CN105039474A - Preparation method of recombinant chicken interferon-alpha standard substance - Google Patents
Preparation method of recombinant chicken interferon-alpha standard substance Download PDFInfo
- Publication number
- CN105039474A CN105039474A CN201510532805.5A CN201510532805A CN105039474A CN 105039474 A CN105039474 A CN 105039474A CN 201510532805 A CN201510532805 A CN 201510532805A CN 105039474 A CN105039474 A CN 105039474A
- Authority
- CN
- China
- Prior art keywords
- chicken interferon
- interferon alpha
- standard substance
- recombination chicken
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a preparation method of a recombinant chicken interferon-alpha standard substance, which comprises the following steps: carrying out fermentation and induction on a recombinant bacterium for expressing recombinant chicken interferon-alpha, directly collecting the thallus, crushing and extracting total proteins from the supernatant; and carrying out three-step purification to obtain the pure preparation product, adding a freeze-drying preservative into the pure product, and carrying out vacuum freeze drying to obtain the standard substance. The recombinant chicken interferon-alpha standard substance prepared by the method can be used for recombinant chicken interferon-alpha characteristic identification and titer determination comparison, so that the recombinant chicken interferon-alpha titer detection results determined in different batches can be more reliable and credible.
Description
Technical field
The present invention relates to a kind of preparation method of recombinant interferon standard substance, be specifically related to a kind of preparation method of recombination chicken interferon alpha standard substance.
Background technology
As one of important step in new rural village economic construction, poultry cultivation is important channel and the means of increasing peasant income always.But for a long time, livestock and poultry transmissible disease not only causes heavy losses to the peasant being engaged in aviculture, and causes serious threat to human health.China is every year because various virus disease causes mortality of livestock up to 15% ~ 20%; The financial loss caused thus has exceeded billions of unit.The highly pathogenic strain of some viruses often causes the acute massive mortality of bird, has very large harm to poultry husbandry and public health.In addition a lot of virus disease is also had to have impact in various degree, as subtracted ovum syndromes etc. to chicken aquaculture; Not small loss is brought to economy.The zoonosis of bird then brings direct harm to human health, needs badly and shows great attention to.
People's microbiotic and antiviral chemicals is mainly adopted to treat for the pharmacological agent that fowl transmissible disease is conventional at present, but the food drug residue problem caused, bring threat to human health.Some countries have prohibited some microbiotic and the application of antiviral in aquaculture now.Therefore, use interference without any side effects usually to treat and prevent avian viral diseases will to be the current problem comparatively paid close attention to.
The Interferon, rabbit protein with broad-spectrum antiviral, antitumor and immunoregulation effect that to be a class induce body to produce by materials such as virus and lipopolysaccharides, first nineteen fifty-seven is found by Issacs and Lindeman, it is the multi-functional cytokine of a class, after being combined with cell receptor, body can be induced to produce multiple specific protein and enzyme, mainly through suppress virogene transcribe and viral RNA of degrading suppress virus growth and breeding and play antitumor etc. activity.According to the generation cell of Interferon, rabbit, biochemical character and the effect that plays in immunity of organism different, be divided into α, β, γ tri-kinds of types.Existing known, interferon alpha can act on virus infected cell in vivo selectively, by suppressing the biosynthesizing of the virus protein in infected cell, plays wide spectrum and efficient disease-resistance toxic action, but to normal host cell without effect.
For biological products, Validity Index many employings biological method of its quality evalution, as animal law and cell method etc. detect.The variability of these methods own is comparatively large, and therefore, standard substance are requisite integral parts in producing, and in biological product standards, quality control and effect evaluation, standard substance are scales of quality evaluation of medicine, play very important effect.
Existing human interferon standard substance appear on the market at present, the interferon standard substance of pig obtains patent of invention, but international and domestic standard substance all not having recombination chicken interferon alpha at present, because Interferon, rabbit has species specificity, people or pig interferon standard substance and be not suitable for chicken interferon, this brings a lot of inconvenience to chicken interferon applied research and production work in control avian viral disease.
Summary of the invention
The invention provides a kind of preparation method of recombination chicken interferon alpha standard substance, these standard substance can be used for biologic activity and detect, and can be used as the reference standard of recombination chicken interferon alpha titration.
The recombination chicken interferon alpha antiviral activity standard substance work prepared in this way tire into: 9.0 × 10
8u/mL; It is 97.34% that SDS-PAGE detects its purity; It is 99.79% that HPLC detects its purity; Relative molecular weight is 35KD;-terminal amino acid sequence is ACNHLRPQDATFSHD from the tenth amino acid.
Technical solution of the present invention is:
A preparation method for recombination chicken interferon alpha standard substance, comprises the following steps:
(1) recombinant bacterium of recombination chicken interferon alpha is carried out fermenting and inducing, after rear directly collection bacterial cell disruption, supernatant extracts total protein, the recombinant bacterium of described recombination chicken interferon alpha is BL21/pET-32 α-rChIFN α engineering bacteria, and its DNA sequence dna is as shown in sequence table SEQ UENCELISTING400 < 1 >.
(2) total protein is through affinitive layer purification, anion-exchange chromatography purifying and sieve chromatography purifying, protein solution after recombination chicken interferon alpha purifying.
(3) in protein solution after recombination chicken interferon alpha purifying, add lyophilized vaccine, through vacuum lyophilization, recombination chicken interferon alpha standard substance can be obtained.
Step (1) specifically comprises the following steps:
(1-1) be inoculated in by engineering bacteria on the solid LB media containing penbritin, cultivate 16 ~ 24 hours for 37 DEG C, clone is seeded to the LB liquid nutrient medium that 2 ~ 3mL contains penbritin, and 18h is cultivated in 37 DEG C of shaking table concussions, obtains bacterium liquid;
(1-2) be seeded in 50 ~ 200mLLB substratum by the bacterium liquid that step (1-1) obtains, the volume ratio of bacterium liquid and substratum is 1:10 ~ 100, and put 37 DEG C of shaking tables and cultivate 18h, rotating speed is 200 ~ 220r/min, as ferment-seeded bacterium liquid;
(1-3) be added in fermentor tank by the LB substratum prepared, connection PH probe, dissolved oxygen probe carry out in-situ sterilization, and sterilising temp is 121 DEG C, and sterilization time is 20min;
(1-4) ferment-seeded bacterium liquid is inoculated in the fermentor tank that LB substratum is housed, the volume ratio of ferment-seeded bacterium liquid and LB substratum is 1:10 ~ 100, and set temperature is 37 DEG C, dissolved oxygen is 30%, rotating speed be 220 ~ 270r/min, PH is 7.2 ~ 7.4 condition bottom fermentations; As the OD in fermentor tank
600when reaching 0.6 ~ 1.0, adding isopropyl-beta D-thio galactopyranoside to final concentration is 0.5 ~ 1mmol/L, temperature regulating to 32 DEG C, and abduction delivering 4 ~ 5h, obtains fermented liquid;
(1-5) by the centrifugal 10min of 4000r/min under fermented liquid 4 DEG C of conditions, thalline is collected, with the resuspended thalline of 200mL physiological saline, under 1000bar pressure, high pressure cell is broken, repeat broken twice, the centrifugal 10 ~ 15min of 8000 ~ 12000r/min under 4 DEG C of conditions, collect supernatant; Repeated centrifugation once, is collected supernatant liquor, can be obtained recombination chicken interferon alpha albumen.
Described affinity chromatography method is as follows: purifying elutriant PH used is 8.0, is made up of Tutofusin tris, imidazoles, and the concentration of Tutofusin tris is 50mM, and the concentration of imidazoles is 10mM, collects rChIFN-α protein peak.
The albumen that described anion-exchange chromatography purification process will be collected as follows after affinitive layer purification, further employing PH is that the elutriant of 6.5 is at the enterprising line linearity wash-out of anion-exchange chromatography post, elutriant is made up of Tutofusin tris, NaCl, the concentration of Tutofusin tris is 50mM, the concentration of NaCl is 1M, collects rChIFN-α protein peak.
Described sieve chromatography purification process is as follows: after the sample concentration collected by ion exchange chromatography, and further through sieve chromatography column purification, adopt PH to be the elution of 7.4, elutriant is by Na
2hPO
4with NaCl composition, Na
2hPO
4concentration be the concentration of 50mM, NaCl be 0.15M, collect rChIFN-α protein peak.
Step (3) specifically comprises the following steps: by degerming with 0.22 μm of membrane filtration for protein solution after recombination chicken interferon alpha purifying, adding final concentration after diluting with 10mmol/LPBS is 80 ~ 150mL/L glycerine, 0.12 ~ 0.25g/mL N.F,USP MANNITOL and 0.025 ~ 0.085g/mL sucrose lyophilized vaccine, preferred final concentration is 100mL/L glycerine, 0.12g/mL N.F,USP MANNITOL, 0.025g/mL sucrose lyophilized vaccine, carry out vacuum freezedrying, as thinner, there is salt balance with PBS herein, adjustable suitable PH shock absorption, the structure and biological activity material of bioprotein can be protected to keep its most complete characteristic.
The-terminal amino acid sequence of the group chicken interferon α standard substance adopting preparation method of the present invention to prepare is ACNHLRPQDATFSHD from the tenth amino acid.
The titration method of the group chicken interferon α standard substance adopting above preparation method to prepare is: chick embryo fibroblast is as test cell, recombination chicken interferon alpha standard substance are as trial-product, recombinant human interferon-alpha is product in contrast, trial-product and reference substance are made different extent of dilution respectively, CEF/VSV system is tired to it and demarcates.
It is 9.0 × 10 that the work of recombination chicken interferon alpha standard substance of the present invention is tired
8u/mL.
The international and domestic standard substance all not having recombination chicken interferon alpha at present, the invention provides a kind of preparation method of recombination chicken interferon alpha biologic activity detection standard substance, laying the foundation for setting up recombination chicken interferon alpha quality standard.
The standard substance of the recombination chicken interferon alpha that the present invention obtains are freeze-dried preparation, can preserve for a long time for 2 ~ 8 DEG C, can preserve 2 years under lower than 25 DEG C of room temperatures.
The recombination chicken interferon alpha according to said method prepared can be used for the comparison of the discriminating of recombination chicken interferon alpha characteristic and titration as standard substance, and the recombination chicken interferon alpha bioactivity result that different batches can be made to measure as standard is more reliably credible.
Accompanying drawing explanation
Fig. 1 is restructuring chicken interferon α SDS-PAGE detected result figure:
M：Marker
1: recombination chicken interferon alpha stoste;
2: sample after recombination chicken interferon alpha affinitive layer purification;
3: recombination chicken interferon alpha anion-exchange chromatography wash-out sample (foreign protein);
4: target protein sample after recombination chicken interferon alpha sieve chromatography purifying;
Fig. 2 is restructuring chicken interferon α HPLCC18 reversed phase chromatography C protein purity detecting result figure.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is and purchases available from routine biochemistry reagent shop.
BL21/pET-32 α-rChIFN α engineering bacteria, makes (Ministry of Agriculture's Transgene-safty certificate: Nong Jian demonstrate,proves No. 034th, word 2014) by oneself by Anhui Jiuchuan Biotechnology Co., Ltd..
Embodiment one
The preparation of recombination chicken interferon alpha standard substance
1. the preparation of recombination chicken interferon alpha protein solution
Engineering bacteria to be inoculated on the solid LB media containing penbritin by 1.1, and cultivate 24 hours for 37 DEG C, clone is seeded to the LB liquid nutrient medium that 3mL contains penbritin, and 18h are cultivated in 37 DEG C of shaking tables concussions, obtain bacterium liquid;
The bacterium liquid that step (1-1) obtains is seeded in 200mLLB substratum by 1.2, and the volume ratio of bacterium liquid and substratum is 1:100, and put 37 DEG C of shaking tables and cultivate 18h, rotating speed is 220r/min, as ferment-seeded bacterium liquid;
The LB substratum prepared is added in fermentor tank by 1.3, and connection PH probe, dissolved oxygen probe carry out in-situ sterilization, and sterilising temp is 121 DEG C, and sterilization time is 20min;
Ferment-seeded bacterium liquid is inoculated in the fermentor tank that LB substratum is housed by 1.4, and the volume ratio of ferment-seeded bacterium liquid and LB substratum is 1:100, and set temperature is 37 DEG C, dissolved oxygen is 30%, rotating speed be 270r/min, PH is 7.4 condition bottom fermentations; As the OD in fermentor tank
600when reaching 0.6, adding isopropyl-beta D-thio galactopyranoside to final concentration is 1mmol/L, temperature regulating to 32 DEG C, and abduction delivering 5h, obtains fermented liquid;
1.5 by the centrifugal 10min of 4000r/min under fermented liquid 4 DEG C of conditions, collects thalline, and with the resuspended thalline of 200mL physiological saline, under 1000bar pressure, high pressure cell is broken, repeats broken twice, the centrifugal 10min of 12000r/min under 4 DEG C of conditions, collects supernatant; Repeated centrifugation once, is collected supernatant liquor, can be obtained recombination chicken interferon alpha albumen.
2. the purifying of recombination chicken interferon alpha protein solution
2.1His affinity chromatography
After the membrane filtration of rough recombination chicken interferon alpha with 0.22 μm of aperture, loading is by being connected on AKTAexplorer100 protein purification system, with the His affinity column that BindingBuffer I (PBS) has balanced, wash away unconjugated albumen with PBS damping fluid, until A
280nmstable, then use Elutionbuffer I (50mM Tutofusin tris, 20 ~ 50mM imidazoles, PH8.0) wash-out, collect rChIFN-α protein peak.
2.2DEAE anion-exchange chromatography
The albumen collected after His affinitive layer purification is replaced BindingBuffer II (50mM Tutofusin tris, PH6.5) after in, the DEAE anion-exchange chromatography post of loading by having balanced with BindingBuffer II, then cross post to A with BindingBuffer II
280nmafter value stabilization, with ElutionBuffer II (50mM Tutofusin tris, 1MNaCl, PH6.5) linear gradient elution, collect rChIFN-α protein peak.
2.3 sieve chromatography
After the sample concentration collected by ion exchange chromatography, loading is by using BindingBuffer III (50mMNa
2hPO
4, 0.15MNaCl, PH7.4) and balance Superdex200 molecular sieve chromatography, with BindingBuffer III wash-out, collect rChIFN-α protein peak.
3. the preparation of recombination chicken interferon alpha standard substance
By degerming with 0.22 μm of membrane filtration for protein solution after recombination chicken interferon alpha purifying; with 10mmol/LPBS dilution after add final concentration reach 100mL/L glycerine, 0.12g/mL N.F,USP MANNITOL, 0.025g/mL sucrose lyophilized vaccine mixing after; be distributed into the work in-process that specification is 2.2mL/ bottle; quick freeze vacuum-drying after packing; undertaken by goods lyophilization, recombination chicken Interferon, rabbit rChIFN-α standard substance can be obtained.
4. the detection of recombination chicken interferon alpha standard substance
Protein content determination: detect protein concentration to the rChIFN-α standard substance Lowry method after above-mentioned purifying, its protein content is 0.4mg/mL.
SDS-PAGE carries out Purity: carry out SDS-PAGE to rChIFN-α standard substance and identify purity, its purity is 97.34%, relative molecular weight 35kD (Fig. 1).
HPLC Purity: rChIFN-α standard substance carry out analysis through μ RPCC18ST4.6/100 reversed phase chromatography post and have to a main absorption peak as Fig. 2, has 1 peak for assorted peak.Show that main peak area accounts for 99.79% (Fig. 2) of the total area by calculating peak area.
N terminal amino acid sequencing:
A () enzyme is cut: get the rChIFN-α protein 20 0 μ g after purifying, add 4 unit recombinant enterokinases, cut 16 hours with enzyme under 4 DEG C of conditions in enzyme cutting buffering liquid.
B () SDS-PAGE electrophoresis: get digestion products and carry out SDS-PAGE electrophoresis, first install on vertical electrophoresis apparatus by the polyacrylamide gel configured before loading, runs 30min with 50V constant voltage sky.
(c) transferring film: forwarded to by albumen electricity on PVDF (polyvinylidene difluoride (PVDF)) film, electricity turns damping fluid CAPS damping fluid.
(d) the beginning of spring red colouring: pvdf membrane is put into and dyes in red dye liquor the beginning of spring, take out after seeing protein band, wash background color with water.
E object band is cut and is put in Eppendorf pipe by () ,-20 DEG C of preservations, carry out the order-checking of N terminal amino acid with Edman edman degradation Edman.
F ()-terminal amino acid sequence is ACNHLRPQDATFSHD from the tenth amino acid, illustrate that the target protein after purifying is exactly recombined chicken alpha interferon.
Embodiment two:
Be inoculated in by engineering bacteria on the solid LB media containing penbritin, cultivate 16 hours for 37 DEG C, clone is seeded to the LB liquid nutrient medium that 2mL contains penbritin, and 18h is cultivated in 37 DEG C of shaking table concussions, obtains bacterium liquid;
Be seeded in 50mLLB substratum by the bacterium liquid that step (1-1) obtains, the volume ratio of bacterium liquid and substratum is 1:10, and put 37 DEG C of shaking tables and cultivate 18h, rotating speed is 200r/min, as ferment-seeded bacterium liquid;
Be added in fermentor tank by the LB substratum prepared, connection PH probe, dissolved oxygen probe carry out in-situ sterilization, and sterilising temp is 121 DEG C, and sterilization time is 20min;
Be inoculated in the fermentor tank that LB substratum is housed by ferment-seeded bacterium liquid, the volume ratio of ferment-seeded bacterium liquid and LB substratum is 1:10, and set temperature is 37 DEG C, dissolved oxygen is 30%, rotating speed be 220r/min, PH is 7.2 condition bottom fermentations; As the OD in fermentor tank
600when reaching 1.0, adding isopropyl-beta D-thio galactopyranoside to final concentration is 0.5mmol/L, temperature regulating to 32 DEG C, and abduction delivering 4h, obtains fermented liquid;
By the centrifugal 10min of 4000r/min under fermented liquid 4 DEG C of conditions, collect thalline, with the resuspended thalline of 200mL physiological saline, under 1000bar pressure, high pressure cell is broken, repeats broken twice, the centrifugal 15min of 800r/min under 4 DEG C of conditions, collects supernatant; Repeated centrifugation once, is collected supernatant liquor, can be obtained recombination chicken interferon alpha albumen.
The method identical with embodiment one is adopted to carry out purifying, standard substance preparation and determination methods.
Embodiment three:
The titration of recombination chicken interferon alpha standard substance
This detection method can protect chick embryo fibroblast (Chickenembryofibroblast according to rChIFN-α; CEF) from vesicular stomatitis virus (vesicularstomatitisvirus; the principle of disoperation VSV); suppress pathological changes caused by virus effect (cytopathiceffect, CPE) phenomenon as the method detecting its activity using Interferon, rabbit.Namely half cell (50%) still can be protected to be decided to be Interferon, rabbit unit (or claiming to tire) from the dilution inverse of virus attack with the most high dilution of every milliliter of Interferon, rabbit inspection product; often represent with unit (U), and correct result with national standard.This result, after observing survival CEF cell dyeing with Crystal Violet Dye, according to the painted depth, goes out tiring of measured Interferon, rabbit by Reed-Munch formulae discovery.
1. experiment material
Recombinant human interferon-alpha standard substance: product in contrast, purchased from Beijing Chinese food medicine identification research institute, interferon alpha national standard, lot number: 97/04, calls markization Interferon, rabbit in the following text;
Recombination chicken interferon alpha standard substance: obtained, as trial-product by embodiment one;
Cell: chick embryo fibroblast (CEF);
Virus: challenge virus is vesicular stomatitis virus (VSV), is so kind as to give by clinical institute of viruses of Medical University Of Anhui;
96 porocyte culture plates: its method for numbering serial is: 12 row are from left to right numbered with 1,2,3,4,5,6,7,8,9,10,11,12 respectively; The front five-element are from top to bottom numbered with A, B, C, D, E, F respectively.
2. main operational steps and method
2.1 chick embryo fibroblast make
I. prepare: get the purification table top that various cultivation articles for use of having sterilized are placed in Nagative pressure bio-safty cabinet, disinfection by ultraviolet light 20min.
II. select embryo: get 9 ~ 10 age in days SPF chicken embryos, clean eggshell by bromogeramine, after drying, with the tincture of iodine, alcohol disinfecting eggshell, open air chamber with sterilizing tweezers and operating scissors.
III. process tissue: with the tweezers of another set of sterilization shell membrane opened chicken embryo picked up decaptitate, pawl, eye, put in sterile saline.Chicken embryo tissue block is placed in the beaker of sterilization, with sterilizing Hanks liquid rinsing 2 ~ 3 times, remove blood stains, tissue block is moved in sterilizing penicillin bottle, with sterilizing eye scissors, tissue is cut into the bulk of 1 ~ 2 mm in size, adds the trypsinase that final concentration is 0.25%, inserted in 37 DEG C of constant water bath box and digested, 2-3min rocks once, and digestion time is determined, generally about 12min according to the size of tissue block and the hardness of tissue.Depending on chicken embryo age in days size, less digestion time is shorter, sees soft texture.The general indigestible time is oversize otherwise easily cause cell viability not enough.
IV. being separated: when seeing that in digestive process Digestive system clouding is turbid, a little Digestive system of available suction pipe sucking-off, at Microscopic observation, is dispersed into cell mass or individual cells as organized, stopping digestion immediately.Add the nutritive medium of 10mL containing 10% calf serum, repeatedly blow and beat with suction pipe, make cell dispersal, come off.Then use filtered through gauze, filter the tissue block not yet fully digesting and open, sucking-off supernatant.
V. counting: with tally counting, adding nutrient solution adjustment cell number is 1 × 10
6individual/mL, is sub-packed in multiple Tissue Culture Flask, 10mL/ bottle.Inserted containing 5%CO
2in cell culture incubator, 37 DEG C.Cultivate 24h to observe.Generally monolayer cell can be formed at 24 ~ 48h.
The preparation of 2.2 need testing solutions
Aseptically operate, after recombined chicken alpha interferon standard substance being added 1mLPBS dissolving, in 96 porocyte culture plates, the dilution of 4 times of ascending series is done, totally 10 extent of dilution (horizontally-arranged put, be 1-10 hole) from 1:10000 (volume ratio) extent of dilution, each extent of dilution adds 4 holes (being respectively C, D, E, F), 11st hole is CEF cell controls group, and the 12nd hole is VSV virus control group
The preparation of 2.3 contrast recombination chicken interferon alphas
Aseptically operate, human interferon reference substance is diluted by labelled amount in 96 porocyte culture plates, from the extent of dilution of 2000IU/mL, does 4 times of ascending series dilutions, amount to making 10 extent of dilution, each extent of dilution adds 2 holes (being respectively A, B).
2.3 titration
Get cultured cells and discard nutrient solution, after washing 2 times with PBS, digestion and collecting cell, be mixed with every milliliter containing 1 × 10 with nutrient medium
6the cell suspension of individual cell, is inoculated in the first six row of 96 porocyte culture plates, every hole 100 μ l.
During 1-10 capable to A, B of 96 porocyte culture plates of the different extent of dilution reference substance solution immigration inoculation CEF cells prepared is arranged, every hole adds 100 μ l, during 1-10 capable to C, D, E, F of 96 porocyte culture plates of the different extent of dilution need testing solutions immigration inoculation CEF cells prepared is arranged, every hole adds 100 μ l, in 37 DEG C, 5%CO
218 ~ 24h is cultivated under condition.
Discard the supernatant liquor in Tissue Culture Plate, the vesicular stomatitis virus (VSV ,-70 DEG C of preservations) preserved is diluted to about 100TCID with nutrient solution
50/ mL, move in the capable 1-10 row of A, B, C, D, E, F of 96 porocyte culture plates of inoculation CEF cell, every hole 100 μ l, in 37 DEG C, 5%CO
224h (50% pathology point of microscopy need testing solution is at 1U/mL) is cultivated under condition.
2.4 results are observed
Incubator 24h culture will be put observe under inverted microscope.First observe " cell control well " and " virus control wells ", the CPE occurred in every hole represents with "+".When " +++ or ++++" appears in virus control wells, there is the obvious pathology of 75 ~ 100% in the cell namely in virus control wells, when the whole well-grown of the cell in normal cell controls hole is without pathology, then shows that this experiment contrast system is qualified, otherwise discard and reform.
++++represent whole cytopathy;
+++ represent 75% cytopathy;
+++ represent 50% cytopathy;
+ represent 25% cytopathy.
When Interferon, rabbit protective hole CPE is no longer in progress, get final product observations.
Above-mentioned cell plate lid is opened, discards liquid in each hole and, in thimerosal, add violet staining liquid 1 ~ 2/hole, with remaining dye liquor in thin current flushing port after 3 ~ 5min, after drying, can result be recorded.
2.5 results are observed
The work of recombined chicken alpha interferon standard substance is tired (U) method of calculation and result:
A, B arrange control group human interferon each porocyte and have all occurred 100% pathology, illustrate that human interferon reference substance is not suitable for chicken interferon and tires sequencing system.
Trial-product group outcome record is as following table:
As follows with Reed-Munch formulae discovery
Namely this batch of Interferon, rabbit is diluted to 10
-4× 4
-8 . 23(1:9.0 × 10
-8) time, half cell can be protected from " challenge virus " infringement, the recombination chicken interferon alpha standard substance work of this titration tire into: 9.0 × 10
8u/mL.Chicken interferon α standard substance every bottle due to this titration adopt 1mL dilution, therefore the recombination chicken interferon alpha standard substance work of this titration is tired and reached: 9.0 × 10
8u/ bottle.
2.6 work units are revised
Interferon, rabbit unit measured by each laboratory, is generally all called this laboratory " work unit " traditionally; In order to show the height that certain Interferon, rabbit is tired, just must be revised with homotype country (border) interferon standard substance, current Interferon, rabbit national standard only has people's, but interference have species specificity, this experiment also demonstrate that the mensuration that human interferon-alpha is not suitable for chicken source sexual cell system is tired, and is very important so prepare chicken interferon standard substance.
Above-mentioned detailed description of the preparation method of these recombination chicken interferon alpha standard substance and titration method being carried out with reference to embodiment; illustrative instead of determinate; several embodiments can be listed according to institute's limited range; therefore in the change do not departed under general plotting of the present invention and amendment, should belong within protection scope of the present invention.
SEQUENCELISTING
<110> Anhui Jiuchuan Biotechnology Co., Ltd.
The preparation method of <120> recombination chicken interferon alpha standard substance
<130>1
<160>1
<170>PatentInversion3.3
<210>1
<211>531
<212>DNA
<213>BL21/pET-32α-rChIFNα
<400>1
gcctgcaaccaccttcgcccccaggatgccaccttctctcacgacagcctccagctcctc60
cgggacatggctcccacactaccccagctgtgcccacagcacaacgcgtcttgctccttc120
aacgacaccatcctggacaccagcaacacccggcaagccgacaaaaccacccacgacatc180
cttcagcacctcttcacaatcctcagcagccccagcactccagcccactggaacgacagc240
caacgccaaagcctcctcaaccggatccaccgctacacccagcacctcgagcaatgcttg300
gacagcagcgacacgcgctcccggacgcgatggcctcgcaaccttcacctcaccatcaaa360
aaacacttcagctgcctccacaccttcctccaagacaacgattacagcgcctgcgcctgg420
gaacacgtccgcctgcaagctcgtgcctggttcctgcacatccacaacctcacaggcaac480
acgcgcactaagcttgcggccgcactcgagcaccaccaccaccaccactga531
Claims (10)
1. a preparation method for recombination chicken interferon alpha standard substance, is characterized in that: comprise the following steps:
(1) recombinant bacterium of recombination chicken interferon alpha is carried out fermenting and inducing, supernatant after direct collection bacterial cell disruption extracts total protein, the recombinant bacterium of described recombination chicken interferon alpha is BL21/pET-32 α-rChIFN α engineering bacteria, and its DNA sequence dna is as shown in SEQUENCELISTING400 < 1 >.
(2) total protein is through affinitive layer purification, anion-exchange chromatography purifying and sieve chromatography purifying, protein solution after recombination chicken interferon alpha purifying;
(3) in protein solution after recombination chicken interferon alpha purifying, add lyophilized vaccine, through vacuum lyophilization, recombination chicken interferon alpha standard substance can be obtained.
2. the preparation method of recombination chicken interferon alpha standard substance according to claim 1, is characterized in that: step (1) specifically comprises the following steps:
(1-1) be inoculated in by engineering bacteria on the LB solid medium containing penbritin, cultivate 16 ~ 24 hours for 37 DEG C, clone is seeded to the LB liquid nutrient medium that 2 ~ 3mL contains penbritin, and 18h is cultivated in 37 DEG C of shaking table concussions, obtains bacterium liquid;
(1-2) be seeded in 50 ~ 200mLLB substratum by the bacterium liquid that step (1-1) obtains, the volume ratio of bacterium liquid and substratum is 1:10 ~ 100, and put 37 DEG C of shaking tables and cultivate 18h, rotating speed is 200 ~ 220r/min, as ferment-seeded bacterium liquid;
(1-3) be added in fermentor tank by the LB substratum prepared, connection PH probe, dissolved oxygen probe carry out in-situ sterilization, and sterilising temp is 121 DEG C, and sterilization time is 20min;
(1-4) ferment-seeded bacterium liquid is inoculated in the fermentor tank that LB substratum is housed, the volume ratio of ferment-seeded bacterium liquid and LB substratum is 1:10 ~ 100, and set temperature is 37 DEG C, dissolved oxygen is 30%, rotating speed be 220 ~ 270r/min, PH is 7.2 ~ 7.4 condition bottom fermentations; As the OD in fermentor tank
600when reaching 0.6 ~ 1.0, adding isopropyl-beta D-thio galactopyranoside to final concentration is 0.5 ~ 1mmol/L, temperature regulating to 32 DEG C, and abduction delivering 4 ~ 5h, obtains fermented liquid;
(1-5) by the centrifugal 10min of 4000r/min under fermented liquid 4 DEG C of conditions, thalline is collected, with the resuspended thalline of 200mL physiological saline, under 1000bar pressure, high pressure cell is broken, repeat broken twice, the centrifugal 10 ~ 15min of 8000 ~ 12000r/min under 4 DEG C of conditions, collect supernatant; Repeated centrifugation once, is collected supernatant liquor, can be obtained recombination chicken interferon alpha albumen.
3. the preparation method of recombination chicken interferon alpha standard substance according to claim 1 and 2, is characterized in that: described affinity chromatography method is as follows:
Purifying elutriant PH used is 8.0, is made up of Tutofusin tris, imidazoles, and the concentration of Tutofusin tris is 50mM, and the concentration of imidazoles is 10mM, collects rChIFN-α protein peak.
4. the preparation method of recombination chicken interferon alpha standard substance according to claim 1, is characterized in that: described anion-exchange chromatography purification process is as follows:
By the albumen collected after affinitive layer purification, further employing PH is that the elutriant of 6.5 is at the enterprising line linearity wash-out of anion-exchange chromatography post, elutriant is made up of Tutofusin tris, NaCl, the concentration of Tutofusin tris is 50mM, the concentration of NaCl is 1M, collects rChIFN-α protein peak.
5. the preparation method of the recombination chicken interferon alpha standard substance according to claim 1 or 4, is characterized in that: described sieve chromatography purification process is as follows:
After the sample concentration collected by ion exchange chromatography, further through sieve chromatography column purification, adopt PH to be the elution of 7.4, elutriant is by Na
2hPO
4with NaCl composition, Na
2hPO
4concentration be the concentration of 50mM, NaCl be 0.15M, collect rChIFN-α protein peak.
6. the preparation method of recombination chicken interferon alpha standard substance according to claim 1, is characterized in that: step (3) specifically comprises the following steps:
By degerming with 0.22 μm of membrane filtration for protein solution after recombination chicken interferon alpha purifying; adding final concentration after diluting with 10mmol/L phosphoric acid buffer is 80 ~ 150mL/L glycerine, 0.12 ~ 0.25g/mL N.F,USP MANNITOL, 0.025 ~ 0.085g/mL sucrose lyophilized vaccine, carries out vacuum freezedrying.
7. the preparation method of recombination chicken interferon alpha standard substance according to claim 6, is characterized in that: described lyophilized vaccine is final concentration is 100mL/L glycerine, 0.12g/mL N.F,USP MANNITOL, 0.025g/mL sucrose.
8. the recombination chicken interferon alpha standard substance that prepare of the preparation method of recombination chicken interferon alpha standard substance according to claim 1.
9. the titration method of recombination chicken interferon alpha standard substance according to claim 8, it is characterized in that: chick embryo fibroblast is as test cell, recombination chicken interferon alpha standard substance are as trial-product, recombinant human interferon-alpha is product in contrast, trial-product and reference substance are made different extent of dilution respectively, CEF/VSV system is tired to restructuring chicken interferon α standard substance and demarcates.
10. the application of recombination chicken interferon alpha standard substance according to claim 8 in the discriminating of recombination chicken interferon alpha characteristic and titration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510532805.5A CN105039474A (en) | 2015-08-25 | 2015-08-25 | Preparation method of recombinant chicken interferon-alpha standard substance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510532805.5A CN105039474A (en) | 2015-08-25 | 2015-08-25 | Preparation method of recombinant chicken interferon-alpha standard substance |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105039474A true CN105039474A (en) | 2015-11-11 |
Family
ID=54446441
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510532805.5A Pending CN105039474A (en) | 2015-08-25 | 2015-08-25 | Preparation method of recombinant chicken interferon-alpha standard substance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039474A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105944096A (en) * | 2016-05-06 | 2016-09-21 | 安徽九川生物科技有限公司 | Immunoenhancer for chicken vaccine |
| CN106244653A (en) * | 2016-08-29 | 2016-12-21 | 芜湖英特菲尔生物制品产业研究院有限公司 | A kind of preparation method of recombination chicken interferon gamma standard substance |
| CN106282279A (en) * | 2016-08-25 | 2017-01-04 | 安徽九川生物科技有限公司 | A kind of canine recombinant interferon-ALPHA standard substance, its preparation method and titration method |
| CN106319006A (en) * | 2016-08-25 | 2017-01-11 | 安徽九川生物科技有限公司 | Recombinant bovine interferon-alpha standard substance, preparation method thereof and potency determination method |
| CN106367422A (en) * | 2016-08-29 | 2017-02-01 | 安徽九川生物科技有限公司 | Preparation method of standard product for recombinant ovine interferon Tau biological activity detection |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1260171A (en) * | 2000-01-25 | 2000-07-19 | 长春长生基因药业股份有限公司 | Recombined alpha-type interferon freeze-drying protective agent |
| CN101736062A (en) * | 2009-11-27 | 2010-06-16 | 王明丽 | Method for preparing recombinant porcine alpha interferon standard substance |
| CN103290021A (en) * | 2013-03-19 | 2013-09-11 | 安徽九川生物科技有限公司 | A preparation method for recombinant chicken interferon alpha |
| CN103585633A (en) * | 2013-10-29 | 2014-02-19 | 王明丽 | Freeze-drying protective agent for recombinant porcine interferon alpha 1 and preparation method thereof |
| CN104447978A (en) * | 2014-12-10 | 2015-03-25 | 天津生机集团股份有限公司 | Recombinant chicken interferon alpha and preparation method thereof |
-
2015
- 2015-08-25 CN CN201510532805.5A patent/CN105039474A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1260171A (en) * | 2000-01-25 | 2000-07-19 | 长春长生基因药业股份有限公司 | Recombined alpha-type interferon freeze-drying protective agent |
| CN101736062A (en) * | 2009-11-27 | 2010-06-16 | 王明丽 | Method for preparing recombinant porcine alpha interferon standard substance |
| CN103290021A (en) * | 2013-03-19 | 2013-09-11 | 安徽九川生物科技有限公司 | A preparation method for recombinant chicken interferon alpha |
| CN103585633A (en) * | 2013-10-29 | 2014-02-19 | 王明丽 | Freeze-drying protective agent for recombinant porcine interferon alpha 1 and preparation method thereof |
| CN104447978A (en) * | 2014-12-10 | 2015-03-25 | 天津生机集团股份有限公司 | Recombinant chicken interferon alpha and preparation method thereof |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105944096A (en) * | 2016-05-06 | 2016-09-21 | 安徽九川生物科技有限公司 | Immunoenhancer for chicken vaccine |
| CN106282279A (en) * | 2016-08-25 | 2017-01-04 | 安徽九川生物科技有限公司 | A kind of canine recombinant interferon-ALPHA standard substance, its preparation method and titration method |
| CN106319006A (en) * | 2016-08-25 | 2017-01-11 | 安徽九川生物科技有限公司 | Recombinant bovine interferon-alpha standard substance, preparation method thereof and potency determination method |
| CN106244653A (en) * | 2016-08-29 | 2016-12-21 | 芜湖英特菲尔生物制品产业研究院有限公司 | A kind of preparation method of recombination chicken interferon gamma standard substance |
| CN106367422A (en) * | 2016-08-29 | 2017-02-01 | 安徽九川生物科技有限公司 | Preparation method of standard product for recombinant ovine interferon Tau biological activity detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105039474A (en) | Preparation method of recombinant chicken interferon-alpha standard substance | |
| CN103981139B (en) | One strain brucella low virulent strain and vaccine thereof | |
| CN101869702B (en) | Vaccine produced by suspended microcarrier cell culture system and method for producing vaccine | |
| CN104099301A (en) | Coxsackie virus A16 virus strain, uses of strain, vaccine and preparation method of vaccine | |
| CN113621584A (en) | Staphylococcus aureus bacteriophage and antibacterial application thereof | |
| CN104498441A (en) | Duck hepatitis A virus III type attenuated strain, live vaccine prepared from same and application of live vaccine | |
| CN106282279A (en) | A kind of canine recombinant interferon-ALPHA standard substance, its preparation method and titration method | |
| CN104946574A (en) | Bacillus subtilis Baisha2C for restraining plant pathogenic fungi | |
| CN107502581A (en) | One plant of Serratia bacterial strain | |
| CN102994401A (en) | Method for preparing apple tree valsa ceratosperma transformant and GFP (Green Fluorescent Protein) labelled strain | |
| CN109310721B (en) | Bacteriophage strain and application thereof | |
| CN102228686A (en) | Process for preparing veterinary rabies inactivated and freeze-dried vaccine through suspension culture cell | |
| CN105274064B (en) | A kind of duck tembusu virus attenuated vaccine strain and its application | |
| CN105255746B (en) | One plant of Paecilonyces variotii strain and its application for having High pathogenicity to diaphorina citri | |
| CN105039263A (en) | ethod for Prevention and Treatment of Streptococcus Parauberis Infections | |
| US4472378A (en) | Live vaccine for the prevention of salmonellosis in water fowl, a process for making and applying the same | |
| CN106244653A (en) | A kind of preparation method of recombination chicken interferon gamma standard substance | |
| CN102936285A (en) | Antibody for preventing and treating fish Edwardsiellaictaluri disease, preparation method and applications thereof | |
| CN103387942A (en) | Metarrhizum anisopliae for preventing and treating palm insect rhynchophorus ferrugineus and application thereof | |
| CN103146655A (en) | Seed selection of high-immunogenicity rabies virus fixed strain and application thereof in vaccine development | |
| CN103160475B (en) | Enterovirus 71 type viral strain, its application, vaccine and preparation method | |
| CN109810907A (en) | One plant of beauveria bassiana BbJL-01 for having High pathogenicity to Dendrolimus houi linal-instar larvae | |
| CN105838625B (en) | The preparation method of one plant of Cordyceps strain and cordyceps sinensis mycelium powder | |
| CN106319006A (en) | Recombinant bovine interferon-alpha standard substance, preparation method thereof and potency determination method | |
| CN110964700B (en) | Salmonella abortus phage and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151111 |
|
| RJ01 | Rejection of invention patent application after publication |