76 | 1.40×10 7 | 1.7 | 1.90％ |
| 2 | 34.46 | 1.72×10 7 | 1.6 | 2.21％ |
| 3 | 34.36 | 1.85×10 7 | 1.6 | 2.37％ |
| 4 | 34.81 | 1.35×10 7 | 1.5 | 1.62％ |
| 5 | 34.90 | 1.27×10 7 | 1.8 | 1.84％ |
| 6 | 32.12 | 8.60×10 7 | 1.6 | 11.01％ |
| 7 | 32.28 | 7.72×10 7 | 1.6 | 9.86％ |
| 8 | 32.59 | 6.23×10 7 | 1.7 | 8.47％ |
| 9 | 32.28 | 7.72×10 7 | 1.8 | 11.09％ |
| 10 | 32.24 | 7.92×10 7 | 1.5 | 9.51％ |
Embodiment 3: the detection of norovirus in shellfish actual sample
1, the enrichment of norovirus in shellfish
A, shellfish samples must be alive or freezing destructions, and earth etc. must remove, and can not again be immersed in water.Operate on ice, open shellfish shell with tweezers, scalpel etc., separating digesting gland (digestiveglands), get the sample of 10 shellfishes (less than 10 gross samples), by sterile scissors, visceral mass is shredded mixing; Get as the sample extracting RNA in compound sample 2g ± 0.2g to 50mL centrifuge tube (or other sterile centrifugation tube), all the other-80 DEG C retentions.
B, the Proteinase K working fluid adding 1mL respectively and 100 μ L process control material Escherichia coli MS 2 phages, whirlpool mixes.
C, 37 DEG C of shaking tables hatch 1h, 320r/min; 60 DEG C of water-bath 15min.
D, 4 DEG C, the centrifugal 5min of 3000 × g, gets supernatant, and to record supernatant volume be V1, and packing 500 μ L extracts RNA, and-80 DEG C of preservations of all the other supernatant liquors keep sample.
2, viral RNA extracts
3, the foundation of Escherichia coli MS 2 phage typical curve
Get the Escherichia coli MS 2 phage quality-control sample prepared, be diluted to 2.5 × 10
10pfu/mL, gets 100 μ L and carries out extraction viral RNA, is finally diluted in 100 μ L without RNA enzyme H
2in O; Get 20 μ L and be diluted in 180 μ L without RNA enzyme H
2o, gradient dilution 10 times, 100 times, 1000 times, 10000 times, 100000 times, then virus concentration represents 2.5 × 10 respectively
9, 2.5 × 10
8, 2.5 × 10
7, 2.5 × 10
6, 2.5 × 10
5, 2.5 × 10
4pfu/mL, carries out fluorescence quantitative RT-RCR reaction respectively, and application Ct value and phage concentration are set up and returned typical curve.
4, norovirus, Escherichia coli MS 2 phage detect
Norovirus, Escherichia coli MS 2 phage two kinds of targets detect respectively, each detection goal response system comprises: 2 × RT-PCRmix12.5 μ L, sample 5 μ L, water polishing to 25 μ L, each sample makees former times of extracting solution and 10 × dilution extracting solution, arranges positive control and negative control simultaneously.
5, the viral RNA rate of recovery is determined
According to MS2 fluorescent quantitation RT ?PCR reaction obtain Ct value and typical curve regression equation, calculate MS2 concentration, divided by virus concentration during application of sample, be multiplied by 100% and be the rate of recovery, by reclaiming divided by 0.5, and being multiplied by total detection homogenate volume, calculating extraction efficiency
6, result decision principle
Detected result judges to do following judgement when positive control and negative control are set up:
According to the validity of the organic efficiency result of determination of MS2; If it is effective that the viral RNA rate of recovery is more than or equal to 1% test, judge hepatitis A virus and norovirus result according to detection case; If the viral RNA rate of recovery is less than 1%, then need to re-start detection.
7, sample detection result
The organic efficiency of MS2 is all greater than 1%, and the detected result of norovirus G I and G II is negative (Fig. 4-5).
Nucleotides sequence list
<110> Inspection and Quarantine Technology Center, Shandong Inspection and Quarantine
In <120> shellfish, norovirus detects quality control reagent box and nondiagnostic detection method
<160>9
<170>PatentInversion3.5
<210>1
<211>18
<212>DNA
<213> artificial sequence
<221>primer_bind
<222>(1)..(18)
<223> norovirus G I detects forward primer
<400>1
CGYTGGATGCGNTTYCAT18
<210>2
<211>23
<212>DNA
<213> artificial sequence
<221>primer_bind
<222>(1)..(23)
<223> norovirus G I detects reverse primer
<400>2
CCTTAGACGCCATCATCATTYAC23
<210>3
<211>20
<212>DNA
<213> artificial sequence
<221>primer_bind
<222>(1)..(20)
The probe that <223> norovirus G I detects
<400>3
TGGACAGGAGAYCGCRATCT20
<210>4
<211>26
<212>DNA
<213> artificial sequence
<221>primer_bind
<222>(1)..(26)
<223> G 2 norovirus detects forward primer
<400>4
ATGTTCYGRTGGATGAGRTTCTCWGA26
<210>5
<211>21
<212>DNA
<213> artificial sequence
<221>primer_bind
<222>(1)..(21)
<223> G 2 norovirus detects reverse primer
<400>5
TCGACGCCATCTTCATTCACA21
<210>6
<211>20
<212>DNA
<213> artificial sequence
<221>primer_bind
<222>(1)..(20)
<223> G 2 norovirus detection probes
<400>6
AGCACGTGGGAGGGCGATCG20
<210>7
<211>18
<212>DNA
<213> artificial sequence
<221>primer_bind
<222>(1)..(18)
<223> Escherichia coli MS 2 phage detects forward primer
<400>7
GGCTGCTCGCGGATACCC18
<210>8
<211>19
<212>DNA
<213> artificial sequence
<221>primer_bind
<222>(1)..(19)
<223> Escherichia coli MS 2 phage detects reverse primer
<400>8
TGAGGGAATGTGGGAACCG19
<210>9
<211>24
<212>DNA
<213> artificial sequence
<221>primer_bind
<222>(1)..(24)
<223> Escherichia coli MS 2 phage detection probes
<400>9
ACCTCGGGTTTCCGTCTTGCTCGT24
Claims (3)
1. in shellfish, norovirus detects a quality control reagent box, it is characterized in that: test kit comprises NVG I+G II somatotype 2 × RT-PCRmix, MS22 × RT-PCRmix, without RNase water, NVG I+G II positive control, Escherichia coli MS 2 phage (2.5 × 10
10pfu/mL) each pipe.
2. in shellfish according to claim 1, norovirus detects quality control reagent box, it is characterized in that, the detection primer related in NVG I+G II somatotype 2 × RT-PCRmix, MS22 × RT-PCRmix and probe as follows:
(1) norovirus detects primer and probe
Norovirus G I:
Forward primer NVG1-F:5 '-CGYTGGATGCGNTTYCAT-3 '
Reverse primer NVG1-R:5 '-CCTTAGACGCCATCATCATTYAC-3 '
Probe NVG1-P:5 '-Cy5-TGGACAGGAGAYCGCRATCT-BHQ-3 '
G 2 norovirus:
Forward primer NVG2-F:5 '-ATGTTCYGRTGGATGAGRTTCTCWGA-3 '
Reverse primer NVG2-R:5 '-TCGACGCCATCTTCATTCACA-3 '
Probe NVG2-P:5 '-FAM-AGCACGTGGGAGGGCGATCG-BHQ-3 '
(2) Escherichia coli MS 2 phage detects primer and probe
MS2-TM3-F：5'-GGCTGCTCGCGGATACCC-3
MS2-TM3-R：5'-TGAGGGAATGTGGGAACCG-3
MS2-TM2JOE：5'-JOE-ACCTCGGGTTTCCGTCTTGCTCGT-NFQ-3'。
3. utilize the test kit described in above-mentioned any one claim to detect the Non-diagnostic method of norovirus in shellfish, it is characterized in that, comprise the following steps:
1. the enrichment of norovirus in shellfish
A, shellfish samples are alive or freezing destructions, remove earth, operate on ice, open shellfish shell with tweezers, scalpel, separating digesting gland, get the sample of 10 shellfishes (less than 10 gross samples), by sterile scissors, visceral mass is shredded mixing; Get as the sample extracting RNA in compound sample 2g ± 0.2g to 50mL centrifuge tube, all the other-80 DEG C retentions;
B, the Proteinase K working fluid adding 1mL respectively and 100 μ L process control material Escherichia coli MS 2 phages, whirlpool mixes;
C, 37 DEG C of shaking tables hatch 1h, 320r/min; 60 DEG C of water-bath 15min;
D, 4 DEG C, the centrifugal 5min of 3000 × g, gets supernatant, and to record supernatant volume be V1, and packing 500 μ L extracts RNA, and-80 DEG C of preservations of all the other supernatant liquors keep sample;
2. viral RNA extracts
3. the foundation of Escherichia coli MS 2 phage typical curve
Get the Escherichia coli MS 2 phage quality-control sample prepared, be diluted to 2.5 × 10
10pfu/mL, gets 100 μ L and carries out extraction viral RNA, is finally diluted in 100 μ L without RNA enzyme H
2in O; Get 20 μ L and be diluted in 180 μ L without RNA enzyme H
2o, gradient dilution 10 times, 100 times, 1000 times, 10000 times, 100000 times, then virus concentration represents 2.5 × 10 respectively
9, 2.5 × 10
8, 2.5 × 10
7, 2.5 × 10
6, 2.5 × 10
5, 2.5 × 10
4pfu/mL, carries out fluorescence quantitative RT-RCR reaction respectively, and application Ct value and phage concentration are set up and returned typical curve;
4. norovirus, Escherichia coli MS 2 phage detect
RNA step 2. extracted gets 5 μ L respectively, detect respectively according to norovirus, Escherichia coli MS 2 phage two kinds of targets, each detection goal response system comprises: 2 × RT-PCRmix12.5 μ L, sample 5 μ L, water polishing to 25 μ L, each sample makees former times of extracting solution and 10 × dilution extracting solution, arranges positive control and negative control simultaneously;
5. the viral RNA rate of recovery is determined
The Ct value obtained according to the reaction of MS2 fluorescence quantitative RT-RCR and typical curve regression equation, calculate MS2 concentration, divided by virus concentration during application of sample, be multiplied by 100% and be the rate of recovery, by reclaiming divided by 0.5, and being multiplied by total detection homogenate volume, calculating extraction efficiency
The rate of recovery (%)=
6. result judges
Detected result judges to do following judgement when positive control and negative control are set up:
According to the validity of the organic efficiency result of determination of MS2; If it is effective that the viral RNA rate of recovery is more than or equal to 1% test, judge norovirus result according to detection case; If the viral RNA rate of recovery is less than 1%, then need to re-start detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510651084.XA CN105177154A (en) | 2015-10-10 | 2015-10-10 | Test and quality control kit of Norovirus in shellfish and non-diagnostic test method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510651084.XA CN105177154A (en) | 2015-10-10 | 2015-10-10 | Test and quality control kit of Norovirus in shellfish and non-diagnostic test method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105177154A true CN105177154A (en) | 2015-12-23 |
Family
ID=54899576
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510651084.XA Pending CN105177154A (en) | 2015-10-10 | 2015-10-10 | Test and quality control kit of Norovirus in shellfish and non-diagnostic test method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105177154A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105505953A (en) * | 2016-01-14 | 2016-04-20 | 山东出入境检验检疫局检验检疫技术中心 | Preparing method for GI type norovirus virus-like particles and application thereof |
| CN106521031A (en) * | 2016-11-30 | 2017-03-22 | 浙江省疾病预防控制中心 | Method for detecting norovirus in food based on negatively charged membrane concentration |
| CN108977580A (en) * | 2018-08-13 | 2018-12-11 | 郑州安图生物工程股份有限公司 | A kind of kit of the quick detection hepatitis C virus nucleic acid of 2-8 DEG C of preservation |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1160040A (en) * | 1995-12-07 | 1997-09-24 | 住友化学工业株式会社 | Process for racemization of optically active 1-phenylethylamine derivative |
-
2015
- 2015-10-10 CN CN201510651084.XA patent/CN105177154A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1160040A (en) * | 1995-12-07 | 1997-09-24 | 住友化学工业株式会社 | Process for racemization of optically active 1-phenylethylamine derivative |
Non-Patent Citations (3)
| Title |
|---|
| INTERNATIONAL ORGANIZATION FOR STANDRADIZATION: "Microbiology of food and animal feed—Horizontal method for determination of hepatitis A virus and norovirus in food using real-time RT-PCR—Part1:Method for quantification", 《INTERNATIONAL ORGANIZATION FOR STANDRADIZATION》 * |
| JENS DREIER ET AL.: "Use of Bacteriophage MS2 as an Internal Control in Viral Reverse Transcription-PCR Assays", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| 成靓等: "理化因素及感染复数对噬菌体MS2 活性的影响", 《环境科学与管理》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105505953A (en) * | 2016-01-14 | 2016-04-20 | 山东出入境检验检疫局检验检疫技术中心 | Preparing method for GI type norovirus virus-like particles and application thereof |
| CN106521031A (en) * | 2016-11-30 | 2017-03-22 | 浙江省疾病预防控制中心 | Method for detecting norovirus in food based on negatively charged membrane concentration |
| CN108977580A (en) * | 2018-08-13 | 2018-12-11 | 郑州安图生物工程股份有限公司 | A kind of kit of the quick detection hepatitis C virus nucleic acid of 2-8 DEG C of preservation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Virome comparisons in wild-diseased and healthy captive giant pandas | |
| CN106636471B (en) | Multiplex PCR detection kit for simultaneously detecting WSSV, AHPND, EHP and IHHNV of prawns | |
| Kuo et al. | Real-time quantitative PCR assay for monitoring of nervous necrosis virus infection in grouper aquaculture | |
| Selimovic-Hamza et al. | Detection of astrovirus in historical cases of European sporadic bovine encephalitis, Switzerland 1958–1976 | |
| CN106191298A (en) | A kind of method detecting vibrio parahaemolyticus Vibrio parahaemolyticus | |
| Debbink et al. | Human Norovirus Detection and Production, Quantification, and Storage of Virus‐Like Particles | |
| Adeniji et al. | Isolation and identification of enteroviruses from sewage and sewage-contaminated water in Lagos, Nigeria | |
| CN106399584B (en) | A kind of mandarin fish infectious spleen and kidney necrosis virus inactivation quick testing reagent kit and detection method | |
| CN105177154A (en) | Test and quality control kit of Norovirus in shellfish and non-diagnostic test method | |
| Chen et al. | First report of a novel goose astrovirus outbreak in Muscovy ducklings in China | |
| Rai et al. | Detection of viruses in Penaeus monodon from India showing signs of slow growth syndrome | |
| CN105154590A (en) | Detection and quality control kit for hepatitis A viruses and noroviruses in water sample, as well as detecting method | |
| CN103923887A (en) | Pseudoviral particle containing hepatitis e virus RNA (Ribose Nucleic Acid) fragment and preparation method thereof | |
| DiCaprio | Recent advances in human norovirus detection and cultivation methods | |
| Piewbang et al. | Dual infections of tilapia parvovirus (TiPV) and tilapia lake virus (TiLV) in multiple tilapia farms: Their impacts, genetic diversity, viral tropism, and pathological effects | |
| Rahmati-Holasoo et al. | Detection of Carp pox virus (CyHV-1) from koi (Cyprinus carpio L.) in Iran; clinico-pathological and molecular characterization | |
| CN105671169A (en) | Primer, kit and detection method for Candidatus Liberibacter asiaticus detection | |
| CN105177185A (en) | Test and quality control kit and test method of Hepatitis A virus and Norovirus in vegetable | |
| Wu et al. | Efficient capturing and sensitive detection of hepatitis A virus from solid foods (green onion, strawberry, and mussel) using protamine-coated iron oxide (Fe3O4) magnetic nanoparticles and real-time RT-PCR | |
| CN104212915A (en) | Primer group and kit for carrying out spot quick detection on shrimp covert mortality nodavirus | |
| Gao et al. | Real-time quantitative isothermal detection of Ostreid herpesvirus-1 DNA in Scapharca subcrenata using recombinase polymerase amplification | |
| Tsunesumi et al. | Novel murine norovirus-like genes in wild rodents in Japan | |
| CN113430274B (en) | RPA primer, probe, kit and method for detecting liver enterocytozoon | |
| CN102304591B (en) | PCR (polymerase chain reaction) primer pair for identifying H3 subtype avian influenza virus and application thereof | |
| CN115305295A (en) | Kit and method for detecting reovirus of blue crabs in aquaculture water |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151223 |