CN105112430A - Wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase (TaHMGR) gene, isolation and cloning method thereof, site-specific mutagenesis method thereof and enzyme function detection method thereof - Google Patents

Abstract

The invention belongs to the field of molecular biology, and relates to an isolation and cloning, gene site-specific mutagenesis, zymoprotein prokaryotic expression, zymoprotein separation and purification, and enzymatic activity detection technology for a first key enzyme gene participating in isoprenoid substance synthesis in wheat mevalonic acid metabolic pathways. Important technical reserves are provided for further carrying out gene modification and augmentation, constructing eukaryotic genetic expression vectors of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR) genes and converting corresponding products, and are particularly provided for obtaining plants with the high commercial value through secondary metabolism, discussing the relationship between overexpression of the HMGR genes in the receiver plants and important economical characters such as secondary metabolism products, the crop grain size and the grain weight, then increasing the crop yield, analyzing the structures of introns, exons and promoters of the HMGR genes, researching the functions of the promoters and developing related molecular markers.

Description

The detection method of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene TaHMGR and separating clone, rite-directed mutagenesis and enzyme function

Technical field

The invention belongs to biology field, relate to and a kind ofly participate in first key gene wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene TaHMGR of the synthesis of isoprenoid material in wheat mevalonic acid pathways metabolism and the detection method of separating clone, rite-directed mutagenesis and enzyme function thereof.

Background technology

The necessary important substance such as isoprenoid material is maintenance growth and development of plants, photosynthesis, electron transmission, response environment are coerced.Such material can be used as photosynthetic pigments (as chlorophyll, carotenoid), growth substance and plant hormone (as phytokinin, dormin, Plant hormones regulators,gibberellins and brassinolide), membrane structure a part as Sitosterol, electron transmission acceptor as plastoquinone, as the acceptor of glucose in glucosyl reaction as dolichol, and the growth (as prenyl protein, phytokinin) of energy regulating cell.In addition, a lot of plant isoprenoid also has important commercial value if rubber, flavorant, beverage, vitamin A. D. E and natural insecticide are as pyrethrin etc.

Isoprenoid material is mainly through a series of Enzyme catalyzed synthesis in mevalonate pathway, and wherein in this pathways metabolism, first key enzyme is 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme (HMGR; EC1.1.1.34), be one of rate-limiting enzyme controlling pathways metabolism.This enzyme utilizes NADPH, 3-hydroxy-3-methylglutaryl-coenzyme A is changed into mesostate mevalonic acid.From 80 various plants such as Arabidopis thaliana, tomato, Para rubber tree, Vinca, potato, separating clone is out for current HMGR gene.But in prior art also open or delivered about from wheat breed " Jimai 22 " or from other wheat breed the research data information such as the separation and purification of the complete 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene of separating clone, site-directed point mutation, gene prokaryotic, zymoprotein and enzyme function vitro detection thereof, be therefore necessary to carry out its related application of deep research and development to it.

Summary of the invention

For above-mentioned situation of the prior art, the present inventor provide a kind of participate in first key gene of the synthesis of isoprenoid material in wheat mevalonic acid pathways metabolism separating clone, site-directed point mutation, the prokaryotic expression of zymoprotein, the separation and purification of zymoprotein and Enzyme assay technology.For carrying out genetic modification and modification further, build the eukaryotic gene expression vector of 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene and transform corresponding crop, especially the plant of important commercial value is obtained by secondary metabolism, inquire into overexpression in recipient plant of 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene and secondary metabolite, the relation of crop kernel size and the grain Main Agronomic Characters such as heavily, and then raising crop yield, and to 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene intron, exon and promoter structure dissect, research promoter function, develop relevant molecule marker and important technology deposit is provided, particularly can improve by changing specific amino acid codons or reduce the catalytic activity of enzyme.

The present invention clones the wild-type 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme of acquisition to the K of substrate NADPH and HMG-COA from wheat breed " Jimai 22 " _mvalue is respectively 41.3 ± 4.2 and 39.5 ± 4.6mM; Vmax is respectively 0.08 ± 0.00 and 0.09 ± 0.00mmol/min/mg; Kcat is respectively 0.15 ± 0.01 and 0.16 ± 0.01S ^-1; Kcat/K _mbe respectively 3.63 × 10 ³with 4.05 × 10 ³m ^-1s ^-1, prove that the wild-type wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene of cloning has native biological function thus.13 mutant of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene are recorded to the enzyme kinetics parameter of substrate NADPH and HMG-COA, result shows, by the change to specific amino acid codons, can significantly improve or reduce the catalytic activity of enzyme.

Wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene TaHMGR provided by the invention, its coding region nucleotide sequence is as shown in SeqIDNo.1, and the aminoacid sequence of its coding is as shown in SeqIDNo.2.

Above-mentioned wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene cDNA overall length is 2371bp, its open reading frame (ORF) length is 1674bp, from the ATG being positioned at the 112nd, terminate to the TGA of the 1785th, coding 557 amino-acid residues altogether, 5' non-coding region, its upstream (UTR) length is 111bp, 3' non-coding region, downstream (UTR) length reaches 586bp, this gene coded protein molecular weight is about 59.0kD, and iso-electric point (PI) is 6.99.Through SMART software, the on-line analysis of wheat HMGR aminoacid sequence is shown, there are two sections of trans-membrane region between HMGR protein sequence the 34th to 53 amino acids and between the 74th to 96 amino acids, is the positions at place, soluble catalyst region from 165 to 544 amino acids;

The present inventor provides the concrete separating clone method of this gene, the method for site-directed point mutation and prokaryotic expression and enzyme Function detection is:

1. the separation and Extraction of Jimai 22 blade RNA

Specification sheets according to Trizol test kit carries out.The RNA obtained is kept in DEPC water for subsequent use.

2. the synthesis of the first chain cDNA

Carry out according to Takara Reverse Transcription box specification sheets.

3. gene intermediate sequence amplification, connection and conversion

By searching and the multiple known plants of comparison, especially close with wheat relationship plant HMGR sequence, finds gene order high conservative region, utilizes Primer5.0 to design intermediate sequence amplimer, the corresponding sequence of amplification wheat hmgr.Upstream primer mhmgrF1:5'CGATGGCCGGGAGGAACCTGTACATGAG3', its nucleotide sequence is as shown in SeqIDNo.3, and downstream primer mhmgrR1:5'CACCACCAACTGTGCCCACCTCAAT3', its nucleotide sequence is as shown in SeqIDNo.4.Carry out PCR according to certain condition, utilize DNA glue to reclaim test kit and reclaim 485bp specific band.

The DNA fragmentation of recovery is connected with pGEM-TEasy carrier.Utilize heat shock method transformation of E. coli DH5 α, picking positive colony, extract plasmid DNA and check order, obtain goal gene fragment by NCBI comparison.

4. utilize RACE technology to obtain gene end sequences fast

4.1 gene end sequences rapid amplifyings

According to the gene intermediate sequence of obtained 485bp, utilize 5'RACE primer: first round mhmgrR1:5'CACCACCAACTGTGCCCACCTCAAT3', its nucleotide sequence is as shown in SeqIDNo.5; Second takes turns hmgrCR11:5'GTCAGGGAAGTCATCCTGGAGGTAAT3', and its nucleotide sequence is as shown in SeqIDNo.6; 3'RACE primer mhmgrF1:5'CGATGGCCGGGAGGAACCTGTACATGAG3', its nucleotide sequence is as shown in SeqIDNo.7.

According to 5' and the 3' end of the method rapid amplifying gene of the SMARTTmRACEcDNAAmplificationkit of ClontechLaboratoriesINC, screening recon, and check order.

4.2 gene intermediate sequences and RACE sequence use ContigExpress9.1 to splice full length sequence, then manually proofread the contig sequence of gained.

The amplification of 5 full length gene sequences

The design of 5.1 full length gene primers

According to intermediate sequence and RACE sequence contig result, design total length amplimer.

Upstream primer sequence is hmgr-QCF45'GTTTGACTCCGACGCGCAC3', and its nucleotide sequence is as shown in SeqIDNo.8;

Downstream primer sequence is hmgr-QCR15'GCTTCCTGAAGCAAGGAGAG3', and its nucleotide sequence is as shown in SeqIDNo.9.

The pcr amplification of 5.2 full-length genes

With the first chain cDNA for template amplification total length goal gene, carry out the glue recovery of full-length gene PCR primer, connection, conversion, the detection of PCR recon, plasmid extraction and order-checking, acquisition full length sequence is 2371bp, and its nucleotide sequence is as shown in SeqIDNo.1.

The prokaryotic expression in 6 gene catalyzes districts

6.1 gene catalyzes district prokaryotic expression design of primers

According to gained full length sequence sequencing result, utilize software that the gene order of gained is translated into aminoacid sequence (aminoacid sequence as shown in SeqIDNo.2), then compare with NCBI known organism 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme aminoacid sequence, determine the ORF of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene.Two sections of trans-membrane region due to wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme do not participate in the catalysis of enzyme, but the precipitation of zymoprotein during prokaryotic expression can be caused, therefore on the basis of wheat TaHMGR full length sequence, from total length open reading frame sequence the 138th amino acid, the catalytic domain of design 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene expresses primer.Hold at the 5' of gene, design is with 7 amino acid codes primer hmgr-PrF:5'CGCGCGTCGACAGGAGGAATTTAAAATGAGAGGATCGCATCATCA CCACCATCACGTGCCCGAGAAAATGCCCGA3' in ribosome bind site (AGGAGGA), restriction enzyme Sal1 restriction enzyme site, initiator codon, 6 Mstidine codon and 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene, and its nucleotide sequence is as shown in SeqIDNo.10; Hold at the 3' of gene, design has restriction enzyme HindIII restriction enzyme site, terminator codon (TAG) and contains the amino acid whose primer hmgr-PrR:5'CTGCAGAAGCTTTCAAGAACTTAGAGATGCGG3' of coding 6, and its nucleotide sequence is as shown in SeqIDNo.11.

The structure of 6.2 prokaryotic expression vectors

The enzyme mainly comprising gene prokaryotic sequence pcr amplification product is cut, the connection of digestion products and carrier pLM1, conversion, PCR and enzyme are cut and identified positive colony recon, extraction of plasmid DNA and sequence verification.

The rite-directed mutagenesis of 7 wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene codons

The design of 7.1 codon mutation primers

Found by amino acid alignment, in wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme conserved regions, 61Q, 93I, 102Q, 138R, 213I, 223Y, 229P, 336A, 339D, 379N are different from other plant with position amino acid such as 382S, for inquiring into the impact of these amino-acid residues on enzymatic activity, it is sported 61D, 61E, 93V, 102E, 102R, 138Q, 213V, 223F, 229H, 336P, 339A, 379S and 382R respectively.The upstream and downstream primer of mutant is respectively:

Q61DF:CACGGGGAGGGATTTCGAGGGTC, its nucleotide sequence as shown in SeqIDNo.12, Q61DR:GACCCTCGAAATCCCTCCCCGTG, its nucleotide sequence is as shown in SeqIDNo.13, and codon sports GAT by CAG;

Q61EF:CACGGGGAGGGAGTTCGAGGGTC, its nucleotide sequence as shown in SeqIDNo.14, Q61ER:GACCCTCGAACTCCCTCCCCGTG, its nucleotide sequence is as shown in SeqIDNo.15, and codon sports GAG by CAG;

I93VF:CGTGGGCGTCGCCGGGCCGC, its nucleotide sequence as shown in SeqIDNo.16, I93VR:GCGGCCCGGCGACGCCCACG, its nucleotide sequence is as shown in SeqIDNo.17, and codon sports GTC by ATC;

Q102RF:CTCGACGGCAGGCGGTTCTAC, its nucleotide sequence as shown in SeqIDNo.18, Q102RR:GTAGAACCGCCTGCCGTCGAG, its nucleotide sequence is as shown in SeqIDNo.19, and codon sports AGG by CAG;

Q102EF:CTCGACGGCGAGCGGTTCTAC, its nucleotide sequence as shown in SeqIDNo.20, Q102ER:GTAGAACCGCTCGCCGTCGAG, its nucleotide sequence is as shown in SeqIDNo.21, and codon sports GAG by CAG;

R138QF:GTTGTGCTCCAGGACGCGATGAC, its nucleotide sequence as shown in SeqIDNo.22, R138QR:GTCATCGCGTCCTGGAGCACAAC, its nucleotide sequence is as shown in SeqIDNo.23, and codon sports CAG by CGG;

I213VF:GAACATGGTCTCCAAGGGCGTG, its nucleotide sequence as shown in SeqIDNo.24, I213VR:CACGCCCTTGGAGACCATGTTC, its nucleotide sequence is as shown in SeqIDNo.25, and codon sports GTC by ATC;

Y223FF:GTGCTGGATTTCCTCCAGGATGAC, its nucleotide sequence as shown in SeqIDNo.26, Y223FR:GTCATCCTGGAGGAAATCCAGCAC, its nucleotide sequence is as shown in SeqIDNo.27, and codon sports TTC by TAC;

P229HF:CAGGATGACTTCACTGACATGGATG, its nucleotide sequence as shown in SeqIDNo.28, P229HR:CATCCATGTCAGTGAAGTCATCCTG, its nucleotide sequence is as shown in SeqIDNo.29, and codon sports CAC by CCC;

A336PF:CAATGTTGGAACCTGTAAATGATG, its nucleotide sequence as shown in SeqIDNo.30, A336PR:CATCATTTACAGGTTCCAACATTG, its nucleotide sequence is as shown in SeqIDNo.31, and codon sports CCT by GCT;

D339AF:CTGTAAATGCTGGCAAAGATCTTC, its nucleotide sequence as shown in SeqIDNo.32,3D339AR:GAAGATCTTTGCCAGCATTTACAG, its nucleotide sequence is as shown in SeqIDNo.33, and codon sports GCT by GAT;

N379SF:GAAAGGCGCCAGCAGGGAATCGCCAG, its nucleotide sequence as shown in SeqIDNo.34, N379SR:CTGGCGATTCCCTGCTGGCGCCTTTC, its nucleotide sequence is as shown in SeqIDNo.35, and codon sports AGC by AAC;

S382RF:CAACAGGGAACGGCCAGGATC, its nucleotide sequence is as shown in SeqIDNo.36, and S382RR:GATCCTGGCCGTTCCCTGTTG, its nucleotide sequence is as shown in SeqIDNo.37, and codon sports CGG by TCG.

The pcr amplification of 7.2 mutant

With the wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene catalytic domain wild-type expression vector plasmid built for DNA profiling, suitable annealing temperature, carries out pcr amplification.

The conversion of 7.3 mutant pcr amplification products, order-checking

Remove template plasmid DNA, transformation of E. coli DH5a with Dpn1 restriction enzyme, extract plasmid DNA and check order and determine mutational site.Positive colony is transformed in expression strain, carries out protein expression.

8 wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase genes are expressed

First carry out the optimization of 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme wild-type protein expression condition, comprise the optimization etc. of IPTG concentration, inducing temperature.According to the optimal conditions determined, carry out the great expression of 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme wild-type, mutant protein.

The purifying of 9 wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme wild-types and mutant protein

Utilize ion-exchange column separating purification 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme protein.Cross the protein of column purification, being loaded in dialysis tubing dialyses in certain solution desalts, and the protein of purifying saves backup in-86 DEG C.

10 utilize spectrophotometer, detect the activity of wild-type, mutant 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme.Record and clone the wild-type 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme of acquisition to the K of substrate NADPH and HMG-COA from wheat breed " Jimai 22 " _mvalue is respectively 41.3 ± 4.2 and 39.5 ± 4.6mM; Vmax is respectively 0.08 ± 0.00 and 0.09 ± 0.00mmol/min/mg; Kcat is respectively 0.15 ± 0.01 and 0.16 ± 0.01S ^-1; Kcat/K _mbe respectively 3.63 × 10 ³with 4.05 × 10 ³m ^-1s ^-1, prove that the wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene of cloning has native biological function thus.Record the enzyme kinetics parameter of 13 wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene mutant to substrate NADPH and HMG-COA to see the following form, shown by the change to amino acid codes, can significantly improve or reduce the catalytic activity of enzyme.

Wheat HMGR mutant enzyme kinetic parameter

The present invention is for carry out genetic modification and modification further by site-directed point mutation, build the eukaryotic gene expression vector of 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene and transform corresponding crop, especially the plant of important commercial value is obtained by secondary metabolism, inquire into overexpression in recipient plant of 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene and secondary metabolite, the relation of crop kernel size and the grain Main Agronomic Characters such as heavily, and then raising crop yield, and to 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene intron, exon and promoter structure dissect, research promoter function, develop relevant molecule marker and important technology deposit is provided, particularly can improve by changing specific amino acid codons or reduce the catalytic activity of enzyme.

Accompanying drawing explanation

Fig. 1 is wheat breed " Jimai 22 " seedling RNA electrophorogram;

Fig. 2 is intermediate sequence PCR primer electrophorogram,

In figure, 1-4 is wheat TaHMGR gene intermediate sequence PCR primer, and length is 485bp, and 5 is 100bpDNALadder;

Fig. 3 is wheat TaHMGR gene 5' end sequence rapid amplifying PCR primer electrophorogram,

In figure, 1 is 5' terminal sequence pcr amplification product, and size is 1246bp; 2 is the DNALadder of 1kb;

Fig. 4 is wheat TaHMGR gene 3' end sequence rapid amplifying PCR primer electrophorogram,

In figure, 1 is 3' terminal sequence pcr amplification product, and size is 1349bp; 2 is the DNALadder of 1kb;

Fig. 5 Jimai 22TaHMGR full length gene DNA electrophorogram,

In figure, 1 is Jimai 22TaHMGR full length gene amplified production, and size is 2119bp, is spliced by the fragment sequence that the 5' end fragment sequence obtained and 3' end fragment sequence and total length increase, obtains the complete wheat TaHMGR gene that length is 2371bp; 2 is the DNALadder of 1kb;

Fig. 6 is the PCR primer electrophorogram of wheat TaHMGR gene catalyzes district HMGRcd,

In figure, 1 is the PCR primer of HMGRcd, and size is 1311bp; 2 is the DNALadder of 1kb;

Fig. 7 is pLM1-HMGRcd expression plasmid restriction enzyme digestion and electrophoresis figure,

In figure, 1 is 1kbDNALadder; 2 is pLM1-HMGRcd recombinant plasmid; 3 is Sal1, HindIII double digestion recombinant plasmid; 4-5 is respectively Sal1, HindIII single endonuclease digestion recombinant plasmid;

Fig. 8 is the SDS-PAGE electrophorogram of wheat TaHMGR gene HMGRcd albumen,

In figure, 1-4 is the albumen for wash-out; 5 is protein molecular weight standard;

Fig. 9 is the SDS-PAGE electrophorogram of wheat HMGR wild-type and mutein,

In figure, 1 is wild-type wheat HMGR albumen; 2 is Q61D; 3 is Q61E; 4 is I93V; 5 is Q102R; 6 is Q102E; 7 is R138Q; 8 is Protein Marker; 9 is I213V; 10 is Y223F; 11 is P229H; 12 is A336P; 13 is D339A; 14 is N379S; 15 is S382R.

Embodiment

Embodiment 1 (wheat breed " Jimai 22 " blade RNA extracts)

[1] get about 100mg wheat leaf blade rapid grind into powder in liquid nitrogen, add 500 μ lRL (first check whether before use and added beta-mercaptoethanol), vortex concuss mixing immediately.

[2] all solution is transferred to (Filter column CS is placed in collection tube) on Filter column CS, 13,000rpm (13,400 × g) centrifugal 2-5min, supernatant in careful absorption collection tube is in the centrifuge tube of new RNase-Free, and suction nozzle is avoided contacting the pellet cell debris in collection tube as far as possible.

[3] dehydrated alcohol (being about 260ul) of 0.5 times of supernatant volume is slowly added, mixing (now may occur precipitation), the solution obtained is proceeded in adsorption column CR3 together with precipitation, 13,000rpm (13,400 × g) centrifugal 1min, outwells the waste liquid in collection tube, is put back in collection tube by adsorption column CR3.

Attention: if supernatant volume has loss, the then dosage of corresponding adjustment ethanol.

[4] in adsorption column CR3, add 350 μ l protein liquid removal RW1,13,000rpm (13,400 × g) centrifugal 1min, outwells the waste liquid in collection tube, is put back in collection tube by adsorption column CR3.

[5] preparation of DNaseI working fluid: get 10 μ lDNaseI storage liquid and put into new RNase-Free centrifuge tube, add 70 μ lRDD solution, softly mix.

[6] add the DNaseI working fluid of 80 μ l to adsorption column CR3 central authorities, room temperature places 15min.

[7] in adsorption column CR3, add 350 μ l protein liquid removal RW1,12,000rpm (13,400 × g) centrifugal 30-60sec, outwells the waste liquid in collection tube, is put back in collection tube by adsorption column CR3.

[8] in adsorption column CR3, add 500 μ l rinsing liquid RW (first check whether before use and added ethanol), 13,000rpm (13,400 × g) centrifugal 30-60sec, outwell the waste liquid in collection tube, adsorption column CR3 is put back in collection tube.

[9] repeating step 8.

[10] 13,000rpm (13,400 × g) centrifugal 2min, adsorption column CR3 is put into a new RNase-Free centrifuge tube, the unsettled dropping 50 in the middle part to adsorption film μ lRNase-FreeddH2O, room temperature places 2min, 13,000rpm (13,400 × g) centrifugal 1min, obtains RNA solution.

[11] get 2.5 μ lRNA samples, 1.0 ﹪ agarose native gel electrophoresises detect, and gel imaging system Taking Pictures recording, result as shown in Figure 1.

Embodiment 2 (synthesis of cDNA Article 1 chain)

[1] in the nuclease free centrifuge tube of ice bath, following reaction mixture is added:

50-500ngmRNA；

2μloligo(dT)15

2μlSuperPuredNTPs(2.5mMeach)；

Mend RNase-FreeddH ₂o is settled to 14.5 μ l.

Rapidly at cooled on ice 2min after [2] 70 DEG C of heating 5min.Brief centrifugation adds following component after collecting reaction solution: 4 μ l5 × First-StrandBuffer (containing DTT); 0.5 μ lRNasin.

[3] add 1 μ l (200U) TIANScriptM-MLV, mix with pipettor gently.

[4] 42 DEG C of temperature bath 50min.

[5] 95 DEG C of heating 5min termination reactions, put and carry out subsequent experimental or freezen protective on ice.

[6] with RNase-FreeddH2O, reaction system is diluted to 50 μ l, gets 2-5 μ l and carry out pcr amplification reaction.

Embodiment 3 (intermediate sequence amplification, product are reclaimed, connect and conversion, clone identification)

1. gene intermediate sequence pcr amplification and detection

By searching and the multiple known plants of comparison, especially close with wheat relationship plant HMGR sequence, finds gene order high conservative region, utilizes Primer5.0 to design intermediate sequence amplimer, the corresponding sequence of amplification wheat hmgr.

Upstream primer mhmgrF1:CGATGGCCGGGAGGAACCTGTACATGAG, its nucleotide sequence as shown in SeqIDNo.3,

Downstream primer mhmgrR1:CACCACCAACTGTGCCCACCTCAAT, its nucleotide sequence is as shown in SeqIDNo.4.

PCR system is 50ul, and component is as follows:

PCR program is 95 DEG C of denaturation 5min, 95 DEG C of sex change 30sec, 63 DEG C of annealing 30sec, and 72 DEG C extend 35s, totally 38 circulations, and 72 DEG C extend 8min.

1.0% agarose gel electrophoresis detects, and 25 μ lPCR amplified productions and 5 μ l6 × LoadingBuffer mix, and all click and enter sample holes, 100V voltage stabilizing electrophoresis 40min, and ultraviolet gel imaging system is observed and photographic recording, and result as shown in Figure 2.

2. the recovery of amplified production

[1] in adsorption column CB2, (adsorption column puts into collection tube) adds 450 μ l balance liquid BL, and 13,000rpm (13,400 × g) centrifugal 1min, outwells the waste liquid in collection tube, placed back in collection tube by adsorption column.(using the pillar processed the same day)

[2] single target DNA band is cut (excising redundance) from sepharose as far as possible put into clean centrifuge tube, take weight.

[3] in blob of viscose, equimultiple bulk solution PC is added (if gel is heavily 0.1g, its volume can be considered 100 μ l, then add 100 μ lPC solution), about 10min is placed in 50 DEG C of water-baths, constantly leniently spin upside down centrifuge tube therebetween, to guarantee that blob of viscose fully dissolves.

[4] add in an adsorption column CB2 (adsorption column puts into collection tube) by previous step gained solution, 13,000rpm (13,400 × g) centrifugal 1min, outwells waste liquid in collection tube, adsorption column CB2 is put into collection tube.

[5] in adsorption column CB2, add 600 μ l rinsing liquid PW (first check whether before use and added dehydrated alcohol), 13,000rpm (13,400 × g) centrifugal 1min, outwell the waste liquid in collection tube, adsorption column CB2 is put into collection tube.

[6] repetitive operation step 5.

[7] adsorption column CB2 is put into collection tube, 13,000rpm (13,400 × g) centrifugal 2min, removes rinsing liquid as far as possible.Adsorption column is placed in room temperature and places several minutes, thoroughly dry.

[8] adsorption column CB2 is put into a clean centrifuge tube, to the elution buffer EB that the unsettled dropping in adsorption film mid-way is appropriate, room temperature places 2min.13,000rpm (13,400 × g) centrifugal 2min, collect DNA solution ,-20 DEG C save backup.

The connection of 3.PCR product and conversion

According to the concentration reclaiming fragment, determine the ratio between product and pEASY-BluntSimpleCloningVector.Connect step of converting as follows:

[1] in the EP pipe of 200 μ l, add 4 μ l reclaim DNA product and 1 μ l carrier, mix gently.

Hatch 10min, be placed on ice for [2] 25 DEG C.

[3] add connection product (to add when competent cell just thaws and connect product) in 50 μ lE.coliDH5 α competent cells, flick mixing, ice bath 20-30min.

[4] 42 DEG C of heat shocks 90 seconds, are placed in 2min on ice immediately.

[5] add the LB of 1ml antibiotic-free, 160rpm, hatch 1h for 37 DEG C.

[6] the centrifugal 3min of 6000rpm, discards part supernatant, retains 100-150 μ l, flicks suspension thalline, get whole bacterium liquid coated plate, 37 DEG C of overnight incubation.

4. the qualification of positive colony

Preparation thalline PCR system 20 μ l, component is as follows:

Choose edge clear, full 10 round and smooth colonies, choose in 1mlLB substratum, carry out numbering, correspondence is clicked and entered in PCR system.

PCR reaction conditions: 94 DEG C of denaturation 10min (lysing cell, inactivation nuclease), 94 DEG C of sex change 30 seconds, 55 DEG C of annealing 30 seconds, 72 DEG C extend 1min, and 35 circulations, extend 10min after 72 DEG C.

1.0% agarose gel electrophoresis detects positive colony: carry out DNA sequencing to positive transformant.Utilize the SeqMan software in DNAStar routine package to analyze sequencing result, prove that the sequence dna fragment obtained is the middle portion of wheat HMGR gene through comparison.

Embodiment 4 (RACE technology obtains 5' and 3' end sequence)

1.RACE design of primers

According to the intermediate sequence of obtained wheat TaHMGR gene, Primer5.0 is utilized to design 5'RACE and 3'RACE Auele Specific Primer.

5'RACE primer:

First round mhmgrR1:5'CACCACCAACTGTGCCCACCTCAAT3', its nucleotide sequence is as shown in SeqIDNo.5;

Second takes turns hmgrCR11:5'GTCAGGGAAGTCATCCTGGAGGTAAT3', and its nucleotide sequence is as shown in SeqIDNo.6;

3'RACE primer:

MhmgrF1:5'CGATGGCCGGGAGGAACCTGTACATGAG3', its nucleotide sequence is as shown in SeqIDNo.7;

The first chain synthesis of 2.cDNA

[1] micro centrifugal pipe preparing two RNAfree adds following reagent respectively:

(1) 5'-RACE-ReadycDNA is synthesized

RNA1-2.75μl

5'-CDSPrimerA

(2) 3'-RACE-ReadycDNA is synthesized

RNA1-3.75μl

3'-CDSPrimerA

[2] in two micro centrifugal pipes of step one, add distilled water respectively, make 5'-RACE-ReadycDNA final volume be 3.75 μ l, and 3'-RACE-ReadycDNA final volume is 4.75 μ l.

[3] mix, micro-centrifugal.

[4] PCR instrument 72 DEG C is put into, 3min then 42 DEG C, 2min, the centrifugal 10sec of 13000rpm after cooling, by all components from the bottom of pipe.

[5] in 5'-RACE-ReadycDNA system, 1 μ lSMARTerIIAoligo is added.

[6] following reagent is added respectively in two pipes:

[7] mix gently with pipettor, centrifugal at the bottom of pipe.

[8] in PCR instrument 42 DEG C, 90min is hatched, then 70 DEG C, 10min.

[9] add 100 μ lTricine-EDTA damping fluid diluted for use, can three months be preserved for-20 DEG C.

3.RACE rapid amplifying 5' and 3' terminal sequence

[1] 5' terminal sequence is obtained by nest-type PRC

(1) first round 5'RACEPCR20 μ l system, component is as follows:

PCR program is 95 DEG C of denaturation 5min, 95 DEG C of sex change 30sec, 65 DEG C of annealing 30sec, and 72 DEG C extend 2min, totally 30 circulations, and 72 DEG C extend 8min, 16 DEG C of insulations.

(2) second to take turns 5'RACEPCR template be first round PCR primer, 20 μ lPCR systems, and component is as follows:

PCR program is 95 DEG C of denaturation 5min, 95 DEG C of sex change 30sec, 65 DEG C of annealing 30sec, and 72 DEG C extend 2min, totally 35 circulations, and 72 DEG C extend 8min, 16 DEG C of insulations,

Note: in the primer adopted in upper table, UPM and NUP is that test kit carries.

[2] pcr amplification of 3' terminal sequence

50 μ lPCR systems, component is as follows:

PCR program is 95 DEG C of denaturation 5min, 95 DEG C of sex change 30sec, 63 DEG C of annealing 30sec, and 72 DEG C extend 2min, totally 35 circulations, and 72 DEG C extend 8min, 16 DEG C of insulations

Note: in the primer adopted in upper table, UPM is that test kit carries.

The PCR primer obtained, the agarose gel electrophoresis through 1.0% detects, and takes a picture, and result as shown in Figure 3, Figure 4.

The recovery of 4.RACEPCR product glue, connection, conversion, positive clone identification and order-checking

Step is with the step 2 in embodiment 3,3 and 4.

Embodiment 5 (amplification of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene full length sequence)

1. the design of full length gene primer

The acute 5' terminal sequence of root and 3' terminal sequence, utilize Primer5.0 to design total length primer.

Upstream primer sequences h mgr-QCF45'GTTTGACTCCGACGCGCAC3', its nucleotide sequence is as shown in SeqIDNo.8;

Downstream primer sequences h mgr-QCR15'GCTTCCTGAAGCAAGGAGAG3', its nucleotide sequence is as shown in SeqIDNo.9;

2. Jimai 22TaHMGR full length gene amplification

20 μ lPCR systems, component is as follows:

PCR program is 95 DEG C of denaturation 5min, 95 DEG C of sex change 30sec, 57 DEG C of annealing 30sec, and 72 DEG C extend 2min, totally 38 circulations, and 72 DEG C extend 8min, 16 DEG C of insulations.

The PCR primer obtained, the agarose gel electrophoresis through 1.0% detects, and takes a picture, and result as shown in Figure 5.

3. wheat TaHMGR full length gene PCR primer glue recovery, connection, conversion, positive clone identification and order-checking

Step is with the step 2 in embodiment 3,3 and 4.

Embodiment 6 (structure of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene catalysis region expression vector)

1. the design of wheat TaHMGR gene catalyzes region amplimer

On the basis of wheat TaHMGR full length gene sequence, design catalytic domain expresses primer, from total length open reading frame sequence the 138th amino acid, introduces former and later two restriction enzyme sites of Sal1 and HindIII.

hmgr-PrF：

5'CGCGCGTCGACAGGAGGAATTTAAAATGAGAGGATCGCATCATCACCACCATCA CGTGCCCGAGAAAATGCCCGA3', its nucleotide sequence is as shown in SeqIDNo.10;

Hmgr-PrR:5'CTGCAGAAGCTTTCAAGAACTTAGAGATGCGG3', its nucleotide sequence is as shown in SeqIDNo.11.

2. the pcr amplification of wheat TaHMGR catalysis region

Pcr amplification is carried out to be connected to full length sequence on plasmid pEASY-BluntSimpleCloningVector for template.Recombinant plasmid called after pLM1-TaHMGRcd, amplification program is as follows.

20 μ lPCR systems, component is as follows:

PCR program is 95 DEG C of denaturation 5min, 95 DEG C of sex change 30sec, 60 DEG C of annealing 30sec, and 72 DEG C extend 1min20sec, totally 38 circulations, and 72 DEG C extend 8min, 16 DEG C of insulations.

The PCR primer obtained, the agarose gel electrophoresis through 1.0% detects, and takes a picture, and result as shown in Figure 6.

3. cut glue and reclaim target stripe, enzyme cuts back to close product and expression plasmid

It is as follows that enzyme cuts system, and expression plasmid pLM1 enzyme cuts system 15 μ l.

Wheat TaHMGR catalysis region pcr amplification product enzyme cuts system 20 μ l.

4. connect construction of expression vector pLM1-TaHMGRcd

Cut the concentration of rear recovery fragment according to enzyme, determine the ratio between product and pLM1 carrier, linked system is as follows.

16 DEG C of connections are spent the night.

5. the pLM1-TaHMGRcd connected is transformed and enter DH5 α competent cell

See the step 3 in embodiment 3 and 4, choose positive colony, enlarged culturing, extract plasmid and carry out enzyme and to cut and check order qualification, as shown in Figure 7, wherein the 2nd swimming lane is pLM1-HMGRcd recombinant plasmid to result, can find out there is multiple Plasmid Configuration; 3rd swimming lane is the recombinant plasmid of Sal1 and HindIII double digestion, except the recombinant plasmid do not cut completely, has cut goal gene fragment TaHMGRcd and plasmid vector part; 4th and the 5th swimming lane is respectively Sal1, HindIII single endonuclease digestion recombinant plasmid electrophorogram, and represent that recombinant plasmid can be cut by Sal1 and HindIII restriction enzyme respectively, prove thus, goal gene has been connected on expression vector plasmid pLM1.

Embodiment 7 (structure of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene mutant)

1. the design of mutant primer

According to the plant HMG conserved regions such as paddy rice, Chinese sorghum, corn, two fringe false bromegrasses and Arabidopis thaliana and the amino acid whose difference of surrounding thereof, design rite-directed mutagenesis primer, by amino-acid residue 61Q, 93I, 102Q, 138R, 213I, 223Y, 229P, 336A, 339D, 379N and 382S, sport 61D, 61E, 93V, 102E, 102R, 138Q, 213V, 223F, 229H, 336P, 339A, 379S and 382R respectively.The upstream and downstream primer of mutant respectively as shown in nucleotide sequence SeqIDNo.12-37,

2.PCR amplification obtains mutant sequence

With recombinant plasmid pLM1-TaHMGRcd for template carries out pcr amplification, amplification system 50 μ l, component is as follows.

Centrifugal a little, add 5 μ l mineral oil, prevent moisture from evaporating.

PCR program is 95 DEG C of denaturation 3min, 95 DEG C of sex change 45sec, 60 DEG C of annealing 30sec, and 72 DEG C extend 12min, totally 15 circulations, and 72 DEG C extend 10min, 16 DEG C of insulations.

3. mutant sequence purifying, conversion, positive clone identification

[1] PCR primer transferred in another new EP pipe, add 5 μ l10 × FastdigestGreenBuffer and 1 μ lDpnI mixes, 37 hatch 3h.

[2] in the DNA mixture after cutting to above-mentioned Dpn I enzyme, add isopyknic chloroform 55 μ l, vortex oscillation mixes, the centrifugal 5min of 12000rpm.

[3] supernatant liquid after layering is transferred in a new 1.5mL centrifuge tube, add NH4Cl and the 8/3 volume dehydrated alcohol of 1/3 volume, concussion mixing.The centrifugal 10min of 12000rpm.

[4] supernatant is outwelled, with the alcohol flushing of 70 ﹪, the centrifugal 5min of 12000rpm.

[5] outwell supernatant, room temperature is dried, and adds 10 μ l water dissolution bottom settlingss.

The steps such as conversion and the qualification of positive colony are shown in the step 3 and 4 in embodiment 3.

Embodiment 8 (prokaryotic expression of wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene wild-type and mutant)

1. wild-type recombinant plasmid, mutant Transformed E .ColiBL21 (DE3) are expressed competent cell, step is see the step 3 in embodiment 3.

2. E.ColiBL21 (DE3) enlarged culturing pair containing recombinant plasmid also induces TaHMGR to express

[1] BL21 (DE3) strain inoculation of pLM1-TaHMGRcd recombinant plasmid is transformed into in the LB substratum (Amp concentration is 100mg/ml) of 20ml, 37 DEG C, 160rpm incubated overnight.

[2] the bacterium liquid getting 10ml incubated overnight is added to (Amp concentration is 100mg/ml) in 500mlLB nutrient solution.37 DEG C, 160rpm shaking table cultivate 2.5-3h to thalline OD600=0.8 time, add IPTG (final concentration is 1.5mM).

Cultivate 6-8h or ambient temperature overnight cultivation for [3] 37 DEG C.

[4] the centrifugal 10min of 6000r/min, collects thalline, and with 100ml deionized water rinsing thalline, the centrifugal 10min of 6000r/min, collects thalline.

3. the purifying of albumen

[1] 40mL start buffer (Startbuffer) resuspended thalline is added.

[2] 5mg N,O-Diacetylmuramidase is added, 37 DEG C of water-bath lh.

[3] at least lh is placed in-80 DEG C.

[4] 30 DEG C of water-baths are thawed.

[5] sonicated cells 1h (broken 5s, interval 10s).

[6] the centrifugal 10min of 9000r, supernatant liquor is used for protein purification.

[7] strainer of Ni-Trap post and 0.45 μm connects, and syringe is drawn 5mL aqua sterilisa and injected post and drop by drop get rid of ethanol in post.

[8] the 0.1M single nickel salt getting 3-5mL again injects post, washes the nickel ion not having to combine off, then use the start buffer (Startbuffer) of 5mL to balance with 5mL deionized water.

[9] get 20mL centrifugal after supernatant liquor inject post.

[10] post is washed with 5mL start buffer (Startbuffer).

[11] post is washed with 8mL dcq buffer liquid (Washbuffer).

[12] dissolve target protein with the elution buffer (Elutionbuffer) of 5mL, and connect sample with 1.5mL centrifuge tube, every 1mL mono-manages.

4.SDS-PAGE electrophoresis detection protein

[1] separation gel preparation:

Deionized water 2.5ml

30%Arc-Bis mother liquor 3.35ml

1.5MTris-HCl(pH8.8)2ml

10％SDS80μl

10％AP80μl

TEMED3.5μl

[2] concentrated glue preparation:

Deionized water 1.7ml

30%Arc-Bis mother liquor 420 μ l

1MTris-HCl(pH6.7)320μl

10％SDS25μl

10％AP25μl

TEMED3μl

[3] protein sample mixes with 2 × SDS albumen sample-loading buffer 1:1, and 100 DEG C are boiled 5min.Ultrasonic centrifugal after precipitation, add 2ml8M/L urea dissolve, add isopyknic sample-loading buffer 100 DEG C and boil 5min.

[4] separation gel 8ml is prepared, with the mixing of 1ml pipettor (noting not blowing afloat bubble) after adding TEMED, in the gap of two sheet glass, pour into separation gel rapidly, then add 1-2ml deionized water thereon, reserve the concentrated space needed for glue of perfusion, about 1.0cm; After separation gel polymerization completely, incline and tectum liquid, with deionized water wash gel top several, to remove unpolymerized acrylamide gel.

[5] the concentrated glue 2.5ml of preparation, mixes after adding TEMED, and on separation gel, the concentrated glue of perfusion, inserts clean comb; After polymerization completely, gel is fixed on electrophoresis apparatus, and upper and lower groove respectively adds Tris-glycine running buffer, gets rid of the bubble between sheet glass, carefully pulls out comb.

[6] ready sample is added by predetermined order.80V constant voltage run become 120V to during separation gel, to be instructed dose move to bottom time stop electrophoresis.

[7] take out gel, add Xylene Brilliant Cyanine G dye liquor, soak gel with the dye liquor of about 5 times of volumes, be placed on the platform of mild shake, in room temperature dyeing 3-5h.

[8] shift out and reclaim dye liquor for future use, by soak in destainer, mild shake 4-8h, should change destainer 3-4 time therebetween, result is as shown in Figure 8 and Figure 9, as can be seen from the swimming lane 2 and 3 of Fig. 8, obtained the wild-type HMGR zymoprotein that purity is higher, as can be seen from swimming lane 2-7 and the swimming lane 9-15 of Fig. 9,13 mutant zymoprotein of acquisition are the same with the wild-type enzyme albumen of swimming lane 1, purity is very high, may be used for enzyme dynamics.

5. the dialysis of purifying protein

The zymoprotein of purifying is placed in dialysis tubing, dialysis tubing two is clamped with sealing clip, appropriate albumen dialyzate (ensureing that dialysis tubing can suspend) is added in large beaker, put into rotor, be placed in 4 DEG C of dialysis 20h on magnetic stirring apparatus, control rotary speed of rotator too not fast, middle replacing dialyzate 3 times.Collect the albumen after dialysis, be put in-80 DEG C of Ultralow Temperature Freezers for subsequent use.

Embodiment 9 (wild-type, mutant wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme Determination of Kinetic Parameters)

1. the mensuration of zymoprotein concentration

With reference to the operation instruction of Bradford determination of protein concentration test kit, the protein standard solution of preparation series concentration gradient: 0,50mg/ml, 100mg/ml, 200mg/ml, 300mg/ml, 400mg/ml, 500mg/ml, add 100 μ l protein standard liquid and 3mlBradford reagent in each test tube, leave standstill 15min in room temperature.

DU800 ultraviolet spectrophotometer is utilized to measure the absorbance A 595 at 595nm place, and drawing standard curve, according to this standard curve determination sample protein concentration.

2. external enzymatic reaction

Reaction system 1ml, measures enzyme to a kind of Vmax and K of substrate _mtime, another kind of concentration of substrate be fixed.

[1] enzyme is measured to Vmax and K of NADPH _mvalue

(1) get 5 disposable cuvettes, label 1-5, add potassiumphosphate (500mML respectively in each cuvette ^-1, pH7.5) and 10 μ l, HMGRcd albumen x μ l (reclaim the adjustment of gained protein concentration difference according to purifying and add 10 μ g albumen).

(2) No. 1 cuvettes add substrate NADPH (10mML ^-1) 1 μ l makes its final concentration be 10 μMs of L- ¹, No. 2 cuvettes add 2 μ l makes its final concentration be 20 μMs of L ^-1, No. 3 cuvettes add 4 μ l makes its final concentration be 40 μMs of L ^-1, No. 4 cuvettes add 6 μ l makes its final concentration be 60 μMs of L ^-1, No. 5 cuvettes add 8 μ l makes its final concentration be 80 μMs of L ^-1.Add water and supply 985 μ l, mix, leave standstill 1min.

(3) final concentration 150 μMs of L of immobilized substrate HMG-CoA ^-1, finally add substrate HMG-CoA (10mML ^-1) 15 μ l start reaction, add HMG-CoA and rise, start timing 30s, and mix rapidly (note in mixing process rifle head all the time below liquid level in case produce bubble) with 1ml pipettor, during time cut-off, start detection.

(4) with the ultraviolet spectrophotometer (DU-800) of preheating, in detection reaction mixture, substrate NADPH is in the time dependent reduction of 340nm place light absorption value, continuous monitoring 120s, analyzes change and the relation of time of enzymatic speed of response, records 5 data of acquisition.According to meeh's formula y=ax/ (b+x), and utilize sigmaplot12.0, calculate Vmax and K of HMGRcd to substrate NADPH _mvalue (reaction is all at room temperature carried out).

[2] enzyme is measured to Vmax and K of HMG-CoA _mvalue

Measure enzyme to Vmax and K of substrate HMG-CoA _mthe method of value is roughly the same, needs concentration 300 μMs of L of immobilized substrate NADPH herein ^-1.HMG-CoA (10 μMs of L are added respectively in 1-5 cuvette ^-1) volume be 10 μ l, 30 μ l, 50 μ l, 70 μ l, 90 μ l, equally with HMG-CoA start reaction.According to meeh's formula y=ax/ (b+x), obtain 5 data input sigmaplot12.0, calculate relevant enzyme kinetic parameter.

Result display records clones the wild-type 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme of acquisition to the K of substrate NADPH and HMG-COA from wheat breed " Jimai 22 " _mvalue is respectively 41.3 ± 4.2 and 39.5 ± 4.6mM; Vmax is respectively 0.08 ± 0.00 and 0.09 ± 0.00mmol/min/mg; Kcat is respectively 0.15 ± 0.01 and 0.16 ± 0.01S ^-1; Kcat/K _mbe respectively 3.63 × 10 ³with 4.05 × 10 ³m ^-1s ^-1, prove that the wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene of cloning has native biological function thus.Record the enzyme kinetics parameter of 13 wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene mutant to substrate NADPH and HMG-COA to see the following form, shown by the change to amino acid codes, can significantly improve or reduce the catalytic activity of enzyme.

Wheat HMGR mutant enzyme kinetic parameter

In upper table, concerning substrate NADPH, the K of mutant Y223F, Q102R and D339A _mvalue is all than the K of wild-type _mvalue significantly reduces, and illustrates that the avidity of mutant to NADPH greatly improves, the Vmax value increase more remarkable in wild-type of mutant Q61D, I213V and P229H.

For HMG-CoA, mutant D339A, Q102E and Q102R avidity to substrate also greatly improves than wild-type, and the maximum speed of reaction Vmax value of mutant Q61D, I213V and P229H increases greatly than wild-type.

Kcat and Kcat/K _mrepresent the height of enzyme catalysis efficiency, the Kcat value of mutant I93V, I213V and P229H to NADPH is 32 times, 6 times and 5.7 times of wild-type respectively as seen from table, Kcat/K _mvalue is 30.9 times, 7.6 times and 7.1 times of wild-type respectively, to the Kcat value of HMG-CoA, is 32 times of wild-type, 7.1 times and 7.3 times respectively, Kcat/K _mvalue is 32.1 times, 5.4 times and 4.5 times of wild-type respectively.

Pass through foregoing, contriver finds for the higher mutant of the enzymatic activity obtained, it is made to enter in recipient plant by transgenic technology, the content of mevalonic acid pathways metabolism downstream secondary metabolite can be improved, as the content of the isoprenoid materials such as ginsenoside can be improved, and then the output etc. of crop may be affected; For the mutant that enzymatic activity reduces, according to research and actual needs can be produced, if make it enter in recipient plant by transgenic technology, the accretion rate of controlled pathways metabolism can be slowed down.

Claims (2)

1. wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene TaHMGR, is characterized in that: its coding region nucleotide sequence is as shown in SeqIDNo.1, and the aminoacid sequence of its coding is as shown in SeqIDNo.2.

2. wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene TaHMGR according to claim 1 is in site-directed point mutation, the eukaryotic gene expression vector building 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene the application transformed on corresponding crop.