CN105154463B - A kind of structure of bacterial strain and application thereof being overexpressed Thermotoga maritima acetolactate synthase catalytic subunit - Google Patents
A kind of structure of bacterial strain and application thereof being overexpressed Thermotoga maritima acetolactate synthase catalytic subunit Download PDFInfo
- Publication number
- CN105154463B CN105154463B CN201510641578.XA CN201510641578A CN105154463B CN 105154463 B CN105154463 B CN 105154463B CN 201510641578 A CN201510641578 A CN 201510641578A CN 105154463 B CN105154463 B CN 105154463B
- Authority
- CN
- China
- Prior art keywords
- csu
- bacterial strain
- pac
- ahas
- thermotoga maritima
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- LVTXMYIUBLJPAA-MSZQBOFLSA-N CC([C@@H](C1=COCC1)O)O Chemical compound CC([C@@H](C1=COCC1)O)O LVTXMYIUBLJPAA-MSZQBOFLSA-N 0.000 description 1
- NBDHNFMRXZYAOO-UHFFFAOYSA-N OCC1=COCC1 Chemical compound OCC1=COCC1 NBDHNFMRXZYAOO-UHFFFAOYSA-N 0.000 description 1
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a kind of construction methods of bacterial strain and application thereof being overexpressed Thermotoga maritima acetolactate synthase catalytic subunit.The construction method of recombinant bacterial strain includes the following steps：Upstream and downstream primer is designed according to the gene order of TmAHAS CSU, the sense primer of design carries NdeI restriction enzyme sites, downstream primer obtains target gene segment then using Thermotoga maritima genomic DNA as template with I restriction enzyme sites of BamH by PCR amplification；Purpose segment is connected on expression vector pET28a, obtains recombinant plasmid pET28a TmAHAS CSU, and enter the recombinant plasmid transformed in competent cell to build the recombinant bacterial strain for being overexpressed Tm AHAS CSU albumen by thermal shock method.Demonstrate on this basis the recombinant bacterial strain function and it catalyze and synthesize the purposes in terms of R PAC and the like in Stereoselective.
Description
Technical field
The invention belongs to field of genetic engineering, and in particular to one kind for catalyzing and synthesizing (R)-phenylacetyl methanol (R-
) and the like PAC the construction method of bacterial strain.
Background technology
(R)-phenylacetyl methanol (R-PAC) be in medical industry synthesis the adrenergic precursor substance of α/β-, also by with
To synthesize L- ephedrines (L-ephedrine), pseudoephedrine (Pseudoephedrine) and phenylpropanolamine
(Norephedrin) drugs such as, while it is also common a kind of chiral intermediate during organic synthesis, can be used for chiral medicine
The synthesis of object.R-PAC is prepared currently with biotransformation method, is mainly catalyzed between pyruvic acid and benzaldehyde with yeast cells
Condensation reaction, but due to reaction rate is small and substrate be converted into target compound conversion ratio it is low so that this method is not one
A very effective R-PAC route of synthesis.Because the enzyme for playing catalytic action in the reaction is pyruvate decarboxylase (PDC), therefore
PDC after purification has also been used to prepare R-PAC, mainly there is zymomonas mobilis (Zymomonas mobilis) PDC
(ZmPDC) and S. cervisiae (Saccharomyces cerevisiae) PDC (ScPDC).ScPDC catalytic activity is higher, but
Stability is bad；ZmPDC shows preferable stability, but catalytic efficiency is relatively low.PDC is used to also have as catalyst preparation R-PAC
One more fatal problem, that is, PDC can be catalyzed pyruvate decarboxylation and form acetaldehyde, and the accumulation of acetaldehyde then can be to PDC
Enzyme generates irreversible inhibition, to greatly influence the generation of R-PAC.
Acetolactate synthase (AHAS) is branched-chain amino acid in microorganism and higher plant, such as valine, leucine and different
Key enzyme in the biosynthesis pathways such as leucine, AHAS is usually by two large subunits (also referred to as catalytic subunit) and two small subunits
(also referred to as adjusting subunit) is constituted, and large subunit usually plays catalytic action, and small subunit then primarily serves stable large subunit and adjusting
The active effect of large subunit.AHAS expression of enzymes amount is low in higher plant and purifying rear stability is poor；AHAS is extensive in microorganism
In the presence of.There are three kinds of AHAS isodynamic enzymes in common microbiological Escherichia coli (E.coli), it is referred to as AHAS I, II and III,
In with AHAS I, catalytic activity is best in the AHAS of all microbial sources.AHAS is a kind of typical diphosphothiamine
(ThPP) enzyme is relied on, in the presence of ThPP, AHAS can be catalyzed a molecule pyruvic acid and be condensed to form acetyl with another one's share of expenses for a joint undertaking pyruvic acid
Hydroxy acid, also referred to as 2- acetolactic acids, the substance are the biosynthesis precursors of branched chain amino acids valine, leucine；While the enzyme is also
A molecule pyruvic acid can be catalyzed and react generation 2- acetyl -2- hydroxybutyric acids with a molecule batanone acid, which is then branched-amino
The biosynthesis precursor of isoleucine；In addition, AHAS can also be catalyzed reacting between pyruvic acid and benzaldehyde, Stereoselective
Generate R-PAC.Just because of this, Escherichia coli AHAS I and II is used, respectively, to catalyze and synthesize R-PAC (S.Engel et
al.,Biotechnol.Bioeng.,2003,83:833-840；2004,88:825-831).Studies have shown that AHAS I and II are not
It only can be effectively catalyzed the synthesis of R-PAC, side reaction is few, and substrate conversion efficiency is high, and receptor substrate spectrum width, using a variety of
Substituted aromatic aldehyde is the analog that substrate synthesizes R-PAC.But there is also disadvantages for the reaction：1. as previously mentioned, AHAS is usual
It is made of two large subunits and two small subunits, to prepare the two subunits simultaneously when preparing the enzyme and then is reconstructed in vitro
It could obtain, this, which allows for enzyme preparation process, seems complicated；2. the usual stability of E.coli AHAS is poor, large subunit is independent
Although weaker catalytic activity is also shown in the presence of, stability is worse.The two shortcomings largely limit
Applications of the E.coli AHAS in terms of catalyzing and synthesizing R-PAC and the like.
Invention content
The present invention provides the bacterial strains that one kind can be used for catalyzing and synthesizing (R)-phenylacetyl methanol (R-PAC) and the like
Construction method, and then may be implemented to prepare R-PAC and the like by catalyst Stereoselective of the recombinant bacterial strain.
Technical scheme is as follows：
A kind of construction method for the bacterial strain being overexpressed Thermotoga maritima acetolactate synthase catalytic subunit, including following step
Suddenly：
1) upstream and downstream is designed according to the gene order of Thermotoga maritima acetolactate synthase catalytic subunit (TmAHAS-CSU)
Primer, wherein sense primer carry NdeI restriction enzyme sites, and downstream primer carries I restriction enzyme sites of BamH, specific as follows：
Sense primer：GGAATTCCATATGATGCTTCTGGACGAGATC
Downstream primer：CGCGGATCCTCATACTTTCCCCTCCCTAC
In the above primer, underscore part is the identification sequence of restriction enzyme；
2) using Thermotoga maritima genomic DNA as template, target gene is obtained by PCR amplification；
3) target gene is connected on pET28a prokaryotic expression carriers, obtains recombinant plasmid pET28a-TmAHAS-CSU；
4) recombinant plasmid pET28a-TmAHAS-CSU is transformed into E.coli competent cells by thermal shock method, is built
It is overexpressed the recombinant bacterial strain Ecoli-Tm-AHAS-CSU of Tm-AHAS-CSU albumen.
Wherein in step 4), the conversion of recombinant plasmid pET28a-TmAHAS-CSU can specifically carry out in accordance with the following methods：
4.1) E.coli competent cells used in are E.coli Rosetta (DE3) or E.coli BL21 (DE3)；
4.2) competent cell 100-300 μ L (OD600=0.1-0.4) are taken, slowly thawing is placed on ice；
4.3) recombinant plasmid pET28a-TmAHAS-CSU 20-50ng are taken, are added in the competent cell melted, are delayed
Slow pressure-vaccum mixing, stands 20-40min on ice；
4.4) it is put it into 40-45 DEG C of water-bath after thermal shock 80-100s after, then places ice bath 2-5min on ice；
4.5) the LB culture mediums of 600-1000 μ L are added into the competent cell after conversion, are positioned on constant-temperature table,
100-120rpm, 34-40 DEG C of culture 1-2h；
4.6) gained bacterium solution is collected and centrifuges 2-5min in 2800-3300rpm, discarded supernatant up to Tm- is overexpressed
The recombinant bacterial strain Ecoli-Tm-AHAS-CSU of AHAS-CSU.
Verified, the bacterial strain of above-mentioned overexpression Thermotoga maritima acetolactate synthase catalytic subunit has following important use
On the way：The bacterial strain can be directly used for Stereoselective and catalyze and synthesize R-Phenyl Acetyl Methanol (R-PAC) or its analog；It is described
Analog is any one compound in following three classes：
The first kind：R be halogen, nitro, hydroxyl, alkoxy or alkyl, the position of substitution be ortho position,
Meta or para position；
Second class：R is H, halogen, nitro, hydroxyl, alkoxy or alkyl, and the position of substitution is formyl
The ortho position of base, meta or para position；
Third class：R is H, halogen, nitro, hydroxyl, methoxyl group or alkyl, and the position of substitution is first
The ortho position of acyl group or meta position.
It catalyzes and synthesizes R-Phenyl Acetyl Methanol (R-PAC) accordingly or the method for its analog is also classified into following three classes：
First kind catalytic synthesis is
In the reaction, donor substrate is pyruvic acid, and receptor substrate is benzaldehyde (R=H), then product is R- phenyl acetyls
Methanol (R-PAC)；It is halogen, nitro, hydroxyl, alkoxy or alkyl that either receptor substrate, which is the benzaldehyde wherein R of substitution,
The position of substitution is ortho position, meta or para position, and product is the first kind analog of R-Phenyl Acetyl Methanol (R-PAC).
Second class catalytic synthesis is
In the reaction, donor substrate is pyruvic acid, and receptor substrate is pyridine carboxaldehyde (R=H) or the pyridine carboxaldehyde of substitution,
In for the substituted pyridine carboxaldehyde, substituent R is halogen, nitro, hydroxyl, alkoxy or alkyl, and the position of substitution is first
The ortho position of acyl group, meta or para position；Product is the second class analog of R-Phenyl Acetyl Methanol (R-PAC).
Third class catalytic synthesis is：
In the reaction, donor substrate is pyruvic acid, and receptor substrate is furtural (R=H) or the furtural of substitution,
In for the substituted furtural, substituent R is halogen, nitro, hydroxyl, methoxyl group or alkyl, and the position of substitution is first
The ortho position of acyl group or meta position；Product is the third class analog of R-Phenyl Acetyl Methanol (R-PAC).
Above-mentioned catalytic synthesis can specifically be realized by the following method：
Contain 20-80mM donor substrates, 10-40mM receptor substrates, 50-100mM in 1.0-3.0mL reaction mixtures
The HEPES or PBS or Tris-HCl buffer solutions, 0.5-5mM ThPP, 1-10mM MgCl of (pH 7.0-8.5)2、50-100mM
KCl, 0.25-2.0mM DTT and 1-20%DMSO；
100-300mg recombinant bacterial strains Ecoli-Tm- is added after 50-90 DEG C of preincubate 5-15min in reaction mixture
AHAS-CSU initiation reactions simultaneously continue to be incubated 0.5-3 hours at the same temperature；
Then, supernatant is collected by centrifugation, is extracted 2-3 times with chloroform or ethyl acetate, with anhydrous MgSO after organic phase merging4
Or anhydrous Na2SO4It is dry, it is filtered to remove solid content, filtrate evaporated under reduced pressure at 25-45 DEG C, gained residue is carried out with silicagel column
Purifying, eluant, eluent are petroleum ether-ethyl acetate V/V, 3:1.
The invention has the advantages that：
The bacterial strain that the present invention is built can be used directly to catalysis reaction, without purification TmAHAS-CSU albumen.This is
Since the Tm-AHAS-CSU albumen that the bacterial strain is overexpressed has splendid thermal stability, and only in the range of 70-90 DEG C
Just there is stronger catalytic activity, and other albumen have all been denaturalized under such reaction temperature, in bacterial strain, will not be produced to reaction
Raw any influence.
The links of the construction method can be completed by common technique for gene engineering.
Description of the drawings
Fig. 1 is the clone (A) for encoding Tm-AHAS-CSU genes and the structure of recombinant plasmid pET28a-TmAHAS-CSU
(B)。
Fig. 2 is the induced expression result of recombinant bacterial strain Ecoli-Tm-AHAS-CSU.
Fig. 3 is the determination of activity result of recombinant bacterial strain Ecoli-Tm-AHAS-CSU.
Specific implementation mode
Thermotoga maritima (Thermotoga maritime) is a kind of special strict anaerobe, is grown on 55~90
In DEG C environment, such as near seabed hot spring, volcanic crater.It is expressed in vivo since this bacterium can survive under hot conditions
Various enzymes also just have good thermal stability, and therefore, the high temperature resistant enzyme in Thermotoga maritima source has become the heat of research and development
Point, such as fire resistant xylanase, cellobiose phosphorylase and alpha-glucosidase have been cloned expression, and in feed work
Industry, paper industry, energy industry and food medicine and other fields are widely used.The present invention is according in GenBank
The gene order design primer of AHAS catalytic subunits is obtained using Thermotoga maritima genomic DNA as template by PCR amplification
To target enzyme gene, target fragment overall length is 1746bp.Target fragment is connected on pET28a carriers, recombinant plasmid is obtained
pET28a-TmAHAS-CSU；The recombinant plasmid is transferred in E.coli Rosetta (DE3) competent cell with thermal shock method with structure
The recombinant bacterial strain Ecoli-TmAHAS-CSU for being overexpressed TmAHAS-CSU is built, and then is selected by catalyst solid of the recombinant bacterial strain
Prepare R-PAC and the like to property.
Material therefor：
Thermotoga maritima complete genome DNA is purchased from German Culture Collection Center；E.coli Rosetta (DE3) competence is thin
The various reagents box and reagent used in born of the same parents, pET28a prokaryotic expression carriers and experiment are commercial prod, can be facilitated
It buys on ground.
The preparation of culture medium and reagent：
1, LB (Luria-Bertani) fluid nutrient medium：5g yeast extracts, 10g tryptones, 10g are weighed respectively
NaCl is dissolved in 800mL redistilled waters (ddH2O in), pH is then adjusted to 7.0 with 2M NaOH, then use ddH2O is diluted to
1L, high pressure sterilization 20min at 121 DEG C, 4 DEG C preserve it is for use；
2, LB solid mediums：Weigh 0.5g yeast extracts respectively, 1g tryptones, 1g NaCl, 1.5g agar is molten
Solution is in 90mL ddH2In O, pH is then adjusted to 7.0 with 2M NaOH, then use ddH2O is diluted to 100mL, high pressure sterilization at 121 DEG C
20min waits for that liquid is cooled to 60 DEG C or so, averagely pours into the culture dish of 6 sterilizings, and cooling is placed on 4 DEG C and saves backup；
3, isopropyl-beta D-thio galactopyranoside (IPTG) solution：0.24g IPTG are weighed, it is sterile to be dissolved in 10mL
In water, make its final concentration of 100mM, is preserved for use in 4 DEG C after packing；
Building process includes specifically following operating procedure：
1, the clone of coding Thermotoga maritima acetolactate synthase catalytic subunit (TmAHAS-CSU) gene and recombinant plasmid
The structure of pET28a-TmAHAS-CSU：
1) clone of TmAHAS-CSU genes is encoded：Using Thermotoga maritima complete genome DNA as template, modern molecular is utilized
The gene of biology techniques clone's coding Tm-AHAS-CSU, designed primer are respectively that (underscore part is restriction enzyme
The identification sequence of enzyme, respectively NdeI and BamHI)：
Forward primer：GGAATTCCATATGATGCTTCTGGACGAGATC
Reverse primer：CGCGGATCCTCATACTTTCCCCTCCCTAC
Referring to Fig. 1, (A) M swimming lanes are nucleic acid Maker, and 1,2,3,4 swimming lanes are PCR product；(B) M swimming lanes are nucleic acid
Maker, swimming lane 1 are purpose Gene A HAS-CSU, and swimming lane 2 is carrier pET28a, and swimming lane 3 is recombinant plasmid pET28a-TmAHAS-
CSU NdeI single endonuclease digestions are as a result, swimming lane 4 is recombinant plasmid pET28a-TmAHAS-CSU NdeI and BamHI double digestion results.
Between Fig. 1 (A) result shows that purpose band appears in 1.5kb-2.0kb, with TmAHAS-CSU encoding genes
(1.746kb) theoretical value size is almost the same, tentatively shows that PCR amplification has gone out target gene.
2) structure of recombinant plasmid pET28a-TmAHAS-CSU：It will be obtained in 1) using general molecular biology techniques
Genetic fragment is inserted into carrier pET28a, and pET28a-TmAHAS-CSU recombinant plasmids are built.
Fig. 1 (B) result shows after recombinant plasmid double digestion there are two bands, one between 1.5-2.0kb, for purpose base
Cause, another is pET-28a between 5.0-7.0kb, and after the processing of recombinant plasmid single endonuclease digestion, an only band, slightly above
7.0kb is the sum of purpose gene and pET-28a sizes, further determines that construction of recombinant plasmid success.
2, expression and the Function Identification of the structure, Tm-AHAS-CSU albumen of Tm-AHAS-CSU bacterial strains are overexpressed：
1) conversion of recombinant plasmid pET28a-TmAHAS-CSU：
(1) by 200 μ L (OD of E.coli Rosetta (DE3) competent cell600=0.3) it is placed on ice, slowly melts.
(2) recombinant plasmid pET28a-TmAHAS-CSU 30ng (about 5 μ L) are taken, the competent cell melted is added to
In, slow pressure-vaccum mixing stands 30min on ice.
(3) it is put it into 42 DEG C of water-baths after, after thermal shock 90s, then places ice bath 2.5min on ice.
(4) the LB culture mediums of 800 μ L are added into the competent cell after conversion, are positioned on constant-temperature table, 100-
120rpm, 37 DEG C of culture 1h.
(5) gained bacterium solution is collected and centrifuges 2min in 3000rpm, discarded most of supernatant and be overexpressed Tm-AHAS- to obtain the final product
The bacterial strain Ecoli-Tm-AHAS-CSU of CSU.
2) induced expression of recombinant bacterial strain Ecoli-Tm-AHAS-CSU：
(1) recombinant bacterial strain Ecoli-Tm-AHAS-CSU is preserved liquid to be placed on ice to melt, is picked on a small quantity, is drawn with oese
Line (contains 50 μ g/mL of kanamycins in solid medium；34 μ g/mL of chloramphenicol) on, it is put in 37 DEG C of constant incubators and cultivates
2h continues to cultivate 12h later by Flat plate turnover；
(2) monoclonal colonies that picking is of moderate size, surface is smooth, the LB liquid medium for being inoculated in 5mL (contain and block that
50 μ g/mL of mycin；34 μ g/mL of chloramphenicol) in, 37 DEG C, shake 12h on shaking table under the conditions of 180rpm.
(3) previous step bacterium solution 5mL is taken to be added to 500mL LB liquid mediums (containing 50 μ g/mL of kanamycins；Chloramphenicol
34 μ g/mL) in, 37 DEG C, 220rpm cultures 2-3h.
(4) when measuring bacterium solution OD600 and reaching between 0.4-0.6, IPTG (final concentration of 0.5mM), 25 DEG C, 200rpm is added
Induce 4h.
(5) collect bacterium solution, 4 DEG C, 6000rpm centrifugation 10min after, discard supernatant, collect bacterial sediment simultaneously weigh.
Fig. 2 is the induced expression result of recombinant bacterial strain Ecoli-Tm-AHAS-CSU.Swimming lane M is Protein in figure
Maker, swimming lane 1 are not induce full bacterium, and 2 be the full bacterium of induction.Comparison swimming lane 1 and 2 can find that swimming lane 2 obviously has albumen at 66kD
Overexpression, this is consistent with expected results, illustrates Tm-AHAS-CSU successful expressions.The above experiment confirms to be overexpressed Tm-
The bacterial strain Ecoli-Tm-AHAS-CSU of AHAS-CSU is successfully built.
3) activity of colorimetric method for determining recombinant bacterial strain Ecoli-Tm-AHAS-CSU：
Principle：The pyruvic acid of two molecules is in ThPP and Mg2+In the presence of be catalyzed to form acetolactic acid by AHAS, acetolactic acid exists
Under strong acidic condition decarboxylation generate 3-hydroxy-2-butanone (3-Hydroxybutanone), 3-hydroxy-2-butanone in the presence of containing guanidine compound (such as creatine) with
α-alkali naphthols forms red network object, and the complex compound is in A525There is maximum absorption peak at place.It can be to obtained heavy using the reaction
The activity of group bacterial strain Ecoli-Tm-AHAS-CSU is detected.
Detection：Contain 50mM K in 200 μ L reaction mixtures3PO4(pH 7.0), 1mM ThPP, 10mM MgCl2, 50mM
30mg E.coli Rosetta (DE3) bacterial strain (negative control) or recombinant bacterial strain are added after 80 DEG C of preincubate 10min for pyruvic acid
Ecoli-Tm-AHAS-CSU initiation reactions.Continue at the same temperature after being incubated 45min, 30 μ L are added into reaction system
4M H2SO4, 15min is incubated again under the conditions of 65 DEG C to terminate reaction；100 μ L reaction products are taken, the flesh of 90 μ L 0.17% is added
After sour, 90 μ L1.7% alpha-Naphthol (4M NaOH solutions), it is incubated 15min in 65 DEG C of water-baths, is placed at room temperature for 15min,
The absorption value that system 525nm is measured after 6000rpm centrifugations adds E.coli Rosetta using the sample for being not added with bacterial strain as blank
(DE3) sample of bacterial strain is as negative control.Measurement result is as shown in Figure 3.Fig. 3 is recombinant bacterial strain Ecoli-Tm-AHAS-CSU
Determination of activity as a result, curve 1：Blank；Curve 2：Negative control；Curve 3：Ecoli-Tm-AHAS-CSU bacterial strains.
Result above further confirms that constructed Ecoli-Tm-AHAS-CSU bacterial strains can be overexpressed Tm-AHAS-CSU
Albumen.
3, using Ecoli-Tm-AHAS-CSU bacterial strains as catalyst preparation R-PAC and the like：
1) prepared by R-PAC：Reaction equation is as follows.
Contain 100mM HEPES buffer solutions (pH 7.0), 1mM ThPP, 5mM MgCl in 2.0mL reaction mixtures2,
200mg is added after 60mM KCl, 0.5mM DTT, 50mM pyruvic acid, 30mM benzaldehydes and 4%DMSO, 80 DEG C of preincubate 10min
Recombinant bacterial strain Ecoli-Tm-AHAS-CSU initiation reactions simultaneously continue to be incubated 1 hour at the same temperature.It is collected by centrifugation later
Clear liquid extracts (2mL × 3) with chloroform, with a small amount of anhydrous MgSO after organic phase merging4It is dry, be filtered to remove solid content, filtrate in
Evaporated under reduced pressure at 30 DEG C, gained residue are purified with silicagel column, eluant, eluent be petroleum ether-ethyl acetate (V/V, 3:1).It receives
The part containing R-PAC collected merges, and vacuum distillation removes solvent, obtains R-PAC sterling 7.4mg, yield 82.2%.
HRESI-MS (negative ion mode) m/z:(100%) 149.0605 [M-H]-, theoretical value：150.0671；[α]20 D-183°(c
3.1,MeOH)。1H-NMR(400MHz,CDCl3)δ2.09(s,3H),2.30(s,1H,OH),5.14(s,1H),7.30(m,5H)。
Since there is similar chemical property with receptor substrate benzaldehyde, it is expected that, when using chemical combination below
When object is as receptor substrate：
Wherein R be halogen (Cl, Br etc.), nitro, hydroxyl, alkoxy or alkyl, the position of substitution be ortho position,
Meta or para position；It still is able to that corresponding similar product is obtained by the reaction well
2) prepared by (R) -3- pyridyl group oxyacetones：Reaction equation is as follows.
Contain 100mM HEPES buffer solutions (pH 7.0), 1mM ThPP, 5mM MgCl in 2.0mL reaction mixtures2,
It is added after 60mM KCl, 0.5mM DTT, 50mM pyruvic acid, 30mM 3- pyridine carboxaldehydes and 4%DMSO, 80 DEG C of preincubate 10min
200mg recombinant bacterial strain Ecoli-Tm-AHAS-CSU initiation reactions simultaneously continue to be incubated 1 hour at the same temperature.It centrifuges later
Supernatant is collected, (2mL × 3) are extracted with chloroform, with a small amount of anhydrous MgSO after organic phase merging4It is dry, it is filtered to remove solid content,
Filtrate evaporated under reduced pressure at 30 DEG C, gained residue are purified with silicagel column, eluant, eluent be petroleum ether-ethyl acetate (V/V,
2:1).The part containing target compound being collected into merges, and vacuum distillation removes solvent, obtains (R) -3- pyridyl group acetyl first
Alcohol sterling 7.0mg, yield 77.8%.HRESI-MS (negative ion mode) m/z:(100%) 150.0618 [M-H]-, theoretical value：
151.0633；[α]20 D-164°(c 4.1,MeOH)。1H-NMR(400MHz,CDCl3)δ2.12(s,3H),2.23(s,1H,OH),
5.43 (s, 1H), 7.40 (m, 1H), 7.83 (d, 1H, J=7Hz), 8.53 (d, 1H, J=6Hz), 8.78 (s, 1H).
Since there is similar chemical property with receptor substrate pyridine carboxaldehyde, it is expected that, when using belowization
When closing object as receptor substrate：
Wherein R is that H, halogen (Cl, Br etc.), nitro, hydroxyl, alkoxy or alkyl, the position of substitution are first
The ortho position of acyl group, meta or para position；It still is able to that corresponding similar product is obtained by the reaction well
3) prepared by (R) -3- furyl oxyacetones：Reaction equation is as follows.
Contain 100mM HEPES buffer solutions (pH 7.0), 1mM ThPP, 5mM MgCl in 2.0mL reaction mixtures2,
It is added after 60mM KCl, 0.5mM DTT, 50mM pyruvic acid, 30mM 3- furturals and 4%DMSO, 80 DEG C of preincubate 10min
200mg recombinant bacterial strain Ecoli-Tm-AHAS-CSU initiation reactions simultaneously continue to be incubated 1 hour at the same temperature.It centrifuges later
Supernatant is collected, (2mL × 3) are extracted with chloroform, with a small amount of anhydrous MgSO after organic phase merging4It is dry, it is filtered to remove solid content,
Filtrate evaporated under reduced pressure at 30 DEG C, gained residue are purified with silicagel column, eluant, eluent be petroleum ether-ethyl acetate (V/V,
3:1).The part containing target compound being collected into merges, and vacuum distillation removes solvent, obtains (R) -3- furyl acetyl first
Alcohol sterling 6.7mg, yield 79.8%.HRESI-MS (negative ion mode) m/z:(100%) 139.0445 [M-H]-, theoretical value：
140.0473；[α]20 D-123°(c 3.5,MeOH)。1H-NMR(400MHz,CDCl3)δ2.11(s,3H),2.30(s,1H,OH),
5.33 (s, 1H), 6.15 (d, 1H, J=6), 7.25 (m, 2H).
Since there is similar chemical property with receptor substrate furtural, it is expected that, when using belowization
When closing object as receptor substrate：
Wherein R is that H, halogen (Cl, Br etc.), nitro, hydroxyl, methoxyl group or alkyl, the position of substitution are first
The ortho position of acyl group or meta position；It still is able to that corresponding similar product is obtained by the reaction well
Claims (6)
1. being overexpressed the purposes of the bacterial strain of Thermotoga maritima acetolactate synthase catalytic subunit, it is characterised in that：The purposes is
Refer to the bacterial strain and be directly used in Stereoselective and catalyze and synthesize R-Phenyl Acetyl Methanol (R-PAC) or its analog, catalysis is anti-
It is 70-90 DEG C to answer temperature；The analog is any one compound in following three classes：
The first kind：R is halogen, nitro, hydroxyl, alkoxy or alkyl, and the position of substitution is ortho position, meta position
Or contraposition；
Second class：R is H, halogen, nitro, hydroxyl, alkoxy or alkyl, and the position of substitution is formoxyl
Ortho position, meta or para position；
Third class：R is H, halogen, nitro, hydroxyl, methoxyl group or alkyl, and the position of substitution is formoxyl
Ortho position or meta position；
The bacterial strain for being overexpressed Thermotoga maritima acetolactate synthase catalytic subunit builds to obtain via following steps：
1) upstream and downstream primer is designed according to the gene order of Thermotoga maritima acetolactate synthase catalytic subunit (TmAHAS-CSU),
Wherein sense primer carries NdeI restriction enzyme sites, and downstream primer carries I restriction enzyme sites of BamH, specific as follows：
Sense primer：GGAATTCCATATGATGCTTCTGGACGAGATC
Downstream primer：CGCGGATCCTCATACTTTCCCCTCCCTAC
In the above primer, underscore part is the identification sequence of restriction enzyme；
2) using Thermotoga maritima genomic DNA as template, target gene is obtained by PCR amplification；
3) target gene is connected on pET28a prokaryotic expression carriers, obtains recombinant plasmid pET28a-TmAHAS-CSU；
4) recombinant plasmid pET28a-TmAHAS-CSU is transformed into E.coli competent cells by thermal shock method, built table
Up to the recombinant bacterial strain Ecoli-Tm-AHAS-CSU of Tm-AHAS-CSU albumen.
2. purposes according to claim 1, it is characterised in that：In step 4), recombinant plasmid pET28a-TmAHAS-CSU's
Method for transformation is specific as follows：
4.1) E.coli competent cells used in are E.coli Rosetta (DE3) or E.coli BL21 (DE3)；
4.2) take OD600The competent cell 100-300 μ L of=0.1-0.4 are placed on ice slowly thawing；
4.3) recombinant plasmid pET28a-TmAHAS-CSU 20-50ng are taken, is added in the competent cell melted, slowly blows
Persorption is even, stands 20-40min on ice；
4.4) it is put it into 40-45 DEG C of water-bath after thermal shock 80-100s after, then places ice bath 2-5min on ice；
4.5) the LB culture mediums of 600-1000 μ L are added into the competent cell after conversion, are positioned on constant-temperature table, 100-
120rpm, 34-40 DEG C of culture 1-2h；
4.6) gained bacterium solution is collected and centrifuges 2-5min in 2800-3300rpm, discarded supernatant up to Tm-AHAS- is overexpressed
The recombinant bacterial strain Ecoli-Tm-AHAS-CSU of CSU.
3. being catalyzed and synthesized using the bacterial strain of the overexpression Thermotoga maritima acetolactate synthase catalytic subunit described in claim 1
The method of R-Phenyl Acetyl Methanol (R-PAC) or its analog, it is characterised in that：
Catalytic synthesis is
In the reaction, donor substrate is pyruvic acid, and receptor substrate is benzaldehyde (R=H), then product is R-Phenyl Acetyl Methanol
(R-PAC)；It is halogen, nitro, hydroxyl, alkoxy or alkyl, substitution that either receptor substrate, which is the benzaldehyde wherein R of substitution,
Position is ortho position, meta or para position, and product is the first kind analog of R-Phenyl Acetyl Methanol (R-PAC).
4. being catalyzed and synthesized using the bacterial strain of the overexpression Thermotoga maritima acetolactate synthase catalytic subunit described in claim 1
The method of R-Phenyl Acetyl Methanol (R-PAC) or its analog, it is characterised in that：
Catalytic synthesis is
In the reaction, donor substrate is pyruvic acid, and receptor substrate is pyridine carboxaldehyde (R=H) or the pyridine carboxaldehyde of substitution, wherein right
In the substituted pyridine carboxaldehyde, substituent R is halogen, nitro, hydroxyl, alkoxy or alkyl, and the position of substitution is formoxyl
Ortho position, meta or para position；Product is the second class analog of R-Phenyl Acetyl Methanol (R-PAC).
5. being catalyzed and synthesized using the bacterial strain of the overexpression Thermotoga maritima acetolactate synthase catalytic subunit described in claim 1
The method of R-Phenyl Acetyl Methanol (R-PAC) or its analog, it is characterised in that：
Catalytic synthesis is：
In the reaction, donor substrate is pyruvic acid, and receptor substrate is furtural (R=H) or the furtural of substitution, wherein right
In the substituted furtural, substituent R is halogen, nitro, hydroxyl, methoxyl group or alkyl, and the position of substitution is formoxyl
Ortho position or meta position；Product is the third class analog of R-Phenyl Acetyl Methanol (R-PAC).
6. described catalyzing and synthesizing R-Phenyl Acetyl Methanol (R-PAC) or the side of its analog according to claim 3 to 5 is any
Method, it is characterised in that：
Contain 20-80mM donor substrates, 10-40mM receptor substrates, 50-100mM pH in 1.0-3.0mL reaction mixtures
HEPES or PBS or Tris-HCl buffer solution, 0.5-5mM ThPP, the 1-10mM MgCl of 7.0-8.52、50-100mM KCl、
0.25-2.0mM DTT and 1-20%DMSO；
100-300mg recombinant bacterial strains Ecoli-Tm- is added after 70-90 DEG C of preincubate 5-15min in above-mentioned reaction mixture
AHAS-CSU initiation reactions simultaneously continue to be incubated 0.5-3 hours at the same temperature；
Then, supernatant is collected by centrifugation, is extracted 2-3 times with chloroform or ethyl acetate, with anhydrous MgSO after organic phase merging4Or nothing
Water Na2SO4It is dry, it is filtered to remove solid content, filtrate evaporated under reduced pressure at 25-45 DEG C, gained residue is carried out pure with silicagel column
Change, eluant, eluent is volume ratio 3:1 petroleum ether-ethyl acetate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510641578.XA CN105154463B (en) | 2015-09-30 | 2015-09-30 | A kind of structure of bacterial strain and application thereof being overexpressed Thermotoga maritima acetolactate synthase catalytic subunit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510641578.XA CN105154463B (en) | 2015-09-30 | 2015-09-30 | A kind of structure of bacterial strain and application thereof being overexpressed Thermotoga maritima acetolactate synthase catalytic subunit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105154463A CN105154463A (en) | 2015-12-16 |
| CN105154463B true CN105154463B (en) | 2018-10-02 |
Family
ID=54795508
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510641578.XA Active CN105154463B (en) | 2015-09-30 | 2015-09-30 | A kind of structure of bacterial strain and application thereof being overexpressed Thermotoga maritima acetolactate synthase catalytic subunit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105154463B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1409768A (en) * | 1999-12-13 | 2003-04-09 | 维多利亚科技大学 | Yeast-based process for production of L-PAC |
| CN1440460A (en) * | 2000-07-05 | 2003-09-03 | 巴斯福股份公司 | Microbial production of R-phenylacetylcarbinol by biotransformation of benzaldehyde by filamentous fungi |
| CN1451753A (en) * | 2003-05-21 | 2003-10-29 | 江南大学 | Technical scheme for increasing maricolous thermobacillus xylanase B gene expression level by large margin |
| CN1544640A (en) * | 2003-11-17 | 2004-11-10 | 中国农业大学 | Expression method for high temperature resistant xylanase and specific expression carrier for same |
| CN103710328A (en) * | 2013-12-27 | 2014-04-09 | 西北大学 | Preparation and preservation method for colon bacillus acetohydroxyacid synthase |
-
2015
- 2015-09-30 CN CN201510641578.XA patent/CN105154463B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1409768A (en) * | 1999-12-13 | 2003-04-09 | 维多利亚科技大学 | Yeast-based process for production of L-PAC |
| CN1440460A (en) * | 2000-07-05 | 2003-09-03 | 巴斯福股份公司 | Microbial production of R-phenylacetylcarbinol by biotransformation of benzaldehyde by filamentous fungi |
| CN1451753A (en) * | 2003-05-21 | 2003-10-29 | 江南大学 | Technical scheme for increasing maricolous thermobacillus xylanase B gene expression level by large margin |
| CN1544640A (en) * | 2003-11-17 | 2004-11-10 | 中国农业大学 | Expression method for high temperature resistant xylanase and specific expression carrier for same |
| CN103710328A (en) * | 2013-12-27 | 2014-04-09 | 西北大学 | Preparation and preservation method for colon bacillus acetohydroxyacid synthase |
Non-Patent Citations (3)
| Title |
|---|
| Acetohydroxyacid Synthase: A New Enzyme for Chiral Synthesis of R-Phenylacetylcarbinol;Stanislav Engel等;《 BIOTECHNOLOGY AND BIOENGINEERING》;20030930;第83卷(第7期);833-840 * |
| Crystal structures of TM0549 and NE1324—two orthologs of E. coli AHAS isozyme III small regulatory subunit;JANUSZ J. PETKOWSKI等;《Protein Science 》;20071231;第16卷;1360-1367 * |
| 海栖热袍菌两种焦磷酸硫胺素依赖型酶的研究;赵继奎;《中国优秀硕士学位论文全文数据库》;20151215(第12期);A006-104 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105154463A (en) | 2015-12-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Abdoul‐Zabar et al. | Thermostable transketolase from Geobacillus stearothermophilus: characterization and catalytic properties | |
| JP2006238883A (en) | Method for fermentatively producing s-adenosylmethionine | |
| CN104140959B (en) | Novel esterase as well as coding gene and application of esterase | |
| Malla et al. | A sustainable route to produce the scytonemin precursor using Escherichia coli | |
| CN114350727B (en) | Method for synthesizing D-psicose by combining phosphorylation and ATP regeneration system | |
| CN108949652B (en) | Engineering bacterium and application thereof in producing caffeic acid | |
| CN104152478A (en) | Method for coproducing D-arginine and gamatine through biotransformation | |
| CN114807206B (en) | Bacterial strain for synthesizing poly (3-hydroxybutyrate-co-4-hydroxybutyrate) and construction method and application thereof | |
| CN113817782B (en) | Full biosynthesis method of pimelic acid | |
| CN102952826A (en) | Method for eliminating capability of klebsiella pneumoniae in synthesizing 2,3-butanediol and acetoin | |
| CN113151198B (en) | Gamma-glutamine synthetase mutant, coding gene, amino acid sequence and application thereof | |
| CN110564660A (en) | Recombinant microorganism and method for producing orotic acid | |
| CN104130967A (en) | Escherichia coli with coexpression of L-lactate dehydrogenase and formate dehydrogenase as well as construction method and application of escherichia coli | |
| CN112080452B (en) | High-yield phenyllactic acid bacillus licheniformis genetically engineered bacterium, method for producing phenyllactic acid and application | |
| CN111394289B (en) | Genetically engineered bacterium and application thereof, and method for producing prostaglandin E2 | |
| CN105154463B (en) | A kind of structure of bacterial strain and application thereof being overexpressed Thermotoga maritima acetolactate synthase catalytic subunit | |
| CN104480127A (en) | Hyperthermophilic glycosidase mutant and application thereof in preparation of ginsenoside CK | |
| Ye et al. | Homologous expression and characterization of α-L-rhamnosidase from aspergillus Niger for the transformation of flavonoids | |
| WO2014080687A1 (en) | 1,4-butanediol manufacturing method and microorganism | |
| CN108949840B (en) | Engineering bacterium and application thereof in production of p-hydroxycinnamic acid | |
| CN103740669A (en) | Method for improving beta-cyclodextrin production capability of cyclodextrin glycosyltransferase by calcium ion binding site amino acid residue mutation | |
| CN115896211A (en) | Genetic engineering bacterium for producing citicoline by fermentation and application | |
| Li et al. | Biochemical characterization of an organic solvent‐tolerant glycosyltransferase from Bacillus licheniformis PI15 with potential application for raspberry ketone glycoside production | |
| Cheng et al. | Enhanced production of coenzyme Q10 by overexpressing HMG-CoA reductase and induction with arachidonic acid in Schizosaccharomyces pombe | |
| Duan et al. | Cloning, expression, characterization and application of atcA, atcB and atcC from Pseudomonas sp. for the production of L-cysteine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |