CN105154583A - Double-RT-PCR (reverse transcription-polymerase chain reaction) method for simultaneously identifying TGEV (transmissible gastroenteritis viruses) and PEDV (porcine epidemic diarrhea viruses) - Google Patents
Double-RT-PCR (reverse transcription-polymerase chain reaction) method for simultaneously identifying TGEV (transmissible gastroenteritis viruses) and PEDV (porcine epidemic diarrhea viruses) Download PDFInfo
- Publication number
- CN105154583A CN105154583A CN201510411851.XA CN201510411851A CN105154583A CN 105154583 A CN105154583 A CN 105154583A CN 201510411851 A CN201510411851 A CN 201510411851A CN 105154583 A CN105154583 A CN 105154583A
- Authority
- CN
- China
- Prior art keywords
- pcr
- pedv
- tgev
- double
- goal gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a double-RT-PCR (reverse transcription-polymerase chain reaction) method for simultaneously identifying TGEV (transmissible gastroenteritis viruses) and PEDV (porcine epidemic diarrhea viruses). The double-RT-PCR method includes comparing TGEV S protein genes to PEDV S protein gene sequences; respectively designing primers by the aid of selected conservative sequences of the TGEV S protein genes and the PEDV S protein gene sequences to guarantee the pathogen identification accuracy and the specificity of the primers. RT-PCR reaction systems and reaction conditions are optimized, and accordingly the high-specificity and high-sensitivity double-RT-PCR detection method for the PEDV and the TGEV can be obtained. As proved by ultimate experiments, the double-RT-PCR method has the advantages that the TGEV single-RT-PCR sensitivity and the PEDV single-RT-PCR sensitivity are high and can respectively reach 1.51ng/microliter and 1.82ng/microliter, the TGEV and PEDV double-RT-PCR sensitivity is quite obvious, the double-RT-PCR method can be used for detecting 14.50ng/microliter of RNA (ribonucleic acid) templates at least, and is high in sensitivity and low in cost as compared with partial pathogen quick detection cards, and the PEDV and TGEV specificity and sensitivity can be quickly detected by the aid of the double-RT-PCR method.
Description
Technical field
The present invention relates to technical field of molecular biology, be specifically related to a kind of dual RT-PCR method simultaneously can differentiating TGEV and PEDV virus.
Background technology
Transmissible gastro-enteritis virus (TGEV) and Porcine epidemic diarrhea virus (PEDV) can cause pig virus diarrhoea, are multiplely born in winter, season in spring two, propagate rapidly.This acute infectious intestinal disease principal character is clinically that body temperature sharply raises, extreme thirst, and amount of drinking water increases, and is reluctant to search for food or search for food stoppings, vomiting, subsequently violent diarrhoea also rapid dehydration.TGEV and PEDV can infect each age pig, wherein maximum to the harm of piglet, has a strong impact on feed conversion rate, causes a large amount of piglet dead, causes great financial loss.In recent years, serious porcine epizootic diarrhea epidemic situation has been broken out on each pig farm, Asia, causes huge financial loss to pig industry.TGEV and PEDV belongs to coronavirus together, very similar on clinical symptom, pathological change, epidemiology, is therefore difficult to clinically be distinguished, so imperative both distinguishing with molecular biology method.
Dual RT-PCR method is in same reaction system, add the experimental technique that two pairs of primer pairs, two goal gene carry out pcr amplification simultaneously.Save time because it has, laborsaving, reduce testing cost, reduce the advantage such as sample contamination and now developed into a kind of general detection technique, and be used successfully to all respects such as molecular genetics, medical diagnosis on disease, cause of disease discriminating.Dual RT-PCR can be caught more information and accurately be detected trace dna fast, therefore be expected to for differentiating TGEV and PEDV virus, but determining on the general orientation basis using RT-PCR method to implement to differentiate, select which kind of gene of virus as goal gene, design what kind of primer, select what kind of reaction system and reaction conditions to be all the prerequisite that the method can be utilized successfully to differentiate, detect two-strain.In prior art, a kind of effective solution is still lacked for the problems referred to above.
The genome of TGEV is the single-stranded positive RNA of non-segmented negative, and length is about 28.5kb, genome encoding 8 ORF; TGEV has 4 kinds of structural protein (S, M, N, sM) and 3 kinds of Nonstructural Proteins, and wherein S protein is also called spike protein, and the gene of this albumen of encoding is called S gene.PEDV genome is also the RNA of single-stranded positive, total length 27 ~ 33kb, genome sequence comprises 6 ORF, from 5 '-3 ' be followed successively by the gene of coding replicative enzyme polyprotein 1ab (pplab), spike protein (S), ORF3 albumen, secondary embedding membranin (E), main embedding membranin (M) and nucleocapsid protein (N); Wherein S protein is made up of 1383 amino acid, molecular mass is 180 ~ 220ku, is positioned at the spike protein of virion surface, and it is identification target cell, promotes to play importantly biological action in the fusion of virus and cytolemma.
Summary of the invention
The present invention is intended to the technological deficiency for prior art, provides a kind of dual RT-PCR method simultaneously can differentiating TGEV and PEDV virus, lacks a kind of technical problem simultaneously can differentiating the method for TGEV, PEDV virus to solve in prior art.
Another technical problem that the present invention solves is the susceptibility promoting aforesaid method discriminating, detect.
The technical problem again that the present invention solves is the specificity promoting aforesaid method discriminating, detect.
The another technical problem that the present invention solves reduces the cost of TGEV, PEDV virus identification experiment.
For differentiating a method of TGEV and PEDV, the method comprises the following steps:
1) viral RNA in testing sample is extracted;
2) by step 1) the RNA reverse transcription that obtains is cDNA;
3) by step 2) cDNA that obtains performs pcr amplification for wherein goal gene;
4) to amplified production order-checking, to determine wherein whether containing goal gene;
Wherein: described goal gene is divided into TGEV goal gene and PEDV goal gene, wherein said TGEV goal gene is the S protein gene of TGEV, and described PEDV goal gene is the S protein gene of PEDV.
Preferably, step 3) in be the two kind DNA moleculars of sequence as shown in SEQIDNO1 and SEQIDNO2 for the primer of pcr amplification.Can perform preferably following on this basis further: PCR reaction system comprises following composition: 10 × PCRbuffer4 ~ 6 μ L, dNTPMixture3 ~ 5 μ L, ExTaq0.4 ~ 0.6 μ L, primer concentration shown in SEQIDNO1 is 8 ~ 12 μMs, primer concentration shown in SEQIDNO2 is 8 ~ 12uM, CDNA template 2 ~ 3 μ L, ddH
2o30 ~ 35 μ L; PCR reaction conditions is: 93 ~ 95 DEG C of denaturations, 4 ~ 6min, 93 ~ 95 DEG C of sex change 48 ~ 52s, 53 ~ 55 DEG C of annealing 48 ~ 52s, and 70 ~ 74 DEG C extend 48 ~ 52s, totally 33 ~ 37 circulations, and 70 ~ 74 DEG C extend 8 ~ 12min eventually.
Preferably, step 3) in be the two kind DNA moleculars of sequence as shown in SEQIDNO3 and SEQIDNO4 for the primer of pcr amplification.Can perform preferably following on this basis further: PCR reaction system comprises following composition: 10 × PCRbuffer4 ~ 6 μ L, dNTPMixture3 ~ 5 μ L, ExTaq0.4 ~ 0.6 μ L, primer concentration shown in SEQIDNO3 is 8 ~ 12 μMs, primer concentration shown in SEQIDNO4 is 8 ~ 12uM, CDNA template 2 ~ 3 μ L, ddH
2o30 ~ 35 μ L; PCR reaction conditions is: 93 ~ 95 DEG C of denaturations, 4 ~ 6min, 93 ~ 95 DEG C of sex change 48 ~ 52s, 53 ~ 55 DEG C of annealing 48 ~ 52s, and 70 ~ 74 DEG C extend 48 ~ 52s, totally 33 ~ 37 circulations, and 70 ~ 74 DEG C extend 8 ~ 12min eventually.
Preferably, step 3) in be four kinds of DNA moleculars for the primer of pcr amplification, its sequence is respectively as shown in SEQIDNO1, SEQIDNO2, SEQIDNO3, SEQIDNO4.Can perform preferably following on this basis further: PCR reaction system comprises following composition: 10 × PCRbuffer4 ~ 6 μ L, dNTPMixture3 ~ 5 μ L, ExTaq0.4 ~ 0.6 μ L, primer concentration shown in SEQIDNO1 is 8 ~ 12 μMs, primer concentration shown in SEQIDNO2 is the primer concentration shown in 8 ~ 12uM, SEQIDNO3 is 8 ~ 12 μMs, and the primer concentration shown in SEQIDNO4 is 8 ~ 12uM, CDNA template 2 ~ 3 μ L, ddH
2o30 ~ 35 μ L; PCR reaction conditions is: 93 ~ 95 DEG C of denaturations, 4 ~ 6min, 93 ~ 95 DEG C of sex change 48 ~ 52s, 53 ~ 55 DEG C of annealing 48 ~ 52s, and 70 ~ 74 DEG C extend 48 ~ 52s, totally 33 ~ 37 circulations, and 70 ~ 74 DEG C extend 8 ~ 12min eventually.
In above technical scheme, the content that the S protein gene of TGEV and the S protein gene of PEDV can be recorded with Genbank, for foundation, can be the AF209745.1 gene and DQ985739.1 gene recorded in Genbank respectively.In above-mentioned reaction system.10 × the PCRbuffer used, dNTPMixture, ExTaq are the common reagent of the art, can buy from market; Described primer concentration refers to the final concentration of primer in reaction system, i.e. working concentration.Step 1 in above technical scheme) in the extraction of viral RNA and step 2) in reverse transcription prior art all can be utilized to implement.Step 4) if detected result display is containing TGEV goal gene, prove containing TGEV virus in sample, otherwise then not containing TGEV virus; Step 4) if detected result display is containing PEDV goal gene, prove containing PEDV virus in sample, otherwise then not containing TGEV virus
The S protein of PEDV is effectively identifying target cell, promotes to play an important role in the immune responses such as virus and cell membrane fusion.Meanwhile, also play an important role in the neutralizing antibody production process of the mediation after virus infection host.Therefore, S glycoprotein is the main candidate albumen of research and development TGEV, PEDV bigeminy vaccine.TGEV spike protein (S) gene and PEDV spike protein (S) gene order high conservative, therefore, conservative region for PEDVS protein gene and TGEVS protein gene carries out the foundation of dual RT-PCR method detection method, can improve specificity and the susceptibility of RT-PCR detection method.
The present invention, by comparing to TGEVS protein gene and PEDVS protein gene sequence, selects its conserved sequence to design primer respectively, ensures the accuracy of Pathogen identification and the specificity of primer.In addition, by the optimization to RT-PCR reaction system and reaction conditions, obtain the dual RT-PCR detection method of specificity, PEDV and TGEV that susceptibility is higher.Through finally testing confirmation, dual RT-PCR method of the present invention, not only the individual event RT-PCR susceptibility of TGEV and PEDV is high, 1.51ng/ μ L and 1.82ng/ μ L can be reached respectively, the dual RT-PCR susceptibility of TGEV and PEDV is also extremely remarkable, and minimum RNA template amount 14.50ng/ μ L being detected is higher than the rapid antigen detection card susceptibility of prompt TGE and PED of the peace of Korea S import, and with low cost, the specificity to PEDV and TGEV and sensitivity Detection can be realized fast.
Accompanying drawing explanation
Fig. 1 utilizes TGEV individual event RT-PCR detection method of the present invention to carry out the result of RT-PCR amplification to diarrhea of pigs Combined vaccine, PPV, CSFV, BVDV in the embodiment of the present invention 1;
Fig. 2 utilizes TGEV individual event RT-PCR detection method of the present invention to the CDNA of whole reverse transcription gained by 10 times (10 in the embodiment of the present invention 1
0~ 10
-8) carry out the result of RT-PCR amplification after doubling dilution;
Fig. 3 utilizes TGEV individual event RT-PCR detection method of the present invention to repeat the result of testing in the embodiment of the present invention 1;
Fig. 4 utilizes PEDV individual event RT-PCR detection method of the present invention to carry out the result of RT-PCR amplification to diarrhea of pigs Combined vaccine, PPV, CSFV, BVDV in the embodiment of the present invention 1;
Fig. 5 utilizes PEDV individual event RT-PCR detection method of the present invention to the CDNA of whole reverse transcription gained by 10 times (10 in the embodiment of the present invention 1
0~ 10
-8) carry out the result of RT-PCR amplification after doubling dilution;
Fig. 6 utilizes PEDV individual event RT-PCR detection method of the present invention to repeat the result of testing in the embodiment of the present invention 1;
Fig. 7 utilizes dual RT-PCR method of the present invention to carry out the result of RT-PCR amplification to diarrhea of pigs Combined vaccine, PPV, CSFV, BVDV in the embodiment of the present invention 1;
Fig. 8 utilizes dual RT-PCR method of the present invention to the CDNA of whole reverse transcription gained by 10 times (10 in the embodiment of the present invention 1
0~ 10
-8) carry out the result of RT-PCR amplification after doubling dilution;
Fig. 9 utilizes dual RT-PCR method of the present invention to repeat the result of testing in the embodiment of the present invention 1;
Figure 10 is first part's experimental result that in the embodiment of the present invention 1, random selecting 48 increment originally carries out dual RT-PCR detection;
Figure 11 is the second section experimental result that in the embodiment of the present invention 1, random selecting 48 increment originally carries out dual RT-PCR detection.
Embodiment
Below will be described in detail the specific embodiment of the present invention.In order to avoid too much unnecessary details, in the examples below to belonging to known structure or function will not be described in detail.
The approximating language used in following examples can be used for quantitative expression, shows to allow quantity to have certain variation when not changing basic function.Therefore, this exact value itself is not limited to the numerical value that the language such as " approximately ", " left and right " is revised.In certain embodiments, " approximately " represents and allows its numerical value revised to change in the positive and negative scope of 10 (10%), such as, and any numerical value that what " about 100 " represented can be between 90 to 110.In addition, in the statement of " about first numerical value is to second value ", revise the first and second numerical value two numerical value approximately simultaneously.In some cases, approximating language may be relevant with the precision of surveying instrument.
Apart from outside definition, technology used in following examples and scientific terminology have the identical meanings generally understood with those skilled in the art of the invention.
Test reagent consumptive material used in following examples, if no special instructions, is routine biochemistry reagent; Described experimental technique, if no special instructions, is ordinary method; Quantitative test in following examples, all arranges and repeats experiment for three times, results averaged; % in following examples, if no special instructions, is mass percentage.
Embodiment 1
1 material
1.1 seed culture of viruses
Transmissible gastro-enteritis virus, Porcine epidemic diarrhea virus are wild-type, buy from market.
1.2 main agents and instrument
RNAisoPlus, ReversetranscriptaseXL (AMV), RibonucleaseInhibitor, dNTP, ExTaq, TRzol, DNA standard (DL1000) are purchased from TaKaRa company; PED, TGE rapid antigen detection card is purchased from Korea S's peace prompt (Anigen).
Biohazard Safety Equipment (Nuaire, NU-425-600s); Table-type high-speed refrigerated centrifuge (east, the Five continents, Beijing development in science and technology company limited, 3k-15); T100PCR gene-amplificative instrament (hundred Science and Technology Ltd.s difficult to understand, 621BR08082 are matched in Beijing); Electric heating constant temperature tank (Shanghai He Heng plant and instrument company limited, DK-8D); Electronic balance (Sartorius, BSA124S-CW); DYY-8C nucleic acid electrophoresis apparatus (Liuyi Instruments Plant, Beijing); Ultraviolet gel imaging system (BIO-RAD); Micropipet (big dragon company).
2 methods
The Design and synthesis of 2.1 primers
According to the nucleotide sequence of (AF209745.1) protein gene of TGEVS in GenBank and PEDVS (DQ985739.1) protein gene, the relative conserved regions of these two genes selected, utilize Primer5.0 software, design TGEV diagnostic primers P1/P2 respectively, PEDV diagnostic primers P3/P4, its concrete sequence is as shown in table 1:
The name of table 1 primer and sequence
2.2 sample process
After intestinal contents (diarrhoea Combined vaccine) adds the dilution of the PBS after appropriate high pressure, abundant multigelation 2-3 time, the centrifugal 15min of 8000rpm, gets supernatant ,-70 DEG C of preservations.
2.3RNA extract
Adopt TRzol lifting manipulation to extract RNA, concrete steps are as follows:
1. get 250 μ l viral suspension+1mlTrzol, leave standstill 10min;
2. add 200 μ l trichloromethane concuss 15s, room temperature leaves standstill 10min;
3. 4 DEG C, 12000rpm, centrifugal 10min;
4. get upper strata aqueous phase 550 μ l, add isopyknic Virahol;
5. put upside down mixing, leave standstill 10min;
6. 4 DEG C, 12000rpm, centrifugal 10min;
7. abandon supernatant, add 1ml dehydrated alcohol, resuspended;
8. 4 DEG C, 7500rpm, centrifugal 5min;
9. abandon supernatant, dry 5min, add 30 μ lDEPC water dissolution RNA.
2.4 reverse transcription systems and reverse transcription condition
Reverse transcription condition: 30 DEG C of 10min, 42 DEG C of 60min, 72 DEG C of 15min.
In above reverse transcription system, 10 × Buffer can be selected from the product that trade name is TakaraEaTaq, model is RR001A, and concrete name is called 10xExTaqBuffer (Mg2+plus); MLV refers to ThermoScript II, and specification is 200U/ μ L; RRI refers to RNA enzyme inhibitors, and specification is 40U/ μ L; Random primer can be the PCRKIT test kit bought, and concrete name is called that OligodT-AdaptorPrimer specification is 2.5pmol/ μ L.
The foundation of 2.5 individual event RT-PCR method
2.5.1 the optimization of individual event RT-PCR reaction conditions
Extract RNA and reverse transcription is carried out to it and change CDNA into, adopt the reaction system of 50 μ L to carry out the pcr amplification of TGEV and PEDV respectively, respectively primer concentration, annealing temperature are optimized, determine the PCR optimum reaction condition of virus.
2.5.2 individual event sensitivity test
The CDNA of the whole reverse transcription gained of RNA extracted is pressed 10 times (10
0~ 10
-8) doubling dilution, each extent of dilution sample is when the annealing temperature determined and primer concentration, and other conditions are constant carries out pcr amplification.
2.5.3 individual event specific test
Extract respectively diarrhea of pigs Combined vaccine, PPV, CSFV, BVDV total serum IgE and make its reverse transcription become CDNA, utilize TGEV and the PEDV individual event RT-PCR method set up to increase, the specificity of checking RT-PCR detection method.
2.5.4 single file replica test
According to the top condition of the RT-PCR reaction optimized, RT-PCR amplification is carried out to TGEV, PEDV, repeat 5 times, with the reliability of confirmatory experiment result.
The foundation of 2.6 dual RT-PCR methods
2.6.1 the optimization of dual RT-PCR reaction conditions
Extract RNA and reverse transcription is carried out to it and change CDNA into, adopt the reaction system of 50 μ L to carry out the pcr amplification of TGEV and PEDV respectively, respectively primer concentration, annealing temperature are optimized, determine the PCR optimum reaction condition of virus.When considering to grope dual RT-PCR, the proportionlity of two pairs of primers carries out PCR qualification.Concrete primer concentration ratio is as shown in table 2:
Each experimental group primer concentration in the experiment of table 2 dual RT-PCR reaction condition optimization
2.6.2 the sensitivity experiments of dual RT-PCR
The CDNA of the whole reverse transcription gained of RNA extracted is pressed 10 times of (100-10-8) doubling dilutions, and each extent of dilution sample is when the annealing temperature determined and 2 pairs of primer concentrations, and other conditions are constant carries out pcr amplification.
2.6.3 the specificity experiments of dual RT-PCR
Respectively to diarrhea of pigs Combined vaccine, PPV, CSFV, BVDV carry out RNA extraction and reverse transcription CDNA synthesizes, using H2O as negative control, under the prerequisite of the annealing temperature determined and primer concentration, carry out double PCR amplification, detect its specificity.
2.6.4 dual RT-PCR replica test
According to the top condition of the RT-PCR reaction optimized, RT-PCR amplification is carried out to TGEV, PEDV, repeat 5 times, with the reliability of confirmatory experiment result.
2.6.5 the detection of clinical sample
150 points of clinical samples are carried out to the detection of dual RT-PCR method, dual RT-PCR detection and the detection of PED, TGE Detection of antigen card are carried out to 50 parts of clinical samples simultaneously simultaneously.
3 results and analysis
The foundation of 3.1 individual event RT-PCR method
3.1.1TGEV the determination of individual event RT-PCR detection method reaction conditions
By being repeatedly optimized conditions such as the annealing temperature in PCR reaction process, extension time, cycle indexes, determine TGEVPCR optimal reaction system (see table 3).Amplification program is: 94 DEG C of denaturation 5min, 94 DEG C of sex change 50s, and 54 DEG C of annealing 50s, 72 DEG C extend 50s, totally 35 circulations, and 72 DEG C of ends extend 10min, 4 DEG C of preservations.The RNA extracting diarrhea of pigs Combined vaccine carries out RT-PCR amplification, obtains the goal gene fragment of 886bp.PCR primer is delivered to Beijing Hua Da gene and is carried out sequencing analysis, and the homology of the TGEV gene order reported in result and GenBank is up to 100%.
PCR reaction system (50 μ L reaction system) in table 3TGEV individual event RT-PCR detection method
3.1.2TGEV specificity, susceptibility, the replica test result of individual event RT-PCR detection method
Adopt the individual event RT-PCR condition of TGEV, RT-PCR amplification is carried out to the diarrhea of pigs Combined vaccine extracted, PPV, CSFV, BVDV.Result obtains the specific fragment of the 886bp of the same size with goal gene from diarrhea of pigs Combined vaccine, and all fails object band (see Fig. 1) to be detected from PPV, CSFV, BVDV.Under these conditions, 10 times (10 is pressed to the CDNA of whole reverse transcription gained
0~ 10
-8) carry out the most low energy of RT-PCR after doubling dilution and detect 10
-6the diarrhea of pigs Combined vaccine of dilution, its sensitivity is 1.51ng/ μ L (see Fig. 2).Repeat 5 tests according to the RT-PCR condition optimized, result all can obtain object band (see Fig. 3) at 886bp place.
The determination of 3.2PEDV individual event RT-PCR detection method reaction conditions
3.2.1PEDV the determination of individual event RT-PCR detection method reaction conditions
By being repeatedly optimized conditions such as the annealing temperature in PCR reaction process, extension time, cycle indexes, determine PEDVPCR optimal reaction system (see table 4).Amplification program is: 94 DEG C of denaturation 5min, 94 DEG C of sex change 50s, and 54 DEG C of annealing 50s, 72 DEG C extend 50s, totally 35 circulations, and 72 DEG C of ends extend 10min, 4 DEG C of preservations.The RNA extracting diarrhea of pigs Combined vaccine carries out RT-PCR amplification, obtains the goal gene fragment of 199bp.PCR primer is delivered to Beijing Hua Da gene and is carried out sequencing analysis, and the homology of the PEDV gene order reported in result and GenBank is up to 100%.
PCR reaction system (50 μ L reaction system) in table 4PEDV individual event RT-PCR detection method
3.2.2PEDV specificity, susceptibility, the replica test result of individual event RT-PCR detection method
Adopt the individual event RT-PCR condition of PEDV, RT-PCR amplification is carried out to the diarrhea of pigs Combined vaccine extracted, PPV, CSFV, BVDV.Result obtains the specific fragment of the 199bp of the same size with goal gene from diarrhea of pigs Combined vaccine, and all fails object band (see Fig. 4) to be detected from PPV, CSFV, BVDV.Under these conditions, 10 times (10 is pressed to the CDNA of whole reverse transcription gained
0~ 10
-8) carry out the most low energy of RT-PCR after doubling dilution and detect 10
-6the diarrhea of pigs Combined vaccine of dilution, its sensitivity is 1.82ng/ μ L (see Fig. 5).Repeat 5 tests according to the RT-PCR condition optimized, result all can obtain object band (see Fig. 6) at 199bp place.
The foundation of 3.3 dual RT-PCR detection methods
3.3.1TGEV with the determination of PEDV dual RT-PCR detection method reaction conditions
On the basis of TGEV and the PEDV individual event RT-PCR detection method set up, by the optimization to every reaction conditions, determine the optimal reaction system (see table 5) of TGEV and PEDV dual RT-PCR.Best amplification program is: 94 DEG C of denaturation 5min, 94 DEG C of sex change 50s, and 54 DEG C of annealing 50s, 72 DEG C extend 50s, totally 35 circulations, and 72 DEG C of ends extend 10min, 4 DEG C of preservations.The RNA extracting diarrhea of pigs Combined vaccine carries out RT-PCR amplification, obtains the goal gene fragment of 886bp and 199bp.PCR primer is delivered to Beijing Hua Da gene and is carried out sequencing analysis, and the homology of TGEV and the PEDV gene order reported in result and GenBank is up to 99%.
PCR reaction system (50 μ L reaction system) in table 5 dual RT-PCR detection method of the present invention
3.3.2TGEV with specificity, susceptibility, the replica test result of PEDV dual RT-PCR detection method
According to the dual RT-PCR method set up, RT-PCR amplification is carried out to the diarrhea of pigs Combined vaccine extracted, PPV, CSFV, BVDV.Result obtains the specific fragment of 886bp and 199bp from diarrhea of pigs Combined vaccine simultaneously, and all fails object band (see Fig. 7) to be detected from PPV, CSFV, BVDV.Under these conditions, 10 times (10 is pressed to the CDNA of whole reverse transcription gained
0~ 10
-8) carry out the most low energy of RT-PCR after doubling dilution and detect 10
-6the diarrhea of pigs Combined vaccine of dilution, its sensitivity is 14.50ng/ μ L (see Fig. 8).Repeat 5 tests according to the RT-PCR condition optimized, result all can obtain object band (see Fig. 9) at 886bp and 199bp place.
3.4 clinical samples detect
150 parts of clinical samples are carried out to the detection of dual RT-PCR method, dual RT-PCR detection and TGE, PED Detection of antigen card detection (Figure 10 and Figure 11) are carried out to 48 parts of clinical samples simultaneously simultaneously.Result shows, TGEV and the PEDV dual RT-PCR method of foundation meets (see table 6 and 7) completely with the commercialization TGEV of Korea S's import and PEDV Detection of antigen card result.And wherein having amplified TGEV and PEDV in 8 increment product simultaneously, the gene homology delivered through order-checking and GenBank is 99%, shows that 8 increment product are two-strain polyinfection.By dual RT-PCR method and Detection of antigen card, the detected result of same batch sample is illustrated, in 48 increment product, adopt dual RT-PCR method PEDV to detect 29/48 and improve 4.18% compared with 23/48 recall rate of test card method.Utilize dual RT-PCR method to above-mentioned sample duplicate detection three times, test-results is consistent.Result confirm further the specificity of dual RT-PCR detection method set up and susceptibility better, can be used in the diagnosis of clinical TGEV and PEDV polyinfection.The display of 150 parts of diarrhea of pigs clinical sample detected results, PEDV detects 53 parts, accounts for 35.3%, TGEV and detects 11 parts, accounts for 11.3%, PEDV and TGEV polyinfection detects 8 parts, accounts for 5.3%.
Table 6 dual RT-PCR and the comparative analysis of Detection of antigen card detected result
Table 7 clinical sample dual RT-PCR detected result
This success of the test establish the dual RT-PCR detection method that one can detect porcine epizootic diarrhea (PED) and transmissible gastroenteritis of swine (TGE) simultaneously.Carry out analysis to above-mentioned result of study to find, the dual RT-PCR detection method that this institute sets up has good applicability, can simultaneously for the detection of TGE and PED.
Embodiment 2
For differentiating a method of TGEV and PEDV, the method comprises the following steps:
1) viral RNA in testing sample is extracted;
2) by step 1) the RNA reverse transcription that obtains is cDNA;
3) by step 2) cDNA that obtains performs pcr amplification for wherein goal gene;
4) to amplified production order-checking, to determine wherein whether containing goal gene;
It is characterized in that: described goal gene is divided into TGEV goal gene and PEDV goal gene, wherein said TGEV goal gene is the S protein gene of TGEV, and described PEDV goal gene is the S protein gene of PEDV.
Embodiment 3
For differentiating a method of TGEV and PEDV, the method comprises the following steps:
1) viral RNA in testing sample is extracted;
2) by step 1) the RNA reverse transcription that obtains is cDNA;
3) by step 2) cDNA that obtains performs pcr amplification for wherein goal gene;
4) to amplified production order-checking, to determine wherein whether containing goal gene;
It is characterized in that: described goal gene is divided into TGEV goal gene and PEDV goal gene, wherein said TGEV goal gene is the S protein gene of TGEV, and described PEDV goal gene is the S protein gene of PEDV.
On the basis of above technical scheme, meet the following conditions:
Step 3) in be the two kind DNA moleculars of sequence as shown in SEQIDNO1 and SEQIDNO2 for the primer of pcr amplification.
Become to be grouped into below PCR reaction system: 10 × PCRbuffer4 ~ 6 μ L, dNTPMixture3 ~ 5 μ L, ExTaq0.4 ~ 0.6 μ L, primer concentration shown in SEQIDNO1 is 8 ~ 12 μMs, primer concentration shown in SEQIDNO2 is 8 ~ 12uM, CDNA template 2 ~ 3 μ L, ddH
2o30 ~ 35 μ L.
PCR reaction conditions is: 93 ~ 95 DEG C of denaturations, 4 ~ 6min, 93 ~ 95 DEG C of sex change 48 ~ 52s, 53 ~ 55 DEG C of annealing 48 ~ 52s, and 70 ~ 74 DEG C extend 48 ~ 52s, totally 33 ~ 37 circulations, and 70 ~ 74 DEG C extend 8 ~ 12min eventually.
Embodiment 4
For differentiating a method of TGEV and PEDV, the method comprises the following steps:
1) viral RNA in testing sample is extracted;
2) by step 1) the RNA reverse transcription that obtains is cDNA;
3) by step 2) cDNA that obtains performs pcr amplification for wherein goal gene;
4) to amplified production order-checking, to determine wherein whether containing goal gene;
It is characterized in that: described goal gene is divided into TGEV goal gene and PEDV goal gene, wherein said TGEV goal gene is the S protein gene of TGEV, and described PEDV goal gene is the S protein gene of PEDV.
On the basis of above technical scheme, meet the following conditions:
Step 3) in be the two kind DNA moleculars of sequence as shown in SEQIDNO3 and SEQIDNO4 for the primer of pcr amplification.
PCR reaction system comprises following composition: 10 × PCRbuffer4 ~ 6 μ L, dNTPMixture3 ~ 5 μ L, ExTaq0.4 ~ 0.6 μ L, primer concentration shown in SEQIDNO3 is 8 ~ 12 μMs, primer concentration shown in SEQIDNO4 is 8 ~ 12uM, CDNA template 2 ~ 3 μ L, ddH
2o30 ~ 35 μ L.
PCR reaction conditions is: 93 ~ 95 DEG C of denaturations, 4 ~ 6min, 93 ~ 95 DEG C of sex change 48 ~ 52s, 53 ~ 55 DEG C of annealing 48 ~ 52s, and 70 ~ 74 DEG C extend 48 ~ 52s, totally 33 ~ 37 circulations, and 70 ~ 74 DEG C extend 8 ~ 12min eventually.
Embodiment 5
For differentiating a method of TGEV and PEDV, the method comprises the following steps:
1) viral RNA in testing sample is extracted;
2) by step 1) the RNA reverse transcription that obtains is cDNA;
3) by step 2) cDNA that obtains performs pcr amplification for wherein goal gene;
4) to amplified production order-checking, to determine wherein whether containing goal gene;
It is characterized in that: described goal gene is divided into TGEV goal gene and PEDV goal gene, wherein said TGEV goal gene is the S protein gene of TGEV, and described PEDV goal gene is the S protein gene of PEDV.
On the basis of above technical scheme, meet the following conditions:
Step 3) in be four kinds of DNA moleculars for the primer of pcr amplification, its sequence is respectively as shown in SEQIDNO1, SEQIDNO2, SEQIDNO3, SEQIDNO4.
PCR reaction system comprises following composition: 10 × PCRbuffer4 ~ 6 μ L, dNTPMixture3 ~ 5 μ L, ExTaq0.4 ~ 0.6 μ L, primer concentration shown in SEQIDNO1 is 8 ~ 12 μMs, primer concentration shown in SEQIDNO2 is the primer concentration shown in 8 ~ 12uM, SEQIDNO3 is 8 ~ 12 μMs, and the primer concentration shown in SEQIDNO4 is 8 ~ 12uM, CDNA template 2 ~ 3 μ L, ddH
2o30 ~ 35 μ L.
PCR reaction conditions is: 93 ~ 95 DEG C of denaturations, 4 ~ 6min, 93 ~ 95 DEG C of sex change 48 ~ 52s, 53 ~ 55 DEG C of annealing 48 ~ 52s, and 70 ~ 74 DEG C extend 48 ~ 52s, totally 33 ~ 37 circulations, and 70 ~ 74 DEG C extend 8 ~ 12min eventually.
Above embodiments of the invention have been described in detail, but described content is only preferred embodiment of the present invention, not in order to limit the present invention.All make in application range of the present invention any amendment, equivalent to replace and improvement etc., all should be included within protection scope of the present invention.
SEQUENCELISTING
<110> Tianjin Ruipu Biotechnology Co., Ltd
<120> mono-kind can differentiate the dual RT-PCR method of TGEV and PEDV virus simultaneously
<160>4
<210>1
<211>24
<212>DNA
For the PCR primer of TGEVS protein-encoding gene amplification in <213> the present invention
<400>1
TATTTGTGGTTTTGGTTATAATGC24
<210>2
<211>24
<212>DNA
For the PCR primer of TGEVS protein-encoding gene amplification in <213> the present invention
<400>2
GGCTGTTTGGTAACTAATTTRCCA24
<210>3
<211>20
<212>DNA
For the PCR primer of PEDVS protein-encoding gene amplification in <213> the present invention
<400>3
TTTATTCTGTCACGCCATGT20
<210>4
<211>24
<212>DNA
For the PCR primer of PEDVS protein-encoding gene amplification in <213> the present invention
<400>4
CCAGATTTACAAACACCTATNTTA24
Claims (10)
1., for differentiating a method of TGEV and PEDV, the method comprises the following steps:
1) viral RNA in testing sample is extracted;
2) RNA reverse transcription step 1) obtained is cDNA;
3) by step 2) cDNA that obtains performs pcr amplification for wherein goal gene;
4) to amplified production order-checking, to determine wherein whether containing goal gene;
It is characterized in that: described goal gene is divided into TGEV goal gene and PEDV goal gene, wherein said TGEV goal gene is the S protein gene of TGEV, and described PEDV goal gene is the S protein gene of PEDV.
2. method according to claim 1, to is characterized in that in step 3) for the primer of pcr amplification it being the two kind DNA moleculars of sequence as shown in SEQIDNO1 and SEQIDNO2.
3. method according to claim 1, to is characterized in that in step 3) for the primer of pcr amplification it being the two kind DNA moleculars of sequence as shown in SEQIDNO3 and SEQIDNO4.
4. method according to claim 2, it is characterized in that PCR reaction system comprises following composition: 10 × PCRbuffer4 ~ 6 μ L, dNTPMixture3 ~ 5 μ L, ExTaq0.4 ~ 0.6 μ L, primer concentration shown in SEQIDNO1 is 8 ~ 12 μMs, primer concentration shown in SEQIDNO2 is 8 ~ 12uM, CDNA template 2 ~ 3 μ L, ddH
2o30 ~ 35 μ L.
5. method according to claim 4, is characterized in that PCR reaction conditions is: 93 ~ 95 DEG C of denaturations, 4 ~ 6min, 93 ~ 95 DEG C of sex change 48 ~ 52s, 53 ~ 55 DEG C of annealing 48 ~ 52s, 70 ~ 74 DEG C extend 48 ~ 52s, totally 33 ~ 37 circulations, 70 ~ 74 DEG C extend 8 ~ 12min eventually.
6. method according to claim 3, it is characterized in that PCR reaction system comprises following composition: 10 × PCRbuffer4 ~ 6 μ L, dNTPMixture3 ~ 5 μ L, ExTaq0.4 ~ 0.6 μ L, primer concentration shown in SEQIDNO3 is 8 ~ 12 μMs, primer concentration shown in SEQIDNO4 is 8 ~ 12uM, CDNA template 2 ~ 3 μ L, ddH
2o30 ~ 35 μ L.
7. method according to claim 6, is characterized in that PCR reaction conditions is: 93 ~ 95 DEG C of denaturations, 4 ~ 6min, 93 ~ 95 DEG C of sex change 48 ~ 52s, 53 ~ 55 DEG C of annealing 48 ~ 52s, 70 ~ 74 DEG C extend 48 ~ 52s, totally 33 ~ 37 circulations, 70 ~ 74 DEG C extend 8 ~ 12min eventually.
8. method according to claim 1, to it is characterized in that in step 3) for the primer of pcr amplification it being four kinds of DNA moleculars, its sequence is respectively as shown in SEQIDNO1, SEQIDNO2, SEQIDNO3, SEQIDNO4.
9. method according to claim 8, it is characterized in that PCR reaction system comprises following composition: 10 × PCRbuffer4 ~ 6 μ L, dNTPMixture3 ~ 5 μ L, ExTaq0.4 ~ 0.6 μ L, the primer concentration shown in SEQIDNO1 is 8 ~ 12 μMs, and the primer concentration shown in SEQIDNO2 is 8 ~ 12uM, primer concentration shown in SEQIDNO3 is 8 ~ 12 μMs, primer concentration shown in SEQIDNO4 is 8 ~ 12uM, CDNA template 2 ~ 3 μ L, ddH
2o30 ~ 35 μ L.
10. method according to claim 9, is characterized in that PCR reaction conditions is: 93 ~ 95 DEG C of denaturations, 4 ~ 6min, 93 ~ 95 DEG C of sex change 48 ~ 52s, 53 ~ 55 DEG C of annealing 48 ~ 52s, 70 ~ 74 DEG C extend 48 ~ 52s, totally 33 ~ 37 circulations, 70 ~ 74 DEG C extend 8 ~ 12min eventually.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510411851.XA CN105154583A (en) | 2015-07-14 | 2015-07-14 | Double-RT-PCR (reverse transcription-polymerase chain reaction) method for simultaneously identifying TGEV (transmissible gastroenteritis viruses) and PEDV (porcine epidemic diarrhea viruses) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510411851.XA CN105154583A (en) | 2015-07-14 | 2015-07-14 | Double-RT-PCR (reverse transcription-polymerase chain reaction) method for simultaneously identifying TGEV (transmissible gastroenteritis viruses) and PEDV (porcine epidemic diarrhea viruses) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105154583A true CN105154583A (en) | 2015-12-16 |
Family
ID=54795624
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510411851.XA Pending CN105154583A (en) | 2015-07-14 | 2015-07-14 | Double-RT-PCR (reverse transcription-polymerase chain reaction) method for simultaneously identifying TGEV (transmissible gastroenteritis viruses) and PEDV (porcine epidemic diarrhea viruses) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105154583A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109750123A (en) * | 2019-03-15 | 2019-05-14 | 龙岩学院 | A kind of RPA primed probe group and method detecting transmissible gastro-enteritis virus |
| CN114107570A (en) * | 2021-12-30 | 2022-03-01 | 青岛嘉智生物技术有限公司 | TGEV fluorescent quantitative RT-PCR detection primer probe combination, kit and detection method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103409558A (en) * | 2013-07-10 | 2013-11-27 | 东北农业大学 | Multiplex PCR primer group for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus simultaneously |
| CN103320537B (en) * | 2013-07-01 | 2014-07-09 | 青岛农业大学 | Method for detecting PEDV (porcine epidemic diarrhea virus) and TGEV (transmissible gastroenteritis virus) by double RT-PCR (reverse transcription-polymerase chain reaction), and oligonucleotide primer pair |
| CN103952496A (en) * | 2014-04-11 | 2014-07-30 | 上海交通大学 | Duplex PCR method for detecting porcine transmissible gastroenteritis virus and porcine epidemic diarrhea virus |
| CN104328223A (en) * | 2014-11-26 | 2015-02-04 | 哈药集团生物疫苗有限公司 | RT-PCR primer group and RT-PCR kit for simultaneously detecting four porcine RNA viruses |
-
2015
- 2015-07-14 CN CN201510411851.XA patent/CN105154583A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103320537B (en) * | 2013-07-01 | 2014-07-09 | 青岛农业大学 | Method for detecting PEDV (porcine epidemic diarrhea virus) and TGEV (transmissible gastroenteritis virus) by double RT-PCR (reverse transcription-polymerase chain reaction), and oligonucleotide primer pair |
| CN103409558A (en) * | 2013-07-10 | 2013-11-27 | 东北农业大学 | Multiplex PCR primer group for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus simultaneously |
| CN103952496A (en) * | 2014-04-11 | 2014-07-30 | 上海交通大学 | Duplex PCR method for detecting porcine transmissible gastroenteritis virus and porcine epidemic diarrhea virus |
| CN104328223A (en) * | 2014-11-26 | 2015-02-04 | 哈药集团生物疫苗有限公司 | RT-PCR primer group and RT-PCR kit for simultaneously detecting four porcine RNA viruses |
Non-Patent Citations (3)
| Title |
|---|
| 李军等: "RT-PCR检测猪传染性胃肠炎病毒", 《中国兽医学报》 * |
| 邹勇等: "猪流行性腹泻、猪传染性胃肠炎和猪轮状病毒RT-PCR鉴别诊断技术研究", 《上海农业学报》 * |
| 陈芳等: "多重RT-PCR检测猪传染性胃肠炎病毒和猪流行性腹泻病毒", 《中国兽医学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109750123A (en) * | 2019-03-15 | 2019-05-14 | 龙岩学院 | A kind of RPA primed probe group and method detecting transmissible gastro-enteritis virus |
| CN114107570A (en) * | 2021-12-30 | 2022-03-01 | 青岛嘉智生物技术有限公司 | TGEV fluorescent quantitative RT-PCR detection primer probe combination, kit and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103320537B (en) | Method for detecting PEDV (porcine epidemic diarrhea virus) and TGEV (transmissible gastroenteritis virus) by double RT-PCR (reverse transcription-polymerase chain reaction), and oligonucleotide primer pair | |
| CN103320535B (en) | Method for identifying wild strain and vaccine strain of hog cholera virus | |
| US20200149120A1 (en) | Sample nucleic acid measurement test kit, reagent, and application thereof | |
| CN106319092B (en) | A kind of quick discriminating Porcine epidemic diarrhea virus classics strain and HRM detection primers, kit and the method for variant | |
| CN111254223A (en) | Reaction system and kit for detecting African swine fever virus nucleic acid and application of reaction system and kit | |
| CN110551853A (en) | Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN103320536A (en) | African swine fever polymerase chain reaction (PCR) detection method and oligonucleotide primer pair | |
| CN107974513A (en) | A kind of bovine viral diarrhea virus detection kit and its application based on RPA | |
| CN103276103B (en) | Kit with RT-LAMP nucleic acid test strips for detecting porcine epidemic diarrhea virus and applications of kit | |
| CN105755124A (en) | Method for detecting salmonella with fluorescence method on basis of enzymatic remediation isothermal cycle amplification | |
| CN110423847A (en) | A kind of primer sets, kit and the method for African swine fever virus LAMP fluorescence detection | |
| CN113584227B (en) | Nested PCR (polymerase chain reaction) detection primer group and method for identifying African swine fever gene deletion strain | |
| CN105154583A (en) | Double-RT-PCR (reverse transcription-polymerase chain reaction) method for simultaneously identifying TGEV (transmissible gastroenteritis viruses) and PEDV (porcine epidemic diarrhea viruses) | |
| CN108624713B (en) | Method and kit for identifying and detecting porcine pseudorabies vaccine virus and wild virus | |
| CN103451315A (en) | Loop-mediated isothermal amplification detection primer set and kit for rotaviruses as well as detection method | |
| CN102876813B (en) | Real-time fluorescence RT-HDA (Reverse Transcriptase-Helicase-Dependent Isothermal Amplification) kit and primer for detecting avian influenza virus | |
| CN103789430B (en) | Kit for rapid detection of eperythrozoon, leptospira and toxoplasma in blood and application of kit | |
| CN109369796A (en) | A kind of enzyme-linked immunoassay method detecting sheep Toxoplasma Gondi IgG antibody | |
| CN101928780A (en) | A type foot-and-mouth disease virus two-color fluorescence PCR detection method and kit thereof | |
| CN103215389B (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| CN102912038B (en) | RT-HDA kit and primer for detecting avian influenza virus | |
| CN101294224B (en) | Primer and probe sequence for testing pig parvoviral nucleotide fragment | |
| CN104975077A (en) | Pig-sourced eperythrozoon fluorogenic quantitative PCR detection kit and application thereof | |
| CN102912039B (en) | RT-HDA (Reverse Transcription-Helicase-Dependent Isothermal Amplification) kit and primer for detecting foot-and-mouth disease virus | |
| CN105463133A (en) | Swine fever virus DNA/RNA (deoxyribonucleic acid/ribonucleic acid) heterozygosis probe-process detection kit and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151216 |