CN105132497A - Preparation process of recombinant poultry interferon alpha product lyophilized preparation - Google Patents
Preparation process of recombinant poultry interferon alpha product lyophilized preparation Download PDFInfo
- Publication number
- CN105132497A CN105132497A CN201510532757.XA CN201510532757A CN105132497A CN 105132497 A CN105132497 A CN 105132497A CN 201510532757 A CN201510532757 A CN 201510532757A CN 105132497 A CN105132497 A CN 105132497A
- Authority
- CN
- China
- Prior art keywords
- interferon alpha
- fowl
- restructuring
- preparation
- finished product
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses a preparation process of a recombinant poultry interferon alpha product lyophilized preparation; the recombinant poultry interferon alpha product lyophilized preparation is prepared from a lyophilized strain of Bl21/pET-32 alpha-rChIFN alpha engineering bacterium of recombinant poultry interferon alpha by three steps, namely stock solution preparation, semi-finished product preparation and finished product preparation. The recombinant poultry interferon alpha prepared by the preparation process disclosed by the invention is in a lyophilized form that the interferon content is more than or equal to 1 to the power of 9 units/bottle, and the recombinant poultry interferon alpha can be preserved for a long term at 2-8 DEG C and can be preserved for 2 years at room temperature of 25 DEG C. Compared with the prior art, the established recombinant poultry interferon alpha is target protein which is expressed in supernantant liquid after the disruption of escherichia coli engineering bacterium, so as to avoid denaturation and renaturation processes which are required by the expression of protein in the form of an inclusion body; and meanwhile, detailed technical parameters and a corresponding quality control system are established for preparation and production process in each step, so as to lay a foundation for the industrialization of the recombinant poultry interferon alpha.
Description
Technical field
The present invention relates to field of biological pharmacy, particularly relate to the freeze-dried preparation production field of genetic engineering interferon albumen.
Background technology
Along with the fast development of global livestock and poultry breeding industry in recent years, China's aquaculture is the kind of bird or quantity is all positioned at prostatitis, the world.But, also there is a lot of problem in aviculture, as viral infectious diseases such as bird flu, duck hepatitis, all can break out in different seasons every year, these animals are once infection morbidity, have that morbidity is anxious, clinical symptom seriously, very easily Spreading and diffusion and case fatality rate and all higher feature of mortality ratio, cause tremendous economic to lose to aquaculture; What is more important, bird and mankind's close contact, some viral infectious is returned human health as bird flu etc. and is brought potential threat.The control of current bird communicable disease mainly adopts vaccine immunity and pharmacological agent, and because the serotype of vaccine immunity is single, and the serotype of virus is complicated, and strain variation is fast, often causes vaccine immunity failure.Some virus diseases there is no vaccine at present and can use, and some virus also directly may jeopardize the health of the mankind.
People's microbiotic and antiviral chemicals is mainly adopted to treat for the pharmacological agent that fowl transmissible disease is conventional at present, but the food drug residue problem caused, bring threat to human health.Now some countries oneself prohibite some microbiotic and the application of antiviral in aquaculture.Therefore, use interference without any side effects usually to treat and prevent avian viral diseases will to be the current problem comparatively paid close attention to.
The Interferon, rabbit protein with broad-spectrum antiviral, antitumor and immunoregulation effect that to be a class induce body to produce by materials such as virus and lipopolysaccharides, first nineteen fifty-seven is found by Issacs and Lindeman, it is the multi-functional cytokine of a class, after being combined with cell receptor, body can be induced to produce multiple specific protein and enzyme, mainly through suppress virogene transcribe and viral RNA of degrading suppress virus growth and breeding and play antitumor etc. activity.According to the generation cell of Interferon, rabbit, biochemical character and the effect that plays in immunity of organism different, be divided into α, β, γ tri-kinds of types.Existing known, interferon alpha can act on virus infected cell in vivo selectively, by suppressing the biosynthesizing of the virus protein in infected cell, plays wide spectrum and efficient disease-resistance toxic action, but to normal host cell without effect.
The expression of current recombination chicken interferon alpha in escherichia coli has been reported, but its technique is expresses target protein with the inclusion body in fermentation thalli, cause in production process, needing the albumen to inclusion body is expressed to carry out denature and renature, thus cause complex manufacturing and also cost higher, constrain its application in veterinary applications.
The investigation and application of lyophilized vaccine is the hot issue in Present Domestic veterinary biologics industry; past lyophilized vaccine will be sucrose skimmed milk and gelatin, sucrose; goods require-15 DEG C of cryopreservation; as 2 ~ 8 DEG C of preservations only deposit 6 months, bring larger difficulty to veterinary biologics storage and transport.Need a kind of novel protective agent that biological products can be allowed 2 ~ 8 DEG C of stable preservations more than 24 months.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of preparation technology of fowl interferon alpha finished product freeze-dried preparation of recombinating, with the freeze-drying lactobacillus of the BL21/pET-32 α-rChIFN α engineering bacteria of fowl interferon alpha of recombinating, (Anhui Jiuchuan Biotechnology Co., Ltd. produces, Ministry of Agriculture's Transgene-safty certificate: Nong Jian demonstrate,proves No. 034th, word 2014) be raw material, its DNA sequence dna, as shown in SEQUENCELISTING400 < 1 >, obtains through following steps: prepared by (1) stoste; (2) work in-process preparation; (3) finished product preparation.
Step specifically comprises the following steps in (1): (1-1) one-level seeding breeds; (1-2) secondary seeding breeding; (1-3) ferment; (1-4) broken; (1-5) purifying; (1-6) stoste detects.
Step (1-1) specifically comprises the following steps: the freeze-drying lactobacillus 1 opening the BL21/pET-32 α-rChIFN α engineering bacteria of expressing restructuring fowl interferon alpha, add 1 ~ 2mL stroke-physiological saline solution and be dissolved into bacteria suspension, be inoculated in LB solid medium dull and stereotyped, cultivate 24 ~ 36 hours for 37 DEG C, the single bacterium colony of picking, be inoculated in LB culture medium slant, cultivate 24 ~ 36 hours for 37 DEG C, wash lower lawn with 5 ~ 10mLLB liquid nutrient medium and obtain bacterium liquid, add the sterile glycerol that 30% ~ 40% bacteria liquid is long-pending, when can avoid frozen bacterial classification, water freezing produces ice crystal damaging cells, quantitative separating becomes 1mL/ bottle, obtain one-level BL21/pET-32 α-rChIFN α engineering bacteria seeding.
Step (1-2) specifically comprises the following steps: one-level BL21/pET-32 α-rChIFN α engineering bacteria seeding is inoculated in LB solid medium dull and stereotyped, cultivate 24 ~ 36 hours for 37 DEG C, wash lower lawn with LB liquid nutrient medium and obtain bacterium liquid, bacterium liquid is inoculated in LB liquid nutrient medium, the volume ratio of bacterium liquid and LB liquid nutrient medium is 1:10 ~ 15, it is 0.8 ~ 1.2 that 37 DEG C of shaking table concussions are cultured to OD value, obtained secondary seed bacterium liquid.
Step (1-3) specifically comprises the following steps: by LB liquid nutrient medium through the sterilizing in place of 103.43Kpa pressure, by 10% ~ 20% inoculation secondary seed bacterium liquid of culture volume amount, 37 DEG C of fermentations, adding acid or alkali, to control pH value be 7.0 ~ 7.2, control dissolved oxygen >30%, treat the OD of bacterium liquid
600nmvalue adds the isopropyl-beta D-thio galactopyranoside (IPTG) that final concentration is 1mmol/L when reaching 0.6 ~ 1.0,30 ~ 32 DEG C of abduction deliverings, and induce 4 ~ 6 hours, centrifugal at 2 ~ 8 DEG C of temperature, wet thallus is weighed, and-20 DEG C frozen.
Step (1-4) specifically comprises the following steps: with 10mmol/L phosphoric acid buffer (PBS) the resuspended wet thallus that 10 ~ 15% bacteria liquids are long-pending, broken with the high-pressure cell crusher of 800 ~ 1500bar pressure, centrifugal, gained supernatant liquor repeated centrifugation once, again collect supernatant liquor, obtain rough restructuring fowl interferon alpha.
Step (1-5) described purifying is affinitive layer purification and cation exchange chromatography, and it is higher that the purification schemes coupling of these two kinds of different principle prepares purity of protein, fowl interferon alpha stoste of must recombinating after purifying.
Step (2) specifically comprises following steps: fowl interferon alpha stoste of recombinating 2 ~ 3 times of volume 10mmol/L phosphate buffered saline buffers dilute; mix to lyophilized vaccine; be distributed into the restructuring fowl interferon alpha work in-process that specification is 2.2mL/ bottle; as thinner, there is salt balance, adjustable suitable PH shock absorption with PBS herein, the structure and biological activity material of bioprotein can be protected to keep its most complete characteristic.
Further; described lyophilized vaccine is final concentration is 80 ~ 150mL/L skimmed milk, 0.12 ~ 0.25g/mL N.F,USP MANNITOL and 0.025 ~ 0.085g/mL sucrose; skimmed milk can promote distillation in the process of freeze-drying, easily obtains homogenous product, and expands the mutual distance of cell.
Step (3) specifically comprises following steps: will recombinate fowl interferon alpha work in-process through vacuum freezedrying technique under the condition of-40 ~-30 DEG C, obtained restructuring fowl interferon alpha finished product freeze-dried preparation.
Above-mentioned vacuum freezedrying technique is: by shelf greenhouse cooling to-10 ~-15 DEG C, keep 30min ~ 60min, continue to be cooled to-20 DEG C and keep 30min ~ 60min, 1.5h is kept afterwards at-35 DEG C, vacuumize and carry out primary drying, keep 2 ~ 3.5h to obtain white dried thing, open dividing plate and be heated to 30 ~ 35 DEG C, maintain 4h.
The expression amount of the restructuring fowl interferon alpha stoste target protein prepared as stated above is not less than 30%, tires and is greater than 1.0 × 10
9unit/mL, adopts SDS-PAGE and HPLC to detect lipidated protein simultaneously after purifying, purity of protein all detects protein content higher than more than 95%, Lowry method and is greater than 1mg/mL, and specific activity reaches 1.2 × 10
9unit/mg, molecular weight is 35kD.
Restructuring fowl interferon alpha prepared by the present invention is freeze-dried type, in white or faint yellow loosening body, redissolves rapidly for clear liquid after adding water for injection, Interferon, rabbit content>=1 × 10
9unit/bottle, can preserve for 2 ~ 8 DEG C for a long time, can preserve 2 years under lower than 25 DEG C of room temperatures.
The present invention compared with prior art, the restructuring fowl interferon alpha set up, it is the target protein of expressing in the supernatant liquor after large intestine dust wishes engineering bacteria bacterial cell disruption, eliminate the denature and renature process required for inclusion bodies expressing protein, detailed technical parameter and corresponding quality control system are established to each preparation walked and production process simultaneously, produce for the industrialization of restructuring fowl interferon alpha and lay a good foundation.
The made restructuring fowl interferon alpha finished product freeze-dried preparation of the present invention is that a class can induce avian cells to produce the cytokine of multiple broad-spectrum disease resistance toxalbumin, the mode administration of intramuscular injection can be adopted, treatment cycle is short, curative effect is rapid, can be used in the control of newcastle disease virus and avian influenza toxicity disease.
Advantage of the present invention is: the restructuring fowl interferon alpha freeze-dried preparation product using preparation method provided by the invention to obtain; be no matter at purity, protein content, tire and in intracellular toxin etc., all can reach the requirement of veterinary biologics, and production technique is applicable to large-scale production.
Accompanying drawing explanation
Fig. 1 is the restructuring fowl interferon alpha protein SDS-PAGE figure of the centrifugal rear expression of the broken thalline of fermentation; M: albumen Marker; 1: supernatant after fermentation is broken; 2: inclusion body after fermentation is broken; 3: full bacterium after fermentation is broken;
Fig. 2 is restructuring fowl interferon alpha stoste purifying chromatography color atlas; A is restructuring fowl interferon alpha affinitive layer purification color atlas; B is restructuring fowl interferon alpha cation exchange chromatography color atlas;
Fig. 3 is SDS-PAGE figure before and after restructuring fowl interferon alpha stoste purifying; M: albumen Marker; 4: restructuring fowl interferon alpha stoste; 5: sample after restructuring fowl interferon alpha stoste affinitive layer purification; 6: restructuring fowl interferon alpha stoste ion exchange chromatography wash-out sample (foreign protein); 7: target protein sample after restructuring fowl interferon alpha stoste cation exchange chromatography;
Fig. 4 is restructuring fowl interferon alpha stoste HPLC detection purity color atlas;
Fig. 5 is restructuring fowl interferon alpha finished product freeze-dried preparation immune-blotting method result figure; M: albumen Marker; 8: restructuring fowl interferon alpha finished product freeze-dried preparation.
Embodiment
Below in conjunction with case study on implementation, the present invention is described in detail, but this is not limited in scope of the present invention.
The freeze-drying lactobacillus (Ministry of Agriculture's Transgene-safty certificate: Nong Jian demonstrate,proves No. 034th, word 2014) of the BL21/pET-32 α-rChIFN α engineering bacteria of restructuring fowl interferon alpha derives from Anhui Jiuchuan Biotechnology Co., Ltd.'s self-control.
The compound method of LB liquid nutrient medium is: tryptone 100g, yeast extract 50g, sodium-chlor 100g, after dissolving, adds 5MNaOH and regulates pH value to 7.0, then add pure water to cumulative volume 10L with 8L pure water.
Embodiment 1
Recombinate the preparation technology of fowl interferon alpha finished product freeze-dried preparation, comprises the following steps:
1.1 stoste manufacture and detections
1.1.1 one-level seeding breeds
Open the freeze-drying lactobacillus 1 of the BL21/pET-32 α-rChIFN α engineering bacteria of expressing restructuring fowl interferon alpha, add 1mL stroke-physiological saline solution and be dissolved into bacteria suspension, streak inoculation is dull and stereotyped in LB solid medium, cultivate 24 hours for 37 DEG C, the single bacterium colony of picking, be inoculated in LB culture medium slant, cultivate 24 hours for 37 DEG C, wash lower lawn with 5mLLB liquid nutrient medium and obtain bacterium liquid, add the sterile glycerol that 30% bacteria liquid is long-pending, quantitative separating becomes 1mL/ bottle, obtained one-level BL21/pET-32 α-rChIFN α engineering bacteria seeding.
1.1.2 secondary seeding breeds
Take out one-level BL21/pET-32 α-rChIFN α engineering bacteria seeding 1, after putting room temperature 30min, streak inoculation LB solid medium is dull and stereotyped, cultivate 24 hours, wash lower lawn with 5mLLB substratum and obtain bacterium liquid, bacterium liquid is inoculated in LB liquid nutrient medium for 37 DEG C, bacterium liquid and LB liquid nutrient medium volume ratio are 1: 10, at 37 DEG C of temperature, the concussion of 300r/min shaking table is cultured to OD value 0.8, obtains secondary seed bacterium liquid, inoculates for fermentor tank.
1.1.3 fermentation
Preparation LB liquid nutrient medium, at 103.43Kpa sterilized under pressure, now tank body should sterilizing in place.By 10% inoculation secondary seed bacterium liquid of culture volume amount, 37 DEG C of condition bottom fermentations, add acid or alkali control pH value is 7.0, control dissolved oxygen >30% by stirring velocity and air flow.Sampling per hour detects thalline OD
600nmvalue, treats the OD of bacterium liquid
600nmvalue adds final concentration when reaching 0.6 be 1mmol/LIPTG, and adjustment culture temperature to 32 DEG C, starts abduction delivering.Induce after 5 hours, with the centrifugal 15min of 4000r/min under 4 DEG C of conditions, wet thallus is weighed, and-20 DEG C are frozen, and indicate on container simultaneously lot number, tank not, weight and date.Discard after fermented liquid sterilizing, the thalline that takes a morsel makes SDS-PAGE electrophoresis, and with the molecular weight consistent with theoretical value (35kD) of software analysis target protein after running gel scanning, the expression level of target protein is not less than 30% (Fig. 1).
1.1.4 broken
With the resuspended thalline of 10mmol/LPBS that 10% bacteria liquid is long-pending, with the high-pressure cell crusher disrupt bacteria of pressure 1000bar, after continuous crushing twice, under again this suspension being put 4 DEG C of conditions, with the centrifugal 10min of 12000r/min, get supernatant liquor, supernatant liquor repeated centrifugation once, collects supernatant liquor.
1.1.5 purifying
Adopt GEHealthcare company ChelatingSePHarose
tMfastFlow nickel ion chelating affinity chromatography filler, from luggage post, cleans Ni with the pure water of 3 column volumes
2+chelating affinity column, use BindingBuffer (10mmol/LPBS again, 25mmol/L imidazoles, PH=8.0) balance 2 ~ 3 column volumes, on-line checkingi conductivity value and 280nm wavelength absorption value, loading is started after both stablizing, adopted by rough restructuring fowl interferon alpha loading pump loading to cross affinity column, flow rate set is 5 ~ 6mL/min, then crosses chromatography column with BindingBuffer, wash away the foreign protein be not combined with chromatography column, until A280 stablizes.Use ElutionBuffer (10mmol/LPBS, 300mmol/L imidazoles, PH=8.0) wash-out again, collect elutriant, this is walked the restructuring fowl interferon alpha obtained and crosses desalting column, with damping fluid (25mMTris-HClPH=8.0) displacement, prepare next step ion exchange chromatography.Use Bindingbuffer (25mMTris-HClPH=8.0) counterion displacement chromatography post, with Elutionbuffer (25mMTris-HCl1MNaClPH=8.0) gradient elution after loading, collect the elutriant at Interferon, rabbit peak place, be restructuring fowl interferon alpha stoste (Fig. 2) after purifying.
1.1.6 stoste detects
Titration: adopt " few cells pathology suppresses method ", chick embryo fibroblast/VSV detection system, adopt chick embryo fibroblast/VSV virus system, tiring is 1.6 × 10
9unit/mL.
Protein content detects: it is 1.3mg/mL that Lowry method detects protein content.
Specific activity detects: specific activity is biologic activity and the ratio of protein content, and calculating specific activity is 1.2 × 10
9unit/mg.
Purity testing: purity takes SDS-PAGE and HPLC synchronous detection, detected result is all greater than 95% (Fig. 3, Fig. 4).
Molecular weight detection: resolving gel concentration is 15%, application of sample amount is not less than 10 μ g, compares with known molecular amount standard substance simultaneously, and the molecular weight of goods is 35kD.
1.2 work in-process preparations and detection
1.2.1 work in-process preparation
After adding the mixing of final concentration 10% skimmed milk, 0.12g/mL N.F,USP MANNITOL and 0.025g/mL sucrose lyophilized vaccine after the restructuring fowl interferon alpha stoste of upper step gained being diluted with 2 ~ 3 times of volume 10mmol/LPBS; with the packing of 7mL cillin bottle; packing specification is 2.2mL/ bottle, and work in-process are through Bacterial endotoxin test, sterility test.
1.2.2 work in-process calibrating
Bacterial endotoxin test:
Test with reference to " People's Republic of China's veterinary drug allusion quotation " 2010 editions one annex " detection of bacterial endotoxin method ", in restructuring fowl interferon alpha, endotoxin content is 14EU/mL.
Sterility test:
Carry out with reference to " People's Republic of China's veterinary drug allusion quotation " 2010 editions annex " Sterility testing or pure detection method ", aseptic experiment conforms with the regulations.
1.3 finished product preparations and detection
1.3.1 finished product preparation
After the work in-process packing that above-mentioned 1.2.1 is obtained under the condition of-40 ~-30 DEG C vacuum freezedrying: first by shelf greenhouse cooling to-10 DEG C, keep 60min, continue to be cooled to-20 DEG C and keep 60min, 1.5h is kept afterwards at-35 DEG C, vacuumize and carry out primary drying, keep 2h to obtain white dried thing, open dividing plate and be heated to 30 DEG C, maintain 4h, sealing of being jumped a queue by ampoule.
Pack the regulation according to the label of veterinary biologics, specification sheets and packaging.
1.3.2 finished product calibrating
Proterties:
Finished product is white or faint yellow loosening body, redissolves rapidly for clear liquid after adding water for injection.
Steriling test:
Aseptic experiment carries out, asepsis growth with reference to " People's Republic of China's veterinary drug allusion quotation " 2010 editions annex " Sterility testing or pure detection method ".
Diagnostic test:
Recombinate fowl interferon alpha monoclonal antibody through western blot determination with commercialization, and result is positive (Fig. 5).
Safety verification:
Restructuring fowl interferon alpha is dissolved in 4mL physiological saline, and with SPF chicken 10 in 2 ~ 3 weeks age, each intramuscular injection restructuring fowl interferon alpha 0.4mL, observes 10, is all good for alive, does not occur abnormal response.
Titration:
Carry out according to cytopathic-effect inhibition assay, adopt chick embryo fibroblast/VSV virus system, bioactivity result is 1.4 × 10
9unit/.
Bacterial endotoxin test:
Intracellular toxin detects tests with reference to " People's Republic of China's veterinary drug allusion quotation " 2010 editions one annex " detection of bacterial endotoxin method ", and in every bottle of restructuring fowl interferon alpha, endotoxin content is 6EU.
Residue moisture determination:
Moisture determination is with reference to " People's Republic of China's veterinary drug allusion quotation " 2010 editions three annex " residual moisture assay method ", and water content is 2.3%.
Vacuum tightness measures:
Vacuum degree measurement is with reference to " People's Republic of China's veterinary drug allusion quotation " 2010 editions three annex " vacuum tightness assay method ", and vacuum tightness meets beast States Pharmacopoeia specifications.
Embodiment 2
Recombinate the preparation technology of fowl interferon alpha finished product freeze-dried preparation, comprises the following steps:
2.1 stoste manufacture and detections
2.1.1 one-level seeding breeds
Open the freeze-drying lactobacillus 1 of the BL21/pET-32 α-rChIFN α engineering bacteria of expressing restructuring fowl interferon alpha, add 2mL stroke-physiological saline solution and be dissolved into bacteria suspension, streak inoculation is dull and stereotyped in LB solid medium, cultivate 30 hours for 37 DEG C, the single bacterium colony of picking, is inoculated in LB culture medium slant, cultivate 30 hours for 37 DEG C, wash lower lawn with 8mLLB liquid nutrient medium and obtain bacterium liquid, add the sterile glycerol that 35% bacteria liquid is long-pending, quantitative separating becomes 1mL/ bottle.
2.1.2 secondary seeding breeds
Take out one-level BL21/pET-32 α-rChIFN α engineering bacteria seeding 1, after putting room temperature 35min, streak inoculation is dull and stereotyped in LB solid medium, cultivate 30 hours, wash lower lawn with 8mLLB liquid nutrient medium and obtain bacterium liquid, bacterium liquid is inoculated in LB liquid nutrient medium for 37 DEG C, bacterium liquid and LB liquid nutrient medium volume ratio are 1: 12, at 37 DEG C of temperature, the concussion of 300r/min shaking table is cultured to OD value 1.0, obtains secondary seed bacterium liquid, can inoculate for fermentor tank.
2.1.3 fermentation
Preparation LB liquid nutrient medium, at 103.43Kpa sterilized under pressure, now tank body should sterilizing in place.By 15% inoculation secondary seed bacterium liquid of culture volume amount, 37 DEG C of condition bottom fermentations, add acid or alkali control pH value is 7.1, control dissolved oxygen >30% by stirring velocity and air flow.Sampling per hour detects thalline OD
600nmvalue, treats the OD of bacterium liquid
600nmvalue adds final concentration when reaching 0.8 be 1mmol/LIPTG, and adjustment culture temperature to 32 DEG C, starts abduction delivering.Induce after 4 hours, with the centrifugal 20min of 6000r/min under 2 DEG C of conditions, wet thallus is weighed, and-20 DEG C frozen.
2.1.4 broken
With the resuspended thalline of 10mmol/LPBS that 12% bacteria liquid is long-pending, with the high-pressure cell crusher disrupt bacteria of pressure 1500bar, after continuous crushing twice, under again this suspension being put 2 DEG C of conditions, with the centrifugal 20min of 8000r/min, get supernatant liquor, supernatant liquor repeated centrifugation once, collects supernatant liquor.
2.1.5 purifying and detection
Adopt the method purifying identical with step 1.1.5 in embodiment 1, and titration, protein content detection, specific activity detection, purity testing and molecular weight detection are carried out to stoste.
2.2 work in-process preparations and detection
After adding the mixing of final concentration 80mL/L skimmed milk, 0.20g/mL N.F,USP MANNITOL and 0.05g/mL sucrose lyophilized vaccine after being diluted by the 10mmol/LPBS of restructuring fowl interferon alpha stoste 2 ~ 3 times of volumes of upper step gained; with the packing of 7mL cillin bottle; packing specification is 2.2mL/ bottle, and work in-process are through Bacterial endotoxin test, sterility test.
2.3 finished product preparations and detection
After the work in-process packing that above-mentioned 1.2.1 is obtained under the condition of-40 ~-30 DEG C vacuum freezedrying: first by shelf greenhouse cooling to-12 DEG C, keep 45min, continue to be cooled to-20 DEG C and keep 45min, 1.5h is kept afterwards at-35 DEG C, vacuumize and carry out primary drying, keep 3h to obtain white dried thing, open dividing plate and be heated to 33 DEG C, maintain 4h, sealing of being jumped a queue by ampoule.Obtained finished product carries out proterties, steriling test, diagnostic test, safety verification, titration, Bacterial endotoxin test, residue moisture determination and vacuum tightness and measures.
Embodiment 3
Recombinate the preparation technology of fowl interferon alpha finished product freeze-dried preparation, comprises the following steps:
3.1 stoste manufacture and detections
3.1.1 one-level seeding breeds
Open the freeze-drying lactobacillus 1 of the BL21/pET-32 α-rChIFN α engineering bacteria of expressing restructuring fowl interferon alpha, add 1.5mL stroke-physiological saline solution and be dissolved into bacteria suspension, streak inoculation is dull and stereotyped in LB solid medium, cultivate 36 hours for 37 DEG C, the single bacterium colony of picking, is inoculated in LB culture medium slant, cultivate 36 hours for 37 DEG C, wash lower lawn with 10mLLB liquid nutrient medium and obtain bacterium liquid, add the sterile glycerol that 40% bacteria liquid is long-pending, quantitative separating becomes 1mL/ bottle.
3.1.2 secondary seeding breeds
Take out one-level BL21/pET-32 α-rChIFN α engineering bacteria seeding 1, after putting room temperature 35min, streak inoculation is dull and stereotyped in LB solid medium, cultivate 36 hours, wash lower lawn with 10mLLB liquid nutrient medium and obtain bacterium liquid, bacterium liquid is inoculated in LB liquid nutrient medium for 37 DEG C, bacterium liquid and LB liquid nutrient medium volume ratio are 1: 15,, at 37 DEG C of temperature, the concussion of 300r/min shaking table is cultured to OD value 1.2, can inoculate for fermentor tank.
3.1.3 fermentation
Preparation LB liquid nutrient medium, at 103.43Kpa sterilized under pressure, now tank body should sterilizing in place.By 20% inoculation secondary seed bacterium liquid of culture volume amount, 37 DEG C of condition bottom fermentations, add acid or alkali control pH value is 7.2, control dissolved oxygen >30% by stirring velocity and air flow.Sampling per hour detects thalline OD
600nmvalue.Treat the OD of bacterium liquid
600nmvalue adds final concentration when reaching 1.0 be 1mmol/LIPTG, and adjustment culture temperature to 32 DEG C, starts abduction delivering.Induce after 6 hours, with the centrifugal 30min of 8000r/min under 2 DEG C of conditions, wet thallus is weighed, and-20 DEG C frozen.
3.1.4 broken
With the resuspended thalline of 10mmol/LPBS that 15% bacteria liquid is long-pending, with the high-pressure cell crusher disrupt bacteria of pressure 800bar, after continuous crushing twice, under again this suspension being put 2 DEG C of conditions, with the centrifugal 15min of 10000r/min, get supernatant liquor, supernatant liquor repeated centrifugation once, collects supernatant liquor.
3.1.5 purifying and detection
Adopt the method purifying identical with step 1.1.5 in embodiment 1, and titration, protein content detection, specific activity detection, purity testing and molecular weight detection are carried out to stoste.
3.2 work in-process preparations and detection
After adding the mixing of final concentration 150mL/L skimmed milk, 0.25g/mL N.F,USP MANNITOL and 0.085g/mL sucrose lyophilized vaccine after the restructuring fowl interferon alpha stoste of upper step gained being diluted with 2 ~ 3 times of volume 10mmol/LPBS; with the packing of 7mL cillin bottle; packing specification is 2.2mL/ bottle, and work in-process are through Bacterial endotoxin test, sterility test.
3.3 finished product preparations and detection
After the work in-process packing obtained by above-mentioned 1.2.1, vacuum freezedrying under the condition of-40 ~-30 DEG C: first by shelf greenhouse cooling to-15 DEG C, keep 30min, continue to be cooled to-20 DEG C and keep 30min, keep 1.5h at-35 DEG C afterwards, vacuumize and carry out primary drying, 3.5h is kept to obtain white dried thing, open dividing plate and be heated to 35 DEG C, maintain 4h, sealing of being jumped a queue by ampoule.Obtained finished product carries out proterties, steriling test, diagnostic test, safety verification, titration, Bacterial endotoxin test, residue moisture determination and vacuum tightness and measures.
Embodiment 4
Restructuring fowl interferon alpha finished product freeze-dried preparation is to the therapeutic action of newcastle disease
Doubtful newcastle disease is broken out in 2012 in poulty house, Suburbs of Hefei, their early stage chicken fervescence, can down in spirits, feather pine disorderly, in lethargic sleep shape.Hat is in garnet, and expiratory dyspnea, ight soil is thin.Chick 2 ~ 3 days after being ill chickens start death, and mortality ratio increases subsequently.Adult Chicken morbidity after egg productivity sharply decline, but mortality ratio comparatively chick is low.400 plumage morbidity chick are divided into two groups at random, and A group is " restructuring fowl interferon alpha finished product freeze-dried preparation " treatment group, and group fowl interferon alpha finished product freeze-dried preparation adopts the preparation of embodiment 1 method; B group is control group, and with saline therapy, A group gives " restructuring fowl interferon alpha finished product freeze-dried preparation " 100,000 units/plumage with muscle injection mode, every day 1 time, is used in conjunction 3 days; B group gives physiological saline 0.5mL/ plumage, every day 1 time, is used in conjunction 3 days, after medication, A group chicken after 1 day the state of an illness start take a turn for the better, have no chicken death after 3 days.Symptom appears in B group chicken, and after the 2nd day, sb.'s illness took a turn for the worse, starts to occur death, and within the 3rd day, reach peak mortality, mortality ratio reaches 90%, illustrates that giving " restructuring fowl interferon alpha finished product freeze-dried preparation " with muscle injection mode has good therapeutic action to newcastle disease.
Embodiment 5
Restructuring fowl interferon alpha finished product freeze-dried preparation protest test
By the method for artificial challenge H9N2 subtype avian influenza virus, chick is fallen ill the SPF chicken of 400 plumage 20 ages in days.Collunarium eye droppings attacks malicious SPF chicken, after virus inoculation 24h, and intramuscular injection restructuring fowl interferon alpha finished product freeze-dried preparation 100,000 units/plumage, once a day, injection 3 days continuously.After attacking poison, within the 3rd day, 5 days, 7 days, take larynx and cloaca cotton to wipe, isolated viral, calculate separation rate.Restructuring fowl interferon alpha protection ratio=(attacking malicious control group toxin expelling rate-treatment group toxin expelling rate)/attack malicious control group toxin expelling rate × 100%.Attack poison latter 5th day, restructuring fowl interferon alpha treatment group larynx tracheae toxin expelling rate is significantly lower than non-treatment group, and protection ratio is 71.4%, evident in efficacy.
Above-mentioned detailed description of carrying out with reference to the preparation method of embodiment to the stoste of this restructuring fowl interferon alpha, work in-process, freeze-drying finished product; illustrative instead of determinate; several embodiments can be listed according to institute's limited range; therefore in the change do not departed under general plotting of the present invention and amendment, should belong within protection scope of the present invention.
SEQUENCELISTING
<110> Anhui Jiuchuan Biotechnology Co., Ltd.
<120> mono-kind recombinates the preparation technology of fowl interferon alpha finished product freeze-dried preparation
<130>1
<160>1
<170>PatentInversion3.3
<210>1
<211>531
<212>DNA
<213>BL21/pET-32α-rChIFNα
<400>1
gcctgcaaccaccttcgcccccaggatgccaccttctctcacgacagcctccagctcctc60
cgggacatggctcccacactaccccagctgtgcccacagcacaacgcgtcttgctccttc120
aacgacaccatcctggacaccagcaacacccggcaagccgacaaaaccacccacgacatc180
cttcagcacctcttcacaatcctcagcagccccagcactccagcccactggaacgacagc240
caacgccaaagcctcctcaaccggatccaccgctacacccagcacctcgagcaatgcttg300
gacagcagcgacacgcgctcccggacgcgatggcctcgcaaccttcacctcaccatcaaa360
aaacacttcagctgcctccacaccttcctccaagacaacgattacagcgcctgcgcctgg420
gaacacgtccgcctgcaagctcgtgcctggttcctgcacatccacaacctcacaggcaac480
acgcgcactaagcttgcggccgcactcgagcaccaccaccaccaccactga531
Claims (10)
1. the preparation technology of fowl interferon alpha finished product freeze-dried preparation that recombinates, it is characterized in that: with the freeze-drying lactobacillus of the BL21/pET-32 α-rChIFN α engineering bacteria of fowl interferon alpha of recombinating for raw material, the DNA sequence dna of BL21/pET-32 α-rChIFN α engineering bacteria, as shown in SEQUENCELISTING400 < 1 >, obtains through following steps:
(1) stoste preparation;
(1-1) one-level seeding breeding;
(1-2) secondary seeding breeding;
(1-3) ferment;
(1-4) supernatant liquor is collected after fragmentation;
(1-5) supernatant liquor purifying;
(1-6) stoste detects;
(2) work in-process preparation;
(3) finished product preparation.
2. the preparation technology of restructuring fowl interferon alpha finished product freeze-dried preparation according to claim 1, it is characterized in that, specifically comprise the following steps in step (1-1): will the freeze-drying lactobacillus of the BL21/pET-32 α-rChIFN α engineering bacteria of restructuring fowl interferon alpha be expressed, bacteria suspension is become with physiological saline solution, be inoculated in LB solid medium dull and stereotyped, cultivate 24 ~ 36 hours for 37 DEG C, the single bacterium colony of picking, be inoculated in LB culture medium slant, cultivate 24 ~ 36 hours for 37 DEG C, wash lower lawn with 5 ~ 10mlLB liquid nutrient medium and obtain bacterium liquid, add the sterile glycerol that 30% ~ 40% bacteria liquid is long-pending, quantitative separating becomes 1ml/ bottle, obtain one-level BL21/pET-32 α-rChIFN α engineering bacteria seeding.
3. the preparation technology of restructuring fowl interferon alpha finished product freeze-dried preparation according to claim 1 and 2, it is characterized in that, specifically comprise the following steps in step (1-2): one-level BL21/pET-32 α-rChIFN α engineering bacteria seeding is inoculated in LB solid medium dull and stereotyped, cultivate 24 ~ 36 hours for 37 DEG C, wash lower lawn with 5 ~ 10mlLB liquid nutrient medium and obtain bacterium liquid, bacterium liquid is inoculated in LB liquid nutrient medium, bacterium liquid and LB liquid nutrient medium volume ratio are 1: 10 ~ 15, it is 0.8 ~ 1.2 that 37 DEG C of shaking table concussions are cultured to OD value, obtained secondary seed bacterium liquid.
4. the preparation technology of the restructuring fowl interferon alpha finished product freeze-dried preparation according to any one of claim 1-3, it is characterized in that: specifically comprise the following steps in step (1-3): by LB liquid nutrient medium through the sterilizing in place of 103.43Kpa pressure, by 10% ~ 20% inoculation secondary seed bacterium liquid of culture volume amount, 37 DEG C of fermentations, adding acid or alkali, to control pH value be 7.0 ~ 7.2, control dissolved oxygen >30%, treat the OD of bacterium liquid
600nmvalue adds isopropyl-beta D-thio galactopyranoside when reaching 0.6 ~ 1.0, and its final concentration is 1mmol/L, 30 ~ 32 DEG C of abduction deliverings, and induce 4 ~ 6 hours, centrifugal at 2 ~ 8 DEG C, wet thallus is weighed, and-20 DEG C frozen.
5. the preparation technology of the restructuring fowl interferon alpha finished product freeze-dried preparation according to any one of claim 1-4, it is characterized in that, specifically comprise the following steps in step (1-4): with the resuspended wet thallus of 10mmol/L phosphoric acid buffer that 10 ~ 15% bacteria liquids are long-pending, broken with the high-pressure cell crusher of 800 ~ 1500bar pressure, centrifugal, gained supernatant liquor repeated centrifugation once, collects supernatant liquor again, obtains rough restructuring fowl Interferon, rabbit.
6. the preparation technology of the restructuring fowl interferon alpha finished product freeze-dried preparation according to any one of claim 1-5, it is characterized in that, step (1-5) described purifying is affinitive layer purification and cation exchange chromatography, fowl interferon alpha stoste of must recombinating after purifying.
7. the preparation technology of the restructuring fowl interferon alpha finished product freeze-dried preparation according to any one of claim 1-6; it is characterized in that; step specifically comprises following steps in (2): fowl interferon alpha stoste of recombinating 2 ~ 3 times of volume 10mmol/L phosphate buffered saline buffers dilute; add lyophilized vaccine mixing wherein, be distributed into the restructuring fowl interferon alpha work in-process that specification is 2.2ml/ bottle.
8. the preparation technology of restructuring fowl interferon alpha finished product freeze-dried preparation according to claim 7, it is characterized in that, described lyophilized vaccine is final concentration is 80 ~ 150mL/L skimmed milk, 0.12 ~ 0.25g/mL N.F,USP MANNITOL and 0.025 ~ 0.085g/mL sucrose.
9. the preparation technology of the restructuring fowl interferon alpha finished product freeze-dried preparation according to any one of claim 1-8, it is characterized in that, described step specifically comprises following steps in (3): will recombinate fowl interferon alpha work in-process through vacuum freezedrying technique under the condition of-40 ~-30 DEG C, obtained restructuring fowl interferon alpha finished product freeze-dried preparation.
10. the preparation technology of restructuring fowl interferon alpha finished product freeze-dried preparation according to claim 9, it is characterized in that, described vacuum freezedrying technique is: by shelf greenhouse cooling to-10 ~-15 DEG C, keep 30min ~ 60min, continue to be cooled to-20 DEG C and keep 30min ~ 60min, keep 1.5h at-35 DEG C afterwards, vacuumize and carry out primary drying, keep 2 ~ 3.5h to obtain white dried thing, open dividing plate and be heated to 30 ~ 35 DEG C, maintain 4h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510532757.XA CN105132497A (en) | 2015-08-25 | 2015-08-25 | Preparation process of recombinant poultry interferon alpha product lyophilized preparation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510532757.XA CN105132497A (en) | 2015-08-25 | 2015-08-25 | Preparation process of recombinant poultry interferon alpha product lyophilized preparation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105132497A true CN105132497A (en) | 2015-12-09 |
Family
ID=54718064
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510532757.XA Pending CN105132497A (en) | 2015-08-25 | 2015-08-25 | Preparation process of recombinant poultry interferon alpha product lyophilized preparation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105132497A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106362140A (en) * | 2016-08-25 | 2017-02-01 | 芜湖英特菲尔生物制品产业研究院有限公司 | Preparation method for recombinant pig IL-2 finish product freeze-dried preparation |
| CN106676151A (en) * | 2016-08-25 | 2017-05-17 | 芜湖英特菲尔生物制品产业研究院有限公司 | Preparation method of recombinant porcine interferon gamma-finished product lyophilized preparation |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1861634A (en) * | 2006-04-06 | 2006-11-15 | 北京江中泽生科技有限责任公司 | Dog interferon alpha, preparation process and use thereof |
| CN103290021A (en) * | 2013-03-19 | 2013-09-11 | 安徽九川生物科技有限公司 | A preparation method for recombinant chicken interferon alpha |
| CN103585633A (en) * | 2013-10-29 | 2014-02-19 | 王明丽 | Freeze-drying protective agent for recombinant porcine interferon alpha 1 and preparation method thereof |
| CN104447978A (en) * | 2014-12-10 | 2015-03-25 | 天津生机集团股份有限公司 | Recombinant chicken interferon alpha and preparation method thereof |
-
2015
- 2015-08-25 CN CN201510532757.XA patent/CN105132497A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1861634A (en) * | 2006-04-06 | 2006-11-15 | 北京江中泽生科技有限责任公司 | Dog interferon alpha, preparation process and use thereof |
| CN103290021A (en) * | 2013-03-19 | 2013-09-11 | 安徽九川生物科技有限公司 | A preparation method for recombinant chicken interferon alpha |
| CN103585633A (en) * | 2013-10-29 | 2014-02-19 | 王明丽 | Freeze-drying protective agent for recombinant porcine interferon alpha 1 and preparation method thereof |
| CN104447978A (en) * | 2014-12-10 | 2015-03-25 | 天津生机集团股份有限公司 | Recombinant chicken interferon alpha and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 黄丽金等: "酸奶菌种冷冻干燥保护剂的筛选研究", 《食品科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106362140A (en) * | 2016-08-25 | 2017-02-01 | 芜湖英特菲尔生物制品产业研究院有限公司 | Preparation method for recombinant pig IL-2 finish product freeze-dried preparation |
| CN106676151A (en) * | 2016-08-25 | 2017-05-17 | 芜湖英特菲尔生物制品产业研究院有限公司 | Preparation method of recombinant porcine interferon gamma-finished product lyophilized preparation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104498441A (en) | Duck hepatitis A virus III type attenuated strain, live vaccine prepared from same and application of live vaccine | |
| CN111000993B (en) | Bivalent inactivated vaccine for duck viral hepatitis and duck reovirus disease and preparation method thereof | |
| CN104946600B (en) | A kind of H9 subtype avian influenza virus strain | |
| CN103497934B (en) | Avian infectious bronchitis virus vaccine strain (HF2 strain) and application thereof | |
| CN104689310A (en) | Aeromonas hydrophila and aeromonas veronii duplex oral sustained-release microsphere vaccine and preparation method thereof | |
| CN101869702A (en) | Vaccine produced by suspended microcarrier cell culture system and method for producing vaccine | |
| CN113491767A (en) | Triple inactivated vaccine for duck circovirus disease, novel duck reovirus disease and duck viral hepatitis and preparation method thereof | |
| CN106344917A (en) | Swine fever mucosal immunity live vaccine composition and preparation method of vaccine | |
| CN105582533B (en) | Avian influenza virus and avian adenovirus bivalent inactivated vaccine | |
| CN104726414A (en) | Serum type 3 duck hepatitis A virus live vaccine and preparation method thereof | |
| CN105274064B (en) | A kind of duck tembusu virus attenuated vaccine strain and its application | |
| CN105039474A (en) | Preparation method of recombinant chicken interferon-alpha standard substance | |
| CN105132497A (en) | Preparation process of recombinant poultry interferon alpha product lyophilized preparation | |
| CN104087559B (en) | A kind of infectious bursa of Fabricius virus, inactivated vaccine and preparation method thereof | |
| CN113384692A (en) | Duck reovirus and duck circovirus bivalent inactivated vaccine and preparation method thereof | |
| CN109207436A (en) | One plant of 4 type aviadenovirus strain of I group and its application | |
| CN109055320B (en) | Infectious bronchitis virus isolate and application thereof in vaccine preparation | |
| CN102936285A (en) | Antibody for preventing and treating fish Edwardsiellaictaluri disease, preparation method and applications thereof | |
| CN104195114A (en) | Avian pneumovirus and application thereof | |
| CN115068600A (en) | Application of antiviral protein immunopotentiator in H9N2 avian influenza inactivated vaccine | |
| CN106676151A (en) | Preparation method of recombinant porcine interferon gamma-finished product lyophilized preparation | |
| CN109797139A (en) | 3 type duck hepatitis A virus low virulent strain CH-P60 of one kind and its application | |
| CN105727275B (en) | A kind of duck hepatitis bivalent vaccine and preparation method thereof | |
| CN105031636B (en) | A kind of Aeromonas hydrophila and Aeromonas veronii bivalent inactivated vaccine and preparation method | |
| CN103497933B (en) | One application of strain H9N2 type bird flu strain on vaccine development |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Cha Yingli Inventor before: Wang Mingli Inventor before: Zhao Jun Inventor before: Cha Yingli |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151209 |