CN105112430B - The detection method of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene TaHMGR and its separation clone, rite-directed mutagenesis and enzyme function - Google Patents

Abstract

The invention belongs to molecular biology fields, it is related to a kind of separation clone for participating in first key gene of isoprenoid substance synthesis in wheat mevalonic acid metabolic pathway, site-directed point mutation, the prokaryotic expression of zymoprotein, zymoprotein isolate and purify and Enzyme assay technology, for further progress genetic modification and modification, it constructs the eukaryotic gene expression vector of 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene and converts corresponding crop, the plant of important commercial value is especially obtained by secondary metabolism, inquire into overexpression and secondary metabolite of the 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene in recipient plant, the relationship of crop kernel size and the grain Main Agronomic Characters such as again, and then improve crop yield, and to 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene Introne, exon and promoter structure are dissected, and research promoter function, the related molecular labeling of exploitation provide important technology deposit.

Description

Wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene TaHMGR and its separation The detection method of clone, rite-directed mutagenesis and enzyme function

Technical field

The invention belongs to molecular biology field, it is related to isoprenoid in a kind of participation wheat mevalonic acid metabolic pathway The first key gene wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene TaHMGR and its divide that substance synthesizes Detection method from clone, rite-directed mutagenesis and enzyme function.

Background technique

Isoprenoid substance is to maintain plant growth and development, photosynthesis, electron transmission, response environment stress etc. must The important substance needed.The substance can be used as photosynthetic pigments (such as chlorophyll, carotenoid), growth substance and plant hormone A part of (such as basic element of cell division, abscisic acid, gibberellin and brassinosteroid), membrane structure such as sitosterol, electron transmission receptor As plastoquinone, as glucosyl reaction in glucose receptor such as dolichol, and can regulating cell growth (such as iso-amylene Base albumen, the basic element of cell division).In addition, many plant isoprenoids also have important commercial value such as rubber, food fragrant Material, beverage, vitamin A. D. E and natural insecticide such as pyrethrin etc..

Isoprenoid substance mainly passes through a series of Enzyme catalyzed synthesis in mevalonate pathway, wherein metabolism way First key enzyme is 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR in diameter；EC 1.1.1.34), it is control metabolism One of rate-limiting enzyme of approach.The enzyme utilizes NADPH, and 3-hydroxy-3-methylglutaryl-coenzyme A is converted to mesostate first Hydroxyl valeric acid.HMGR gene divides from 80 various plants such as arabidopsis, tomato, Para rubber tree, catharanthus roseus, potato at present Come from cloning.But there are no open or delivered about from wheat breed " Jimai 22 " or from other wheats in the prior art Complete 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene, site-directed point mutation, gene protokaryon table are cloned in separation in kind Reach, zymoprotein isolate and purify and its research datas information such as enzyme function vitro detection, it is therefore necessary to it is carried out deep Research and develop its related application.

Summary of the invention

For above situation in the prior art, the present inventor provides a kind of participation wheat mevalonic acid metabolism The original for separating clone, site-directed point mutation, zymoprotein for first key gene that isoprenoid substance synthesizes in approach Nuclear expression, zymoprotein isolate and purify and Enzyme assay technology.For further progress genetic modification and modification, building 3- hydroxyl The eukaryotic gene expression vector of base -3- methylglutaryl A reductase gene simultaneously converts corresponding crop, especially by secondary Raw metabolism obtains the plant of important commercial value, inquires into 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene in recipient plant In overexpression and secondary metabolite, crop kernel size and the grain Main Agronomic Characters such as again relationship, and then improve agriculture Crop yield, and to 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene introne, exon and promoter structure into Row dissects, and research promoter function, the related molecular labeling of exploitation provide important technology deposit, especially can be specific by changing Amino acid codes increase or decrease the catalytic activity of enzyme.

The wild type 3-hydroxy-3-methylglutaryl-coenzyme A reduction that the present invention is obtained from wheat breed " Jimai 22 " clone K of the enzyme to substrate NADPH and HMG-COA_MValue is respectively 41.3 ± 4.2 and 39.5 ± 4.6mM；Vmax is respectively 0.08 ± 0.00 With 0.09 ± 0.00mmol/min/mg；Kcat is respectively 0.15 ± 0.01 and 0.16 ± 0.01S^-1；Kcat/K_MRespectively 3.63 ×10³With 4.05 × 10³M^-1S^-1, thus prove the wild-type wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase base of clone Because having the function of native biological.13 mutant of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene are measured To the enzyme kinetics parameter of substrate NADPH and HMG-COA, the results showed that, it, can by the change to specific amino acid codons Significantly improve or reduce the catalytic activity of enzyme.

Wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene TaHMGR provided by the invention, code area nucleosides Acid sequence is as shown in Seq ID No.1, and the amino acid sequence of coding is as shown in Seq ID No.2.

Above-mentioned wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene cDNA overall length is 2371bp, open reading Frame (ORF) length is that 1674bp terminates since positioned at the 112nd ATG to the 1785th TGA, encodes 557 ammonia altogether Base acid residue, upstream 5' noncoding region (UTR) length are 111bp, and downstream 3' noncoding region (UTR) length reaches 586bp, the base Because of molecular weight of the encoded protein about 59.0kD, isoelectric point (PI) is 6.99.It is online to wheat HMGR amino acid sequence through SMART software Analysis shows that HMGR protein sequence the 34th between 53 amino acids and the 74th between 96 amino acids there are two sections across Diaphragm area, amino acids are the positions where soluble catalyst region from 165 to 544；

The present inventor provides specific separation cloning process, site-directed point mutation and its prokaryotic expression of the gene And the method for enzyme Function detection are as follows:

1. the separation and Extraction of 22 blade RNA of Jimai

It is carried out according to the specification of Trizol kit.The RNA of acquisition is stored in spare in DEPC water.

2. the synthesis of the first chain cDNA

It is carried out according to Takara reverse transcription reagent box specification.

3. the amplification of gene intermediate sequence, connection and conversion

By searching for and compare a variety of known plants, especially with plant HMGR sequence similar in wheat relationship, find base Because of the highly conserved region of sequence, intermediate sequence amplimer is designed using Primer 5.0, expands the corresponding sequence of wheat hmgr. Upstream primer mhmgrF1:5'CGATGGCCGGGAGGAACCTGTACATGAG3', nucleotide sequence such as Seq ID No.3 institute Show, downstream primer mhmgrR1:5'CACCACCAACTGTGCCCACCTCAAT3', nucleotide sequence such as Seq ID No.4 institute Show.PCR is carried out according to certain condition, recycles 485bp specific band using DNA plastic recovery kit.

The DNA fragmentation of recycling and pGEM-T Easy carrier are attached.5 α of Escherichia coli DH is converted using heat shock method, Picking positive colony extracts Plasmid DNA and is sequenced, compared by NCBI and obtain target gene fragment.

4. being quickly obtained gene end sequences using RACE technology

4.1 gene end sequences rapid amplifyings

According to the gene intermediate sequence of 485bp obtained, 5'RACE primer: first round mhmgrR1:5' is utilized CACCACCAACTGTGCCCACCTCAAT 3', nucleotide sequence is as shown in Seq ID No.5；Second wheel hmgrCR11:5' GTCAGGGAAGTCATCCTGGAGGTAAT 3', nucleotide sequence is as shown in Seq ID No.6；3'RACE primer MhmgrF1:5'CGATGGCCGGGAGGAACCTGTACATGAG 3', nucleotide sequence is as shown in Seq ID No.7.

According to the SMARTTm RACE cDNA Amplification kit's of Clontech Laboratories INC Recon is screened, and is sequenced in the end 5' and 3' of method rapid amplifying gene.

4.2 gene intermediate sequences and RACE sequence are using the splicing full length sequence of Contig Express 9.1, then to institute The contig sequence obtained is manually proofreaded.

The amplification of 5 full length gene sequences

The design of 5.1 full length gene primers

According to intermediate sequence and RACE sequence contig as a result, design overall length amplimer.

Upstream primer sequence is hmgr-QCF4 5'GTTTGACTCCGACGCGCAC 3', nucleotide sequence such as Seq ID Shown in No.8；

Downstream primer sequence is hmgr-QCR1 5'GCTTCCTGAAGCAAGGAGAG 3', nucleotide sequence such as Seq Shown in ID No.9.

The PCR amplification of 5.2 full-length genes

Using the first chain cDNA as template amplification overall length target gene, carry out full-length gene PCR product glue recycling, connection, Conversion, the detection of PCR recon, plasmid extracts and sequencing, and acquisition full length sequence is 2371bp, nucleotide sequence such as Seq ID Shown in No.1.

The prokaryotic expression of 6 gene catalytic domains

6.1 gene catalytic domain prokaryotic expression design of primers

According to gained full length sequence sequencing result, resulting gene order is translated into amino acid sequence (such as using software Amino acid sequence shown in Seq ID No.2), then with biological 3-hydroxy-3-methylglutaryl-coenzyme A reductase known to NCBI Amino acid sequence is compared, and determines the ORF of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene.Due to wheat 3- Two sections of trans-membrane regions of hydroxy-3-methyl glutaryl coenzyme A reductase are not involved in the catalysis of enzyme, but when will cause prokaryotic expression The precipitating of zymoprotein, therefore on the basis of wheat TaHMGR full length sequence, from the 138th amino of overall length open reading frame sequence Acid starts, and designs the catalytic domain expression primer of 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene.At the end 5' of gene, if Meter is close with ribosome bind site (AGGAGGA), restriction enzyme Sal1 restriction enzyme site, initiation codon, 6 histidines 7 amino acid codes primer hmgr-PrF:5'CG in numeral and 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene CGCGTCGACAGGAGGAATTTAAAATGAGAGGATCGCATCATCACCACCATCACGTG CCCGAGAAAATGCCCGA3', Its nucleotide sequence is as shown in Seq ID No.10；At the end 3' of gene, restrictive restriction endonuclease Hind III digestion is designed Site, terminator codon (TAG) and the primer hmgr-PrR:5'CTGCAGAAGCTTTCAAGA containing 6 amino acid of coding ACTTAGAGATGCGG 3', nucleotide sequence is as shown in Seq ID No.11.

The building of 6.2 prokaryotic expression vectors

The main digestion including gene prokaryotic sequence pcr amplification product, turns the connection of digestion products and carrier pLM1 Change, PCR and digestion identify positive colony recon, extraction of plasmid DNA and sequence verification.

The rite-directed mutagenesis of 7 wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene codons

The design of 7.1 codon mutation primers

It is found by amino acid alignment, 61Q in wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase conserved region, The positions amino acid such as 93I, 102Q, 138R, 213I, 223Y, 229P, 336A, 339D, 379N and 382S is different from other plants, To inquire into influence of these amino acid residues to enzymatic activity, it is sported respectively 61D, 61E, 93V, 102E, 102R, 138Q, 213V, 223F, 229H, 336P, 339A, 379S and 382R.The upstream and downstream primer of mutant is respectively as follows:

Q61DF:CACGGGGAGGGATTTCGAGGGTC, nucleotide sequence is as shown in Seq ID No.12, Q61DR: GACCCTCGAAATCCCTCCCCGTG, for nucleotide sequence as shown in Seq ID No.13, codon sports GAT by CAG；

Q61EF:CACGGGGAGGGAGTTCGAGGGTC, nucleotide sequence is as shown in Seq ID No.14, Q61ER: GACCCTCGAACTCCCTCCCCGTG, for nucleotide sequence as shown in Seq ID No.15, codon sports GAG by CAG；

I93VF:CGTGGGCGTCGCCGGGCCGC, nucleotide sequence is as shown in Seq ID No.16, I93VR: GCGGCCCGGCGACGCCCACG, for nucleotide sequence as shown in Seq ID No.17, codon sports GTC by ATC；

Q102RF:CTCGACGGCAGGCGGTTCTAC, nucleotide sequence is as shown in Seq ID No.18, Q102RR: GTAGAACCGCCTGCCGTCGAG, for nucleotide sequence as shown in Seq ID No.19, codon sports AGG by CAG；

Q102EF:CTCGACGGCGAGCGGTTCTAC, nucleotide sequence is as shown in Seq ID No.20, Q102ER: GTAGAACCGCTCGCCGTCGAG, for nucleotide sequence as shown in Seq ID No.21, codon sports GAG by CAG；

R138QF:GTTGTGCTCCAGGACGCGATGAC, nucleotide sequence is as shown in Seq ID No.22, R138QR: GTCATCGCGTCCTGGAGCACAAC, for nucleotide sequence as shown in Seq ID No.23, codon sports CAG by CGG；

I213VF:GAACATGGTCTCCAAGGGCGTG, nucleotide sequence is as shown in Seq ID No.24, I213VR: CACGCCCTTGGAGACCATGTTC, for nucleotide sequence as shown in Seq ID No.25, codon sports GTC by ATC；

Y223FF:GTGCTGGATTTCCTCCAGGATGAC, nucleotide sequence as shown in Seq ID No.26, Y223FR:GTCATCCTGGAGGAAATCCAGCAC, nucleotide sequence as shown in Seq ID No.27, dashed forward by TAC by codon Become TTC；

P229HF:CAGGATGACTTCACTGACATGGATG, nucleotide sequence as shown in Seq ID No.28, P229HR:CATCCATGTCAGTGAAGTCATCCTG, nucleotide sequence as shown in Seq ID No.29, dashed forward by CCC by codon Become CAC；

A336PF:CAATGTTGGAACCTGTAAATGATG, nucleotide sequence as shown in Seq ID No.30, A336PR:CATCATTTACAGGTTCCAACATTG, nucleotide sequence as shown in Seq ID No.31, dashed forward by GCT by codon Become CCT；

D339AF:CTGTAAATGCTGGCAAAGATCTTC, nucleotide sequence as shown in Seq ID No.32, 3D339AR:GAAGATCTTTGCCAGCATTTACAG, nucleotide sequence as shown in Seq ID No.33, dashed forward by GAT by codon Become GCT；

N379SF:GAAAGGCGCCAGCAGGGAATCGCCAG, nucleotide sequence as shown in Seq ID No.34, N379SR:CTGGCGATTCCCTGCTGGCGCCTTTC, nucleotide sequence is as shown in Seq ID No.35, and codon is by AAC Sport AGC；

S382RF:CAACAGGGAACGGCCAGGATC, nucleotide sequence is as shown in Seq ID No.36, S382RR: GATCCTGGCCGTTCCCTGTTG, for nucleotide sequence as shown in Seq ID No.37, codon sports CGG by TCG.

The PCR amplification of 7.2 mutant

With the wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene catalytic domain wild type expression vector matter of building Grain is DNA profiling, and suitable annealing temperature carries out PCR amplification.

Conversion, the sequencing of 7.3 mutant pcr amplification products

Template plasmid DNA is removed with Dpn1 restriction enzyme, converts escherichia coli DH5a, extract Plasmid DNA and is sequenced Determine mutational site.Positive colony is transformed into expression bacterial strain, protein expression is carried out.

The expression of 8 wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase genes

The optimization of 3-hydroxy-3-methylglutaryl-coenzyme A reductase wild-type protein expression condition is carried out first, including IPTG concentration, optimization of inducing temperature etc..According to determining optimal conditions, 3-hydroxy-3-methylglutaryl-coenzyme A reduction is carried out Enzyme wild type, the great expression of mutant protein.

The purifying of 9 wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase wild types and mutant protein

Utilize ion exchange column separating purification 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme protein.Cross the egg of column purification White matter desalts loaded on dialysing in certain solution in bag filter, and the protein of purifying is saved backup in -86 DEG C.

10 utilize spectrophotometer, detect the work of wild type, mutant 3-hydroxy-3-methylglutaryl-coenzyme A reductase Property.The wild type 3-hydroxy-3-methylglutaryl-coenzyme A reductase obtained from wheat breed " Jimai 22 " clone is measured to substrate The K of NADPH and HMG-COA_MValue is respectively 41.3 ± 4.2 and 39.5 ± 4.6mM；Vmax is respectively 0.08 ± 0.00 and 0.09 ± 0.00mmol/min/mg；Kcat is respectively 0.15 ± 0.01 and 0.16 ± 0.01S^-1；Kcat/K_MRespectively 3.63 × 10³With 4.05×10³M^-1S^-1, it is natural raw thus to prove that the wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene of clone has Object function.Measured 13 wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene mutant to substrate NADPH and The enzyme kinetics parameter of HMG-COA see the table below, and show to significantly improve or reduce enzyme by the change to amino acid codes Catalytic activity.

Wheat HMGR mutant enzyme kinetic parameter

The present invention is further to carry out genetic modification and modification, building 3- hydroxy-3-methyl penta by site-directed point mutation The eukaryotic gene expression vector of two acyl coenzyme A reductase genes simultaneously converts corresponding crop, especially obtains by secondary metabolism The plant of important commercial value inquires into 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene and crosses scale in recipient plant Up to the relationship with secondary metabolite, crop kernel size and the grain Main Agronomic Characters such as again, and then crop yield is improved, with And 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene introne, exon and promoter structure are dissected, it studies Promoter function, the related molecular labeling of exploitation provide important technology deposit, especially can be by changing specific amino acid code Son increases or decreases the catalytic activity of enzyme.

Detailed description of the invention

Fig. 1 is wheat breed " Jimai 22 " seedling RNA electrophoretogram；

Fig. 2 is intermediate sequence PCR products electrophoresis map,

1-4 is wheat TaHMGR gene intermediate sequence PCR product in figure, and length 485bp, 5 be 100bp DNA Ladder；

Fig. 3 is wheat TaHMGR gene 5' end sequence rapid amplifying PCR products electrophoresis map,

1 is 5' terminal sequence pcr amplification product, size 1246bp in figure；2 be the DNA Ladder of 1kb；

Fig. 4 is wheat TaHMGR gene 3' end sequence rapid amplifying PCR products electrophoresis map,

1 is 3' terminal sequence pcr amplification product, size 1349bp in figure；2 be the DNA Ladder of 1kb；

Fig. 5 Jimai 22TaHMGR full length gene DNA electrophoretogram,

1 is Jimai 22TaHMGR full length gene amplified production, size 2119bp, the 5' end fragment sequence that will be obtained in figure The fragment sequence expanded with 3' end fragment sequence with overall length is spliced, and the complete wheat TaHMGR that length is 2371bp has been obtained Gene；2 be the DNA Ladder of 1kb；

Fig. 6 is the PCR products electrophoresis map of wheat TaHMGR gene catalytic domain HMGRcd,

In figure 1 be HMGRcd PCR product, size 1311bp；2 be the DNA Ladder of 1kb；

Fig. 7 is pLM1-HMGRcd expression plasmid restriction enzyme digestion and electrophoresis figure,

1 is 1kb DNA Ladder in figure；2 be pLM1-HMGRcd recombinant plasmid；3 be Sal1, HindIII double digestion weight Group plasmid；4-5 is respectively Sal1, HindIII single endonuclease digestion recombinant plasmid；

Fig. 8 is the SDS-PAGE electrophoresis of wheat TaHMGR gene HMGRcd albumen,

1-4 is the albumen of elution in figure；5 be protein molecular weight standard；

Fig. 9 is the SDS-PAGE electrophoresis of wheat HMGR wild type and mutein,

1 is wild-type wheat HMGR albumen in figure；2 be Q61D；3 be Q61E；4 be I93V；5 be Q102R；6 be Q102E；7 For R138Q；8 be Protein Marker；9 be I213V；10 be Y223F；11 be P229H；12 be A336P；13 be D339A；14 For N379S；15 be S382R.

Specific embodiment

Embodiment 1 (wheat breed " Jimai 22 " blade RNA extraction)

[1] about 100mg wheat leaf blade rapid grind into powder in liquid nitrogen is taken, 500 μ l RL are added and (are first checked using preceding Whether beta -mercaptoethanol has been added), the acutely concussion that is vortexed immediately mixes.

[2] all solution are transferred on Filter column CS (Filter column CS is placed in collecting pipe), 13,000rpm (13,400 × g) centrifugation 2-5min, into the centrifuge tube of new RNase-Free, suction nozzle avoids the careful supernatant drawn in collecting pipe as far as possible Contact the pellet cell debris in collecting pipe.

[3] it is slowly added to the dehydrated alcohol (about 260ul) of 0.5 times of supernatant volume, it is (at this time it is possible that heavy to mix Form sediment), obtained solution and precipitating are transferred to together in adsorption column CR3,13,000rpm (13,400 × g) are centrifuged 1min, outwell receipts Waste liquid in collector puts back to adsorption column CR3 in collecting pipe.

Note: if supernatant volume has loss, the corresponding dosage for adjusting ethyl alcohol.

[4] 350 μ l protein liquid removal RW1,13,000rpm (13,400 × g) are added into adsorption column CR3 and are centrifuged 1min, Fall the waste liquid in collecting pipe, adsorption column CR3 is put back in collecting pipe.

[5] preparation of DNase I working solution: 10 μ l DNase I storing liquids is taken to be put into new RNase-Free centrifuge tube In, 70 μ l RDD solution are added, it is soft to mix.

[6] the DNase I working solution of 80 μ l is added to the center adsorption column CR3, is placed at room temperature for 15min.

[7] 350 μ l protein liquid removal RW1,12,000rpm (13,400 × g) are added into adsorption column CR3 and are centrifuged 30- 60sec outwells the waste liquid in collecting pipe, and adsorption column CR3 is put back in collecting pipe.

[8] it is added 500 μ l rinsing liquid RW (ethyl alcohol has been added using preceding first check whether) into adsorption column CR3,13, 000rpm (13,400 × g) is centrifuged 30-60sec, outwells the waste liquid in collecting pipe, adsorption column CR3 is put back in collecting pipe.

[9] step 8 is repeated.

[10] 13,000rpm (13,400 × g) be centrifuged 2min, by adsorption column CR3 be put into a new RNase-Free from In heart pipe, 50 μ l RNase-Free ddH2O are vacantly added dropwise to the intermediate position of adsorbed film, are placed at room temperature for 2min, 13,000rpm (13,400 × g) is centrifuged 1min, obtains RNA solution.

[11] 2.5 μ l RNA samples are taken, 1.0 ﹪ agarose native gel electrophoresis detection, gel imaging system is taken pictures note Record, as a result as shown in Figure 1.

Embodiment 2 (synthesis of first chain of cDNA)

[1] following reaction mixture is added into the nuclease free centrifuge tube of ice bath:

50-500ng mRNA；

2μl oligo(dT)15

2μl Super Pure dNTPs(2.5mM each)；

Mend RNase-Free ddH₂O is settled to 14.5 μ l.

Cool down 2min after [2] 70 DEG C of heating 5min on ice rapidly.Following each group is added after collecting reaction solution in brief centrifugation Point: 4 μ 5 × First-Strand of l Buffer (containing DTT)；0.5μl RNasin.

[3] add 1 μ l (200U) TIANScript M-MLV, gently mixed with pipettor.

[4] 42 DEG C of warm bath 50min.

[5] 95 DEG C of heating 5min terminate reaction, set and carry out subsequent experimental or freezen protective on ice.

[6] reaction system is diluted to 50 μ l with RNase-Free ddH2O, 2-5 μ l is taken to carry out pcr amplification reaction.

Embodiment 3 (intermediate sequence amplification, product recycling, connection and conversion, clone identification)

1. gene intermediate sequence PCR amplification and detection

By searching for and compare a variety of known plants, especially with plant HMGR sequence similar in wheat relationship, find base Because of the highly conserved region of sequence, intermediate sequence amplimer is designed using Primer 5.0, expands the corresponding sequence of wheat hmgr.

Upstream primer mhmgrF1:CGATGGCCGGGAGGAACCTGTACATGAG, nucleotide sequence such as Seq ID Shown in No.3,

Downstream primer mhmgrR1:CACCACCAACTGTGCCCACCTCAAT, nucleotide sequence such as Seq ID No.4 institute Show.

PCR system is 50ul, and component is as follows:

PCR program is 95 DEG C of initial denaturations 5min, 95 DEG C of denaturation 30sec, 63 DEG C of annealing 30sec, 72 DEG C of extension 35s, totally 38 A circulation, 72 DEG C of extension 8min.

The detection of 1.0% agarose gel electrophoresis, 25 μ l pcr amplification products and 5 μ 6 × Loading of l Buffer are mixed, Sample holes, 100V pressure stabilizing electrophoresis 40min, ultraviolet gel imaging system observation and film recording are all clicked and entered, as a result such as Fig. 2 institute Show.

2. the recycling of amplified production

[1] (adsorption column is put into collecting pipe) is added 450 μ l equilibrium liquid BL in adsorption column CB2, and 13,000rpm (13,400 × g) centrifugation 1min, outwells the waste liquid in collecting pipe, adsorption column is placed back in collecting pipe.(processed column on the day of use Son)

[2] single target DNA band is cut from Ago-Gel (excision redundance as far as possible) be put into it is clean In centrifuge tube, weight is weighed.

[3] be added into blob of viscose equimultiple bulk solution PC (if gel weight is 0.1g, volume can be considered 100 μ l, then plus Enter 100 μ l PC solution), 10min or so is placed in 50 DEG C of water-baths, constantly centrifuge tube is leniently spun upside down therebetween, to ensure blob of viscose Sufficiently dissolution.

[4] previous step acquired solution is added in an adsorption column CB2 (adsorption column is put into collecting pipe), 13,000rpm (13,400 × g) is centrifuged 1min, outwells waste liquid in collecting pipe, adsorption column CB2 is put into collecting pipe.

[5] it is added 600 μ l rinsing liquid PW (dehydrated alcohol has been added using preceding first check whether) into adsorption column CB2,13, 000rpm (13,400 × g) is centrifuged 1min, outwells the waste liquid in collecting pipe, adsorption column CB2 is put into collecting pipe.

[6] repetitive operation step 5.

[7] adsorption column CB2 is put into collecting pipe, 13,000rpm (13,400 × g) are centrifuged 2min, remove rinsing as far as possible Liquid.Adsorption column is placed in and is placed at room temperature for several minutes, is thoroughly dried.

[8] adsorption column CB2 is put into a clean centrifuge tube, suitable elution is vacantly added dropwise to adsorbed film middle position Buffer EB, is placed at room temperature for 2min.13,000rpm (13,400 × g) are centrifuged 2min, collect DNA solution, -20 DEG C save backup.

The connection and conversion of 3.PCR product

According to the concentration of recycling segment, determine between product and pEASY-Blunt Simple Cloning Vector Ratio.It is as follows to connect step of converting:

[1] 4 μ l recycling DNA product and 1 μ l carrier are added in the EP pipe of 200 μ l, mixes gently.

[2] 25 DEG C of incubation 10min, are placed on ice.

[3] plus connection product (adds in 50 μ l E.coli DH5 α competent cells when competent cell just thaws Enter connection product), flick mixing, ice bath 20-30min.

[4] 42 DEG C heat shock 90 seconds, be immediately placed on 2min on ice.

[5] add LB, 160rpm, 37 DEG C of incubation 1h of 1ml antibiotic-free.

[6] 6000rpm is centrifuged 3min, discards part supernatant, retains 100-150 μ l, flicks suspension thalline, take whole bacterium solutions Coated plate, 37 DEG C of overnight incubations.

4. the identification of positive colony

20 μ l of thallus PCR system is prepared, component is as follows:

Edge clear, full 10 round and smooth colonies are chosen, chooses in 1ml LB culture medium, carries out number, it is corresponding It clicks and enters in PCR system.

PCR reaction condition: 94 DEG C of initial denaturation 10min (lytic cell inactivates nuclease), 94 DEG C are denaturalized 30 seconds, and 55 DEG C are moved back Fire 30 seconds, 72 DEG C of extension 1min, 35 recycle, and extend 10min after 72 DEG C.

1.0% agarose gel electrophoresis detects positive colony: carrying out DNA sequencing to positive transformant.Utilize DNAStar journey SeqMan software in sequence packet analyzes sequencing result, proves that sequence dna fragment obtained is wheat by comparing The middle section of HMGR gene.

Embodiment 4 (RACE technology obtains 5' and 3' end sequence)

1.RACE design of primers

According to the intermediate sequence of wheat TaHMGR gene obtained, 5'RACE and 3'RACE is designed using Primer 5.0 Specific primer.

5'RACE primer:

First round mhmgrR1:5'CACCACCAACTGTGCCCACCTCAAT 3', nucleotide sequence such as Seq ID Shown in No.5；

Second wheel hmgrCR11:5'GTCAGGGAAGTCATCCTGGAGGTAAT 3', nucleotide sequence such as Seq ID Shown in No.6；

3'RACE primer:

MhmgrF1:5'CGATGGCCGGGAGGAACCTGTACATGAG 3', nucleotide sequence such as Seq ID No.7 institute Show；

The first chain of 2.cDNA synthesizes

[1] micro centrifugal pipe for preparing two RNA free is separately added into following reagent:

(1) 5'-RACE-Ready cDNA is synthesized

RNA 1-2.75μl

5'-CDS Primer A

(2) 3'-RACE-Ready cDNA is synthesized

RNA 1-3.75μl

3'-CDS Primer A

[2] it is separately added into distilled water into two micro centrifugal pipes of step 1, so that 5'-RACE-Ready cDNA is whole Volume is 3.75 μ l, and 3'-RACE-Ready cDNA final volume is 4.75 μ l.

[3] it is uniformly mixed, micro- centrifugation.

[4] 72 DEG C are put into PCR instrument, and then 42 DEG C, 2min of 3min, 13000rpm is centrifuged 10sec after cooling, will own Group is separated to tube bottom.

[5] 1 μ l SMARTer IIA oligo is added into 5'-RACE-Ready cDNA system.

[6] following reagent is added into two pipes respectively:

[7] it is mixed gently with pipettor, tube bottom is arrived in centrifugation.

[8] 42 DEG C in PCR instrument, be incubated for 90min, then 70 DEG C, 10min.

[9] it is spare that the dilution of 100 μ l Tricine-EDTA buffers is added, -20 DEG C can be reserved for three months.

3.RACE rapid amplifying 5' and 3' terminal sequence

[1] 5' terminal sequence is obtained by nest-type PRC

(1) 20 μ l system of first round 5'RACE PCR, component are as follows:

PCR program is 95 DEG C of initial denaturations 5min, 95 DEG C of denaturation 30sec, 65 DEG C of annealing 30sec, 72 DEG C of extension 2min, totally 30 A circulation, 72 DEG C of extension 8min, 16 DEG C of heat preservations.

(2) second wheel 5'RACE pcr templates are first round PCR product, and 20 μ lPCR systems, component is as follows:

PCR program is 95 DEG C of initial denaturations 5min, 95 DEG C of denaturation 30sec, 65 DEG C of annealing 30sec, 72 DEG C of extension 2min, totally 35 A circulation, 72 DEG C of extension 8min, 16 DEG C of heat preservations,

Note: UPM and NUP is included for kit in primer employed in upper table.

[2] PCR amplification of 3' terminal sequence

50 μ lPCR systems, component are as follows:

PCR program is 95 DEG C of initial denaturations 5min, 95 DEG C of denaturation 30sec, 63 DEG C of annealing 30sec, 72 DEG C of extension 2min, totally 35 A circulation, 72 DEG C of extension 8min, 16 DEG C of heat preservations

Note: UPM is included for kit in primer employed in upper table.

The PCR product of acquisition is detected through 1.0% agarose gel electrophoresis, and is taken a picture, as a result as shown in Figure 3, Figure 4.

The recycling of 4.RACE PCR product glue, connection, conversion, positive clone identification and sequencing

Step is the same as step 2,3 and 4 in embodiment 3.

Embodiment 5 (amplification of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene full length sequence)

1. the design of full length gene primer

Root play 5' terminal sequence and 3' terminal sequence design overall length primer using Primer 5.0.

Upstream primer sequence hmgr-QCF45'GTTTGACTCCGACGCGCAC 3', nucleotide sequence such as Seq ID Shown in No.8；

Downstream primer sequence hmgr-QCR15'GCTTCCTGAAGCAAGGAGAG 3', nucleotide sequence such as Seq ID Shown in No.9；

2. Jimai 22TaHMGR full length gene expands

20 μ lPCR systems, component are as follows:

PCR program is 95 DEG C of initial denaturations 5min, 95 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 2min, totally 38 A circulation, 72 DEG C of extension 8min, 16 DEG C of heat preservations.

The PCR product of acquisition is detected through 1.0% agarose gel electrophoresis, and is taken a picture, as a result as shown in Figure 5.

3. the recycling of wheat TaHMGR full length gene PCR product glue, connection, conversion, positive clone identification and sequencing

Step is the same as step 2,3 and 4 in embodiment 3.

Embodiment 6 (building of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene catalysis region expression vector)

1. the design of wheat TaHMGR gene catalysis region amplimer

On the basis of wheat TaHMGR full length gene sequence, catalytic domain expression primer is designed, from overall length open reading frame The 138th amino acid of sequence starts, and introduces former and later two restriction enzyme sites of Sal1 and HindIII.

Hmgr-PrF:

5'CGCGCGTCGACAGGAGGAATTTAAAATGAGAGGATCGCATCATCACCACCATCACGTGCCCGAGAA AATGCCCGA3', nucleotide sequence is as shown in Seq ID No.10；

Hmgr-PrR:5'CTGCAGAAGCTTTCAAGAACTTAGAGATGCGG 3', nucleotide sequence such as Seq ID Shown in No.11.

2. the PCR amplification of wheat TaHMGR catalysis region

It is carried out using the full length sequence being connected on plasmid pEASY-Blunt Simple Cloning Vector as template PCR amplification.Recombinant plasmid is named as pLM1-TaHMGRcd, and amplification program is as follows.

20 μ lPCR systems, component are as follows:

PCR program is 95 DEG C of initial denaturations 5min, 95 DEG C of denaturation 30sec, 60 DEG C of annealing 30sec, 72 DEG C of extension 1min 20sec, totally 38 recycle, 72 DEG C of extension 8min, 16 DEG C of heat preservations.

The PCR product of acquisition is detected through 1.0% agarose gel electrophoresis, and is taken a picture, as a result as shown in Figure 6.

3. gel extraction target stripe, digestion recovery product and expression plasmid

Digestion system is as follows, 15 μ l of expression plasmid pLM1 digestion system.

20 μ l of wheat TaHMGR catalysis region pcr amplification product digestion system.

4. connecting construction of expression vector pLM1-TaHMGRcd

According to the concentration for recycling segment after digestion, determine that the ratio between product and pLM1 carrier, linked system are as follows.

16 DEG C of connections are overnight.

5. the pLM1-TaHMGRcd connected conversion is entered DH5 α competent cell

Referring to the step 3 and 4 in embodiment 3, choose positive clone molecule, expand culture, extract plasmid and carry out digestion and Sequencing identification, as a result as shown in fig. 7, wherein the 2nd swimming lane is pLM1-HMGRcd recombinant plasmid, it can be seen that there is multiple plasmid structures Type；3rd swimming lane is that the recombinant plasmid of Sal1 and HindIII double digestion has cut out other than the recombinant plasmid not cut completely through Target gene fragment TaHMGRcd and plasmid vector part；4th and the 5th swimming lane is respectively Sal1, HindIII single endonuclease digestion recombination matter Grain electrophoretogram indicates that recombinant plasmid can be cut by Sal1 and HindIII restriction enzyme respectively, thus proves, purpose base Because having been attached on expression vector plasmid pLM1.

Embodiment 7 (building of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene mutant)

1. the design of mutant primer

According to the conserved region plants HMG such as rice, sorghum, corn, two fringe false bromegrass and arabidopsis and its surrounding amino acid Difference, design rite-directed mutagenesis primer, by amino acid residue 61Q, 93I, 102Q, 138R, 213I, 223Y, 229P, 336A, 339D, 379N and 382S, sports 61D, 61E, 93V, 102E, 102R, 138Q, 213V, 223F, 229H, 336P, 339A, 379S respectively And 382R.The upstream and downstream primer of mutant respectively as shown in nucleotide sequence Seq ID No.12-37,

2.PCR amplification obtains mutant sequence

PCR amplification is carried out by template of recombinant plasmid pLM1-TaHMGRcd, 50 μ l of amplification system, component is as follows.

It is slightly centrifuged, 5 μ l mineral oil is added, prevent moisture from evaporating.

PCR program is 95 DEG C of initial denaturations 3min, 95 DEG C of denaturation 45sec, 60 DEG C of annealing 30sec, 72 DEG C of extension 12min, is total to 15 circulations, 72 DEG C of extension 10min, 16 DEG C of heat preservations.

3. mutant sequence purifying, conversion, positive clone identification

[1] PCR product is transferred in another new EP pipe, 5 μ l 10 × Fastdigest Green Buffer is added It is uniformly mixed with 1 μ l DpnI, 37 are incubated for 3h.

[2] in the DNA mixture after I digestion of Xiang Shangshu Dpn, isometric 55 μ l of chloroform is added, vortex oscillation mixes, 12000rpm is centrifuged 5min.

[3] supernatant liquid after layering is transferred in a new 1.5mL centrifuge tube, be added 1/3 volume NH4Cl and 8/3 volume dehydrated alcohol, concussion mix.12000rpm is centrifuged 10min.

[4] supernatant is outwelled, is rinsed with the ethyl alcohol of 70 ﹪, 12000rpm is centrifuged 5min.

[5] supernatant is outwelled, room temperature is dried, and 10 μ l water is added to dissolve bottom precipitation.

The step 3 and 4 in embodiment 3 is shown in conversion with positive clone molecule identification.

(the protokaryon table of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene wild type and mutant of embodiment 8 Up to)

1. by wild type recombinant plasmid, mutant Transformed E .Coli BL21 (DE3) express competent cell, step referring to Step 3 in embodiment 3.

It cultivates 2. couple E.Coli BL21 (DE3) containing recombinant plasmid expands and TaHMGR is induced to express

[1] BL21 (DE3) strain for being transformed into pLM1-TaHMGRcd recombinant plasmid is inoculated into the LB culture medium (Amp of 20ml Concentration is 100mg/ml) in, 37 DEG C, 160rpm is incubated overnight.

[2] bacterium solution for taking 10ml to be incubated overnight is added in 500ml LB culture solution (Amp concentration is 100mg/ml).37℃, When 160rpm shaking table culture 2.5-3h to thallus OD600=0.8, it is added IPTG (final concentration of 1.5mM).

[3] 37 DEG C of culture 6-8h or ambient temperature overnight culture.

[4] 6000r/min is centrifuged 10min, collects thallus, rinses thallus, 6000r/min centrifugation with 100ml deionized water 10min collects thallus.

3. the purifying of albumen

[1] 40mL start buffer (Start buffer) is added and thallus is resuspended.

[2] 5mg lysozyme, 37 DEG C of water-bath lh are added.

[3] in -80 DEG C of placement at least lh.

[4] 30 DEG C of water-baths are thawed.

[5] sonicated cells 1h (broken 5s, be spaced 10s).

[6] 9000r is centrifuged 10min, and supernatant is used for protein purification.

[7] Ni-Trap column is connected with 0.45 μm of filter, and syringe draws a drop one in 5mL aqua sterilisa injection column Drop ground excludes the ethyl alcohol in column.

[8] it takes the 0.1M nickel sulfate of 3-5mL to inject in column again, washes off the nickel ion being not bound with 5mL deionized water, so It is balanced afterwards with the start buffer (Start buffer) of 5mL.

[9] in the supernatant injection column after taking 20mL to be centrifuged.

[10] column is washed with 5mL start buffer (Start buffer).

[11] column is washed with 8mL dcq buffer liquid (Wash buffer).

[12] destination protein is dissolved with the elution buffer (Elution buffer) of 5mL, and is connect with 1.5mL centrifuge tube Sample, every 1mL mono- are managed.

4.SDS-PAGE electrophoresis detection protein

[1] separation gel is prepared:

Deionized water 2.5ml

30%Arc-Bis mother liquor 3.35ml

1.5M Tris-HCl(pH8.8) 2ml

80 μ l of 10%SDS

80 μ l of 10%AP

TEMED 3.5μl

[2] concentration glue is prepared:

Deionized water 1.7ml

420 μ l of 30%Arc-Bis mother liquor

1M Tris-HCl(pH6.7) 320μl

25 μ l of 10%SDS

25 μ l of 10%AP

TEMED 3μl

[3] protein sample is mixed with 2 × SDS albumen sample-loading buffer 1:1, and 100 DEG C are boiled 5min.It is heavy after ultrasound centrifugation It forms sediment, the dissolution of 2ml 8M/L urea is added, 100 DEG C of isometric sample-loading buffer is added and boils 5min.

[4] separation gel 8ml is prepared, is added after TEMED and mixes (being careful not to blow afloat bubble) with 1ml pipettor, exist rapidly Separation gel is perfused in the gap of two glass plates, then adds 1-2ml deionized water on it, sky needed for reserving perfusion concentration glue Between, about 1.0cm；After separation gel polymerization completely, coating liquid is poured out, is washed with deionized at the top of gel for several times, to remove Remove unpolymerized acrylamide gel.

[5] concentration glue 2.5ml is prepared, is uniformly mixed after TEMED is added, perfusion concentration glue, insertion are clean on separation gel Comb；After polymerization completely, gel is fixed on electrophoretic apparatus, Tris- glycine running buffer is respectively added in upper and lower slot, excludes Bubble between glass plate, carefully pulls out comb.

[6] ready sample is added in a predetermined order.80V constant pressure becomes 120V when running to separation gel, and to be instructed dose Stop electrophoresis when moving to bottom.

[7] gel is taken out, Coomassie brilliant blue dye liquor is added, gel is impregnated with the dye liquor of about 5 times of volumes, is placed on gentle shake Platform on, in room temperature dye 3-5h.

[8] it removes and recycles dye liquor for future use, by soak in destainer, gently shake 4-8h, it therebetween should be more Destainer is changed 3-4 times, as a result as shown in Figure 8 and Figure 9, from the swimming lane 2 and 3 of Fig. 8 as can be seen that have been obtained for purity higher Wild type HMGR zymoprotein can be seen that 13 mutant zymoproteins obtained and swimming from the swimming lane 2-7 and swimming lane 9-15 of Fig. 9 The wild-type enzyme albumen in road 1 is the same, and purity is very high, can be used for enzyme dynamics.

5. the dialysis of purifying protein

The zymoprotein of purifying is placed in bag filter, clamps bag filter both ends with sealing clip, appropriate egg is added in large beaker White dialyzate (guaranteeing that bag filter can suspend), is put into rotor, is placed in 4 DEG C of dialysis 20h on magnetic stirring apparatus, control rotor Rotation speed should not be too fast, centre replacement dialyzate 3 times.Albumen after collecting dialysis, it is spare to be put in -80 DEG C of ultra low temperature freezers.

Embodiment 9 (survey by wild type, mutant wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase kinetic parameter It is fixed)

1. the measurement of zymoprotein concentration

Referring to the operation instruction of Bradford determination of protein concentration kit, the protein standard for preparing series of concentrations gradient is molten Liquid: 0,100 μ l are added in each test tube in 50mg/ml, 100mg/ml, 200mg/ml, 300mg/ml, 400mg/ml, 500mg/ml Protein standard liquid and 3ml Bradford reagent, in being stored at room temperature 15min.

Using the absorbance A 595 at DU800 ultraviolet specrophotometer measurement 595nm, and standard curve is drawn, according to this Standard curve determination sample protein concentration.

2. external enzymatic reaction

Reaction system 1ml, Vmax and K of the measurement enzyme to a kind of substrate_MWhen, to fix another concentration of substrate.

[1] Vmax and K of the measurement enzyme to NADPH_MValue

(1) 5 disposable cuvettes are taken, potassium phosphate (500mML is added in label 1-5 into each cuvette respectively^-1, PH7.5) 10 μ l, HMGRcd albumen x μ l (10 μ g albumen are added according to the adjustment of protein concentration difference obtained by purification and recovery).

(2) No. 1 cuvettes add substrate NADPH (10mML^-1) 1 μ l makes its final concentration of 10 μM of L-¹, No. 2 cuvettes add 2 μ l make its final concentration of 20 μM of L^-1, No. 3 cuvettes add 4 μ l to make its final concentration of 40 μM of L^-1, No. 4 cuvettes add 6 μ l to make Its final concentration of 60 μM of L^-1, No. 5 cuvettes add 8 μ l to make its final concentration of 80 μM of L^-1.Water is added to supply to 985 μ l, mixing is It is even, stand 1min.

(3) 150 μM of L of the final concentration of immobilized substrate HMG-CoA^-1, it is eventually adding substrate HMG-CoA (10mML^-1)15μ L starting reaction, is added HMG-CoA and rises, and starts timing 30s, and be uniformly mixed rapidly and (paid attention in mixed process with 1ml pipettor Pipette tips are always to prevent generation bubble below liquid level), the time starts to detect when ending.

(4) ultraviolet specrophotometer (DU-800) of preheating is used, substrate NADPH is at 340nm in detection reaction mixture The reduction amount that light absorption value changes over time continuously monitors 120s, the variation and the relationship of time of analysis enzymatic reaction speed, record 5 data of lower acquisition.According to meeh's formula y=ax/ (b+x), and sigmaplot 12.0 is utilized, calculates HMGRcd the bottom of to The Vmax and K of object NADPH_MValue (reaction carries out at room temperature).

[2] Vmax and K of the measurement enzyme to HMG-CoA_MValue

Enzyme is measured to the Vmax and K of substrate HMG-CoA_MThe method of value is substantially same as above, and needs that immobilized substrate NADPH's is dense herein Spend 300 μM of L^-1.HMG-CoA (10 μM of L are separately added into 1-5 cuvette^-1) volume be 10 μ l, 30 μ l, 50 μ l, 70 μ L, 90 μ l is equally started with HMG-CoA and is reacted.According to meeh's formula y=ax/ (b+x), 5 data input sigmaplot are obtained 12.0, calculate relevant enzyme kinetic parameter.

The wild type 3- hydroxy-3-methyl glutaryl coenzyme obtained from wheat breed " Jimai 22 " clone is measured as the result is shown K of the A reductase to substrate NADPH and HMG-COA_MValue is respectively 41.3 ± 4.2 and 39.5 ± 4.6mM；Vmax is respectively 0.08 ± 0.00 and 0.09 ± 0.00mmol/min/mg；Kcat is respectively 0.15 ± 0.01 and 0.16 ± 0.01S^-1；Kcat/K_MRespectively It is 3.63 × 10³With 4.05 × 10³M^-1S^-1, thus prove the wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase base of clone Because having the function of native biological.13 wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene mutant pair are measured The enzyme kinetics parameter of substrate NADPH and HMG-COA see the table below, and show through the change to amino acid codes, can be significant Increase or decrease the catalytic activity of enzyme.

Wheat HMGR mutant enzyme kinetic parameter

In upper table, for substrate NADPH, the K of mutant Y223F, Q102R and D339A_MValue is than the K of wild type_MValue It is substantially reduced, illustrates that mutant greatly improves the affinity of NADPH, the Vmax value ratio of mutant Q61D, I213V and P229H Wild type dramatically increases.

For HMG-CoA, mutant D339A, Q102E and Q102R also greatly propose the affinity of substrate than wild type The maximum reaction rate Vmax value of height, mutant Q61D, I213V and P229H is greatly increased than wild type.

Kcat and Kcat/K_MThe height of enzymatic efficiency is represented, as seen from table mutant I93V, I213V and P229H couple The Kcat value of NADPH is 32 times, 6 times and 5.7 times of wild type, Kcat/K respectively_MValue is 30.9 times of wild type, 7.6 respectively Times and 7.1 times, be 32 times, 7.1 times and 7.3 times of wild type, Kcat/K respectively to the Kcat value of HMG-CoA_MValue is wild respectively 32.1 times, 5.4 times and 4.5 times of raw type.

Through the above, inventor has found mutant higher for the enzymatic activity of acquisition, passes through transgenosis skill Art makes it into recipient plant, and the content of mevalonic acid metabolic pathway downstream secondary metabolite can be improved, can such as mention The content of the isoprenoids substance such as high ginsenoside, and then the yield etc. of crop may be influenced；Enzymatic activity is reduced Mutant, can according to research and production be actually needed, if made it into recipient plant by transgenic technology, can subtract The accretion rate of slow controlled metabolic pathway.

Claims (1)

1. wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase geneTaHMGRIn site-directed point mutation, building 3- hydroxyl- The eukaryotic gene expression vector of 3- methylglutaryl A reductase gene simultaneously converts the application on corresponding crop, special Sign is: the wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase geneTaHMGR,Encode region nucleotide sequence such as Shown in Seq ID No.1, the amino acid sequence of coding is as shown in Seq ID No.2；The wheat 3- hydroxy-3-methyl penta 2 The method of the rite-directed mutagenesis of acyl coenzyme A reductase gene codon, the specific steps are as follows:

The design of 1.1 codon mutation primers

The upstream and downstream primer of mutant is respectively as follows:

I93VF:CGTGGGCGTCGCCGGGCCGC, nucleotide sequence is as shown in Seq ID No.16, I93VR: GCGGCCCGGCGACGCCCACG, for nucleotide sequence as shown in Seq ID No.17, codon sports GTC by ATC；

The PCR amplification of 1.2 mutant

It is with the wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene catalytic domain wild type expression vector plasmid of building DNA profiling, suitable annealing temperature carry out PCR amplification；

Conversion, the sequencing of 1.3 mutant pcr amplification products

Template plasmid DNA is removed with Dpn1 restriction enzyme, converts escherichia coli DH5a, extract Plasmid DNA and determination is sequenced Mutational site；Positive colony is transformed into expression bacterial strain, protein expression is carried out.