CN105112403B - Chrysanthemum salt tolerance is associated with molecular labeling and its preparation method and application - Google Patents
Chrysanthemum salt tolerance is associated with molecular labeling and its preparation method and application Download PDFInfo
- Publication number
- CN105112403B CN105112403B CN201510587614.9A CN201510587614A CN105112403B CN 105112403 B CN105112403 B CN 105112403B CN 201510587614 A CN201510587614 A CN 201510587614A CN 105112403 B CN105112403 B CN 105112403B
- Authority
- CN
- China
- Prior art keywords
- chrysanthemum
- salt tolerance
- salt
- molecular labeling
- tolerance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses chrysanthemum salt tolerance association molecular labeling and its preparation method and applications.The preparation method includes the continuous 2 years Salt-Tolerance Identifications of a.；B. Dendranthema morifolium Varieties group structure is analyzed；C. Dendranthema morifolium Varieties Genetic relationship；D. with the determination of the molecular labeling of chrysanthemum salt tolerance tight association.This method uses tri- kinds of molecular marking techniques of SRAP, SCoT and EST-SSR to carry out the scanning of full-length genome molecular labeling to 159 Cut Flower Chrysanthemum Morifolium kinds simultaneously, obtained stainable bands quantity is abundant, polymorphism is good, repeated height, help to obtain the molecular labeling with salt tolerance tight association.The invention detects that 3 marker sites are significantly associated with the salt tolerance of kind, certain reference is provided for chrysanthemum salt tolerance molecular marker assisted selection.
Description
Technical field
The invention belongs to field of biotechnology, are related to chrysanthemum salt tolerance association molecular labeling and its preparation method and application.
Background technique
Chrysanthemum (Chrysanthemum morifolium Ramat.) is originating in China, is composite family Chrysanthemum perennial root grass
This plant.Dendranthema morifolium Varieties are various, and germ plasm resource is abundant, contain hereditary variation information abundant.Soil salt damage is always to influence
One key factor of agricultural production, time natural disposition salt damage caused by facility cultivation are also more and more concerned by people.It cuts
Hua Ju plantation is in applying chemical fertilizer during cultivation management in greenhouse but cannot obtain the abundant leaching of rainwater, in addition soil
Surface moisture, which is constantly evaporated, will cause salt accumulation in soil in protected field, influences absorption of the Cut Flower Chrysanthemum Morifolium root system to water, fertilizer, finally leads
It causes its growth and development to be obstructed, reduces quality.Chrysanthemum salt tolerance is complicated quantitative character, and genetic mechanism is complicated.Therefore, understand
The diversity and affiliation of Cut Flower Chrysanthemum Morifolium variety source are excavated advantageous with the molecular labeling of the quantitative characters tight associations such as salt tolerance
It is excavated and molecular marker assisted selection breeding in carrying out the excellent allele site of correlated traits.
Association analysis (linkage disequilibrium mapping or association mapping) is with linkage disequilibrium (linkage
Disequilibrium, LD) based on, using natural population as research object, detect in group objective trait and genetic marker or
The significant association of the hereditary variation of candidate gene；Multiple allele in natural population can be detected simultaneously, be conducive to a large amount of
Identifying in germ plasm resource has the positive excellent allele contributed to objective trait.Compared to traditional QTL plotting technique, association point
Analysis has the advantage that (1) is short research cycle, generally using natural population as material, without constructing special mapping population；(2)
Population genetic basis used is wide, can analyze simultaneously multiple allele of same gene seat；(3) positioning accuracy is high, can
Reach single-gene level.The shuffling information accumulated during long-term evolution using natural population, high resolution, it can be achieved that
The finely positioning of QTL, or even gene itself can be directly targeted to；(4) environmental factor pair can be removed by many years, multispots trial
The influence of character statistics.
The salinization of soil is global problem, has seriously affected ecological environment and agricultural production.China's chrysanthemum produces at present
Substantially distributed regional production, the cultivation that coastal and northern area salt-affected soil seriously limits chrysanthemum are promoted.Cause
This, improve Dendranthema morifolium Varieties salt tolerance be chrysanthemum breeding research in an important goal.However at present about chrysanthemum salt tolerance
The accurate positioning and clone for being associated with molecular labeling not yet appear in the newspapers.
Summary of the invention
It is almost empty at home and abroad for the accurate positioning of chrysanthemum salt tolerance Fineness gene in the prior art and the research of clone
This white status, the present invention is by filtering out multiple and chrysanthemum salt tolerance gene site tight association molecular labeling, to build
Vertical chrysanthemum salt tolerance molecular marker assisted selection system, improves the efficiency of selection of the excellent salt tolerance germ plasm resource of chrysanthemum, is chrysanthemum
Breeding of new variety lays the foundation.The purpose of the present invention is obtained by following technological means:
A kind of preparation method of chrysanthemum salt tolerance association molecular labeling, comprising the following steps:
A, Salt-Tolerance Identification: choosing separate sources and several Dendranthema morifolium Varieties without direct affiliation, collects salt tolerance
Data carry out basic descriptive statistical analysis to salt tolerance data；
B, Dendranthema morifolium Varieties group structure is analyzed:
1) genomic DNA of Dendranthema morifolium Varieties is extracted；
2) Dendranthema morifolium Varieties genomic DNA is randomly selected, the combination of SRAP, SCoT and EST-SSR primer is screened, will be sieved
The amplified band selected is clear, stablize and full-length genome molecular labeling that the primer sets of rich polymorphism are shared in Dendranthema morifolium Varieties is swept
It retouches, the polymorphic bands data result that statistics scanning obtains；
3) guild division is carried out to Dendranthema morifolium Varieties group, calculates the Q value i.e. genome mutation of some kind of each kind
Derived from the probability of some group, and draw out group structure figure；
C, Dendranthema morifolium Varieties Genetic relationship: the integral data marked according to three kinds analyzes interracial affiliation, obtains
To affiliation COEFFICIENT K matrix；
D, with the determination of the molecular labeling of chrysanthemum salt tolerance tight association: using the mixed linear in 5.0 software of TASSEL
Model M LM carries out the association analysis of salt tolerance and molecular labeling, by the Q value of each kind obtained in step b population analysis
All covariant is used as to be included in model with K matrix obtained in step c Genetic relationship；With the average value of 2 years membership function values
Phenotypic data as Salt-Tolerance Identification combines the above molecular data and is associated analysis, if P < 0.01, then it is assumed that the marker bit
Point is the molecular labeling with chrysanthemum salt tolerance tight association, while obtaining the phenotypic variation explanation rate R of the marker site2。
The specific method of the Salt-Tolerance Identification is preferred are as follows: chooses separate sources and 100 without direct affiliation
Above Dendranthema morifolium Varieties are taken root respectively at foot bud cuttage of the acquisition of continuous 2 year spring for trying Dendranthema morifolium Varieties in hole tray to it
And 200mM/L NaCl salt treatment is carried out when growing to 10 leaf age seedling to it, 3d, 5d and 7d observe different cultivars seedling after processing
Victimization state, record the aggrieved number of sheets (yellow leaf, flaccid leaf, withered leaf), evaluate salt gypsum rock, salt gypsum rock is divided into 5 grades, 1 grade:
Plant is substantially without damage symptoms, leaf green, health；2 grades: plant is normal, lower blade slightly macula lutea or blackspot；3 grades:
The a bit gloomy lackluster of plant, lower part have 2-3 piece leaf obviously to black or wilt；4 grades: some wiltings of plant, lower part 4-5 piece leaf become
Black and withered wilting；5 grades: plant is obviously wilted, and middle and lower part Ye Junyi blackening wilts or dries up.Each kind each time point note
The wilting index for recording 5 plant takes its arithmetic average；The average membership function value X of each kind is found out with Subordinate FunctioniMake
For the Salt-Tolerance Identification data of final each kind, since salt gypsum rock and salt tolerance are negatively correlated, membership function value XiIt calculates public
Formula are as follows: Xi=1- (X-Xmin)÷(Xmax-Xmin)；
X in formula is the measured value of some index of some kinds, XminAnd XmaxFor the minimum value of all kind indexs
And maximum value；The final membership function value of each kind is the average value of the membership function value of all indexs of each kind, average
Membership function value is bigger, and salt tolerance is stronger.
The step 3) preferably carries out base to Dendranthema morifolium Varieties group with the Bayesian method in STRUCTURE software
In the guild division of mathematical model, the corresponding Q value of each experimental cultivar is obtained, i.e. the genome mutation of some kind is derived from some
The probability of group, and draw out group structure figure；The step c: Dendranthema morifolium Varieties Genetic relationship: soft using SPAGeDi
Part, the integral data marked according to three kinds analyze interracial affiliation, obtain affiliation COEFFICIENT K matrix.
The step d is preferably using the average value of 2 years membership function values as the phenotypic data of Salt-Tolerance Identification, application
The association analysis that mixed linear model MLM in TASSEL5.0 software carries out salt tolerance and molecular labeling is recognized if P < 0.01
For the molecular labeling that the marker site is with chrysanthemum salt tolerance tight association, while showing that the phenotypic variation of the marker site is explained
Rate R2。
The preparation method of chrysanthemum salt tolerance of the present invention association molecular labeling, further preferably the following steps are included:
A, Salt-Tolerance Identification: choosing separate sources and 100 or more the Dendranthema morifolium Varieties without direct affiliation, respectively at
Continuous 2 year spring acquires the foot bud cuttage for examination Dendranthema morifolium Varieties in hole tray, to it when it is taken root and grows to 10 leaf age seedling
200mM/L NaCl salt treatment is carried out, 3d, 5d and 7d observe the victimization state of different cultivars seedling after processing, record aggrieved leaf
Number evaluates salt gypsum rock, and salt gypsum rock is divided into 5 grades, 1 grade: plant is substantially without damage symptoms, leaf green, health；2 grades: plant
It is normal, lower blade slightly macula lutea or blackspot；3 grades: a bit gloomy lackluster of plant, lower part have 2-3 piece leaf obviously to black
Or it wilts；4 grades: some wiltings of plant, lower part 4-5 piece leaf blackening and withered wilting；5 grades: plant is obviously wilted, and middle and lower part leaf is equal
Blackening wilts or dries up.Each kind each time point records the wilting index of 5 plant, takes its arithmetic average；With person in servitude
Membership fuction method finds out the average membership function value X of each kindiAs the Salt-Tolerance Identification data of final each kind, since salt damage refers to
Number is negatively correlated with salt tolerance, membership function value XiCalculation formula are as follows: Xi=1- (X-Xmin)÷(Xmax-Xmin)；
X in formula is the measured value of some index of some kinds, XminAnd XmaxFor the minimum value of all kind indexs
And maximum value；The final membership function value of each kind is the average value of the membership function value of all indexs of each kind, average
Membership function value is bigger, and salt tolerance is stronger；
B, Dendranthema morifolium Varieties group structure is analyzed:
1) genomic DNA of Dendranthema morifolium Varieties is extracted using CTAB micromethod；
2) 8 Dendranthema morifolium Varieties genomic DNAs are randomly selected to screen the combination of SRAP, SCoT and EST-SSR primer, it will
The amplified band that filters out is clear, stablize and the primer sets of rich polymorphism share full-length genome molecular labeling in Dendranthema morifolium Varieties
Scanning, the polymorphic bands data result that statistics scanning obtains；
3) class based on mathematical model is carried out to Dendranthema morifolium Varieties group with the Bayesian method in STRUCTURE software
Group divides, and obtains the corresponding Q value of each experimental cultivar, i.e. the genome mutation of some kind probability that is derived from some group, and
Draw out group structure figure；
C, Dendranthema morifolium Varieties Genetic relationship: applying SPAGeDi software, and the integral data marked according to three kinds analyzes kind
Between affiliation, obtain affiliation COEFFICIENT K matrix；
D, with the determination of the molecular labeling of chrysanthemum salt tolerance tight association: using the mixed linear in 5.0 software of TASSEL
Model M LM carries out the association analysis of salt tolerance and molecular labeling, by the Q value of each kind obtained in step b population analysis
All covariant is used as to be included in model with K matrix obtained in step c Genetic relationship；With the average value of 2 years membership function values
As the phenotypic data of Salt-Tolerance Identification, carries out salt tolerance using the mixed linear model MLM in 5.0 software of TASSEL and divide
The association analysis of son label, if P < 0.01, then it is assumed that the marker site is the molecular labeling with chrysanthemum salt tolerance tight association, together
When obtain the phenotypic variation explanation rate R of the marker site2。
Wherein, obtaining to preferably include with chrysanthemum salt tolerance tight association molecular labeling: (1) E19M16-3, P value are
0.0085, R2It is 4.49%, amplimer is to being forward primer M16 sequence as shown in SEQ ID NO.1, reverse primer E19 sequence
Column are as shown in SEQ ID NO.2；(2) p1-3, P value are 0.0046, R2It is 5.29%, amplimer is p1 sequence such as SEQ ID
Shown in NO.3；(3) EST-SSR187-2, P value are 0.0043, R2It is 5.36%, amplimer is to for forward primer 187F sequence
As shown in SEQ ID NO.4, reverse primer 187R sequence is as shown in SEQ ID NO.5.
The molecular labeling with chrysanthemum salt tolerance tight association obtained using method of the present invention, comprising: (1)
E19M16-3, P value are 0.0085, R2Be 4.49%, amplimer to being forward primer M16 sequence as shown in SEQ ID NO.1,
Reverse primer E19 sequence is as shown in SEQ ID NO.2；(2) p1-3, P value are 0.0046, R2It is 5.29%, amplimer p1
Sequence is as shown in SEQ ID NO.3；(3) EST-SSR187-2, P value are 0.0043, R2It is 5.36%, amplimer is to being positive
Primer 187F sequence is as shown in SEQ ID NO.4, and reverse primer 187R sequence is as shown in SEQ ID NO.5.
Primer of the present invention with the molecular labeling of chrysanthemum salt tolerance tight association, molecular labeling E19M16-3 are positive
Primer M16 sequence is as shown in SEQ ID NO.1, and reverse primer E19 sequence is as shown in SEQ ID NO.2；Molecular labeling p1-3 draws
Object p1 sequence is as shown in SEQ ID NO.3；Molecular labeling EST-SSR187-2 forward primer 187F sequence such as SEQ ID NO.4 institute
Show, reverse primer 187R sequence is as shown in SEQ ID NO.5.
Application of the preparation method of chrysanthemum salt tolerance association molecular labeling of the present invention in salt tolerance chrysanthemum breeding.
Application of the molecular labeling of the present invention in salt tolerance chrysanthemum breeding.
Application of the molecular labeling primer of the present invention in salt tolerance chrysanthemum breeding.
The utility model has the advantages that
It is material, benefit that the present invention, which selects 100 Duo Ge Dendranthema morifolium Varieties natural populations from a wealth of sources and without direct affiliation,
Full-length genome molecule scanning is carried out to it with tri- kinds of labelling techniques of SRAP, SCoT and EST-SSR, has obtained group's knot of the group
Structure and affiliation are obtained in conjunction with to continuous 2 years Salt-Tolerance Identification data of all kinds of the group with association analysis method
Obtained the molecular labeling with salt tolerance tight association.Its advantage is that:
(1) research cycle is short, generally using natural population as material, without constructing special mapping population；Group used loses
It is wide to pass basis, multiple allele of same gene seat can be analyzed simultaneously；Positioning accuracy is high, can reach single-gene water
It is flat；The influence that environmental factor counts character can be removed by many years, multispots trial.
(2) SSR marker is codominant marker, and polymorphism is good, and repeatability is high, covers whole gene group, has more equipotential bases
The characteristic of cause；SRAP tagging system has many advantages, such as that easy, yield is high, easily obtains separated bands from sequence, and the label is just
Anti-primer is directed to the introne and exon region design of genome respectively, to open reading frame (open reading
Frames, ORFs) it is expanded, it is complementary with the amplification region of SSR marker, it can be used as the supplemental markers of SSR marker；SCoT mark
It is denoted as dominant marker, with easy to operate, design of primers is simple, can effectively generate and the label of the linkage of characters, reproducible etc.
Advantage.Tri- kinds of molecular marking techniques of SRAP, SCoT and EST-SSR are used in this research simultaneously, obtained stainable bands polymorphism is good,
It is repeated high, it help to obtain the molecular labeling being closely related with chrysanthemum salt tolerance.
(3) the conventional hybridization breeding cycle of chrysanthemum is long, time-consuming and laborious, and cannot achieve orderly improvement specific trait, is educating
There are certain limitations in kind.The acquisition of chrysanthemum salt tolerance association molecular labeling may be implemented excellent salt-enduring cultivars and select ahead of time,
Workload is reduced, the efficiency of selection of chrysanthemum new gene type is greatly improved, to accelerate breeding process.
Detailed description of the invention
Fig. 1 judges suitable group's number by L (K) and Δ K
159 Dendranthema morifolium Varieties group structures (K=2) of Fig. 2
The affiliation of 159 Dendranthema morifolium Varieties of Fig. 3 detects
The classification of Fig. 4 salt stress foliar symptoms
Specific embodiment
Below with reference to embodiment, the present invention will be further described, and the experiment side of actual conditions is not specified in the following example
Method, usually according to the known approaches of this field.
(1) acquisition of test material and its Salt-Tolerance Identification phenotypic data
Test material: separate sources and without direct affiliation, type extensively, representative 159 strong Dendranthema morifolium Varieties (tables
1), all material be stored in " Chinese Chrysanthemum Germ-plasma resources protection " center ", if other colleague need, Agricultural University Of Nanjing " in
State's chrysanthemum Germ-plasma resources protection " center " can provide these germplasm to domestic unit.Spring respectively at 2012 and 2013 adopts
It takes the consistent foot bud of health, the growth potential of all kinds to carry out hole tray cuttage and seedling culture, to cuttage seedling rooting and grows to 10 leaf ages
Salt stress processing is carried out when seedling.
159 Dendranthema morifolium Varieties of the table 1 for examination
Salt stress processing method: 159 foot buds for trying Cut Flower Chrysanthemum Morifolium kind are acquired respectively at 2012 and spring in 2013
Cuttage extracts it from hole tray when it is taken root and grows to 10 leaf age seedling, after clear water washes away the matrix of root in hole tray
It is fixed on the cystosepiment having had openning hole with sponge, cystosepiment is put on plastic container, is immersed in its root in turnover box
Distilled water in, first slow seedling culture 4 days, with ventilation pump to liquid 24 hours ventilation send oxygen.Then it will be changed in control group turnover box
For 1/2Hoagland nutrient solution, processing group is changed to 1/2Hoagland nutrient solution and adds NaCl, makes that NaCl's is final concentration of
200mM.Each 8 plants of the processing group and control group of each kind.
The observation and measurement of index: 3d, 5d and 7d observe the victimization state of different cultivars seedling after salt treatment, record aggrieved
The number of sheets (yellow leaf, flaccid leaf, withered leaf), evaluates salt gypsum rock, and salt gypsum rock is divided into 5 grades, 1 grade: plant substantially without damage symptoms,
Leaf green, health；2 grades: plant is normal, lower blade slightly macula lutea or blackspot；3 grades: a bit gloomy lackluster of plant,
Lower part has 2-3 piece leaf obviously to black or wilt；4 grades: some wiltings of plant, lower part 4-5 piece leaf blackening and withered wilting；5 grades: planting
Strain is obvious to wilt, and middle and lower part Ye Junyi blackening wilts or dries up.The wilting that each kind each time point records 5 plant refers to
Number, takes its arithmetic average.
Data process&analysis: finding out the membership function value of each time point salt gypsum rock using Subordinate Function, due to
Salt gypsum rock and salt tolerance are negative correlativing relations, therefore use formula: Xi=1- (X-Xmin)÷(Xmax-Xmin)；X in formula
For the measured value of some kind salt gypsum rock, XminAnd XmaxFor the minimum value and maximum value of all kind salt gypsum rocks.With each
The average value size of the membership function value of the salt gypsum rock at three time points of kind evaluates the salt tolerance of the kind, is averagely subordinate to
Functional value is bigger, and salt tolerance is stronger.
It is retouched substantially respectively using Salt-Tolerance Identification data of 2007 software of Microsoft Excel to two times
The property stated statisticallys analyze (table 2), it can be seen that the salt tolerant membership function value range of 2 years all kinds is 0.00-1.00, average
Value is respectively 0.54 and 0.50, and the coefficient of variation is respectively 47.80% and 36.80%.
The statistical analysis of 2 159 Dendranthema morifolium Varieties salt tolerance membership function values of table
(2) Dendranthema morifolium Varieties group structure is analyzed:
1) 159 Dendranthema morifolium Varieties genomic DNAs, the inspection of Lambda DNA agarose gel electrophoresis are extracted using CTAB micromethod
DNA concentration and quality are surveyed, ddH is finally used2O is diluted to 50ng/ μ L, is placed in -20 DEG C of refrigerators and saves backup.
2) 8 Dendranthema morifolium Varieties genomic DNAs are randomly selected to screen the combination of SRAP, SCoT and EST-SSR primer, are selected
It selects the primer pair all material that electrophoretic band is clear, polymorphism is high, reproducible to be expanded, for Primer of the invention
And sequence is shown in Table 3, table 4 and table 5.It is (big that Lambda DNA, Taq DNA polymerase, the dNTPs of experiment are purchased from precious bioengineering
Even) Co., Ltd, SRAP, SCoT and EST-SSR primer are synthesized by Shanghai Jierui Biology Engineering Co., Ltd.
In the 10 μ L amplification systems of SRAP-PCR: 10 × PCR Buffer 1.0 μ L, Mg2+2.25mM、dNTPs
0.225mM, front and back primer be 5 μM each, Taq DNA polymerase 0.5U, template DNA 50ng.Amplification program are as follows: 94 DEG C of initial denaturations
5min；94 DEG C of denaturation 1min, 35 DEG C of renaturation 1min, 72 DEG C of extension 1min, totally 5 recycle；94 DEG C of denaturation 1min；50 DEG C of renaturation
1min, 72 DEG C of extension 1min, totally 35 recycle；72 DEG C of extension 10min, 4 DEG C save backup.
In the 25 μ L amplification systems of SCoT-PCR: Mg2+1.20mM, dNTPs 0.15mM, 4 μM of primer, Taq archaeal dna polymerase
1U, template DNA 50ng.Amplification program are as follows: 94 DEG C of initial denaturation 4min；94 DEG C of denaturation 50s, 49.4 DEG C of annealing 35s, 72 DEG C extend
45s, 35 circulations；72 DEG C of extension 7min, 4 DEG C save backup.
In the 25 μ L systems of EST-SSR-PCR: 10 × PCR Buffer 2.5 μ L, Mg2+1.50mM、dNTPs 0.20mM、
Front and back primer is 4 μM each, Taq DNA polymerase 1.0U, template DNA 35ng.Amplification program are as follows: 94 DEG C of initial denaturation 4min；94 DEG C of changes
Property 30s, 54 DEG C of renaturation 30s, 72 DEG C of extension 30s, totally 34 circulation；72 DEG C of extension 7min, 4 DEG C save backup.
The pcr amplification product of three kinds of molecular labelings uses 8% non denatured polyacrylamide gels (PAGE) electrophoresis detection, silver
The dyeing of dye method.
When counting three kinds of molecular labeling bands, on the identical migration position of electrophorogram, have band is denoted as 1, does not have
Band is denoted as 0, because banding pattern is unclear caused by different reasons or shortage of data is denoted as N (according to difference in subsequent software analysis
The logging data of software requires to be converted into corresponding record form), the naming method of slug band is that " primer name-number is compiled
Number ", digital number refers to the number that the band gets off from electrophorogram by molecular weight descending order number, such as " E11M25-
The 10th band counted on the electrophorogram that 10 " expression SRAP label E11M25 primer pairs obtain, " p1-3 " indicates SCoT mark
Remember the 3rd band that No. 1 primer obtains, " EST-SSR70-11 " indicates the Sub_clause 11 item that No. 70 primers of EST-SSR label obtain
Band.
38 pairs of SRAP primer composite sequences that table 3 filters out
7 SCoT primer sequences that table 4 filters out
31 pairs of EST-SSR primer composite sequences that table 5 filters out
3) class based on mathematical model is carried out to Dendranthema morifolium Varieties group with the Bayesian method in STRUCTURE software
Group divides, and first assumed group number (K) is 1-15, not counting when MCMC (Markov Chain Monte Carlo) is started
Iteration (length of burn-in period) is set as 10000 times, and assumes site all and be independent, and each K value is independently transported
It calculates 5 times, suitable K value is then determined simultaneously according to the maximum principle of likelihood function value and Δ K value (Evanno et al.2005)
Draw scatterplot curve graph.Log-likelihood function value L (K) lasting increase with the increase of the K value of setting as the result is shown, can not be true
Make reliable K value (Figure 1A)；And Δ K when K=2 maximum (Figure 1B), when K continues to increase, Δ K is reduced rapidly, scatterplot
Curve is steep, therefore judges that K value should take 2, i.e. 159 Dendranthema morifolium Varieties can be divided into 2 main subgroups, group structure figure
As shown in Figure 2.Subgroup 1 (Pop1) includes 100 kinds, wherein the Q value of 86 kinds is greater than 0.60, i.e. the genome of kind becomes
The heterologous probability in this subgroup is greater than 60%, remaining kind of 14 Q values less than 0.60 is drawn to mixing group；Subgroup 2
(Pop2) include 59 kinds, wherein Q value has 47 kinds greater than 0.60, and in addition the Q values of 12 kinds is less than 0.60, also by
It draws to mixing group.Mixing group shares 26 kinds in this way.
(3) Dendranthema morifolium Varieties Genetic relationship
Using SPAGeDi software, integral data (371 SRAP strip datas, the 49 SCoT bands marked according to three kinds
Data and 287 EST-SSR strip datas) the interracial affiliation of analysis, affiliation coefficient matrix (K matrix) is obtained,
The range of each numerical value is 0-1 in matrix, and value is smaller to indicate that the affiliation between the two kinds is remoter, on the contrary then indicate
Interracial affiliation is closer.The frequency disribution of affiliation coefficient such as Fig. 3 between obtained sibling species.As the result is shown
52.7% product Interspecific relationship coefficient is 0, and 21.3% product Interspecific relationship coefficient is less than 0.05, and relationship is closed between kind
Coefficient only accounts for 1.2% more than or equal to 0.3, and the affiliation coefficient average value between all Dendranthema morifolium Varieties for examination is 0.074, is said
It is bright very weak for the examination interracial affiliation of chrysanthemum group, it is appropriate for association analysis, obtained affiliation coefficient matrix (K
Matrix) it will be as the covariant in subsequent association analysis model.
(4) with the determination of the molecular labeling of chrysanthemum salt tolerance tight association
The association analysis of salt tolerance and molecular labeling is carried out using the mixed linear model MLM in 5.0 software of TASSEL,
By matrix (K obtained in the Q value of each kind obtained in step (2) population analysis and step (3) Genetic relationship
Matrix) all model is included in as covariant.Join using the average value of 2 years membership function values as the phenotypic data of Salt-Tolerance Identification
It closes the above molecular data and is associated analysis, if P < 0.01, then it is assumed that the marker site is and chrysanthemum salt tolerance tight association
Molecular labeling, while obtaining the phenotypic variation explanation rate R of the marker site2。
(table 4) as the result is shown, detects the molecular labeling of 3 with chrysanthemum salt tolerance tight association altogether, and conspicuousness is maximum
It is EST-SSR187-2 (P=0.0043).The phenotypic variation explanation rate range for being associated with site is 4.49%-5.36%, average out to
5.05%, wherein not only conspicuousness is maximum but also phenotypic variation explanation rate is also maximum by site EST-SSR187-2.The present invention obtains
This 3 with the significantly associated molecular labeling site of salt tolerance will be molecular mark technology from now in salt tolerance chrysanthemum
Important foundation is established in application in breed breeding.
Table 4 and the significant relevant marker site (P < 0.01) of salt tolerance
E19M16-3, amplimer is to for forward primer M16-TGAGTCCAAACCGGAGG (SEQ ID NO.1), reversely
Primer E19-TGTGGTCCGCAAATTTAG (SEQ ID NO.2)；(2) p1-3 amplimer is p1-
CAACAATGGCTACCACCA(SEQ ID NO.3)；(3) EST-SSR187-2 amplimer is to for forward primer 187F-
TAGGCGAACGAGTGTCAAGA (SEQ ID NO.4), reverse primer 187R-GCCATCAGTCTCTCCCTCAG (SEQ ID
NO.5)。
It is recognised that the illustrative embodiments that above-described embodiment uses only for illustrating inventive principle, however this hair
Bright to be not limited only to this, those skilled in the art can make various improvement and change in the case where not departing from real situation of the present invention, this
A little improvement and change also belong to protection scope of the present invention.
Claims (1)
1. application of one group of molecular marker and primer thereof in salt tolerance chrysanthemum breeding；The molecular labeling is by following three kinds points
Son label composition: (1) E19M16-3, P value are 0.0085, R2It is 4.49%, amplimer is to for forward primer M16 sequence such as SEQ
Shown in ID NO.1, reverse primer E19 sequence is as shown in SEQ ID NO.2；(2) p1-3, P value are 0.0046, R2It is 5.29%, expands
Increasing primer is p1 sequence as shown in SEQ ID NO.3；(3) EST-SSR187-2, P value are 0.0043, R2It is 5.36%, amplification is drawn
Object is to being forward primer 187F sequence as shown in SEQ ID NO.4, and reverse primer 187R sequence is as shown in SEQ ID NO.5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510587614.9A CN105112403B (en) | 2015-09-15 | 2015-09-15 | Chrysanthemum salt tolerance is associated with molecular labeling and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510587614.9A CN105112403B (en) | 2015-09-15 | 2015-09-15 | Chrysanthemum salt tolerance is associated with molecular labeling and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105112403A CN105112403A (en) | 2015-12-02 |
| CN105112403B true CN105112403B (en) | 2019-06-21 |
Family
ID=54660517
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510587614.9A Active CN105112403B (en) | 2015-09-15 | 2015-09-15 | Chrysanthemum salt tolerance is associated with molecular labeling and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105112403B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498475A (en) * | 2014-11-26 | 2015-04-08 | 南京农业大学 | Obtaining method and application of molecular markers related to chrysanthemum drought resistance |
| CN106446596B (en) * | 2016-07-15 | 2019-04-30 | 南京农业大学 | To the significant relevant molecular labeling of waterlogging tolerance of chrysanthemum and its identification method and application |
| CN107338295A (en) * | 2017-07-20 | 2017-11-10 | 扬州大学 | A kind of waterlogging phenotype of eggplant and the method for SSR molecular marker association analysis |
| CN107815502B (en) * | 2017-11-23 | 2021-06-08 | 南京农业大学 | dCAPS marker development and application for identifying waterlogging tolerance of chrysanthemum |
| CN116732222B (en) * | 2023-05-26 | 2024-03-15 | 南京农业大学 | Method for efficiently predicting salt tolerance of chrysanthemum based on whole genome |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498475A (en) * | 2014-11-26 | 2015-04-08 | 南京农业大学 | Obtaining method and application of molecular markers related to chrysanthemum drought resistance |
-
2015
- 2015-09-15 CN CN201510587614.9A patent/CN105112403B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498475A (en) * | 2014-11-26 | 2015-04-08 | 南京农业大学 | Obtaining method and application of molecular markers related to chrysanthemum drought resistance |
Non-Patent Citations (2)
| Title |
|---|
| 32 个菊花近缘种属植物耐盐性筛;管志勇 等;《中国农业科学》;20101008;第43卷(第19期);4063-4071 |
| 栽培菊花与菊属-近缘属属间杂种杂交后代耐盐性的遗传分析;许莉莉 等;《生态学报》;20130823;第33卷(第16期);4902-4908 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105112403A (en) | 2015-12-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105112403B (en) | Chrysanthemum salt tolerance is associated with molecular labeling and its preparation method and application | |
| Chang | Origin, domestication, and diversification | |
| Csilléry et al. | Adaptation to local climate in multi-trait space: evidence from silver fir (Abies alba Mill.) populations across a heterogeneous environment | |
| CN106446596B (en) | To the significant relevant molecular labeling of waterlogging tolerance of chrysanthemum and its identification method and application | |
| CN104498475A (en) | Obtaining method and application of molecular markers related to chrysanthemum drought resistance | |
| Martínez-Castillo et al. | Wholesale replacement of Lima bean (Phaseolus lunatus L.) landraces over the last 30 years in northeastern Campeche, Mexico | |
| CN104450694A (en) | q SRBSDV6 (Southern rice black-streaked dwarf virus 6) and molecular marker method thereof | |
| CN107190011A (en) | The gene of the coding myosin of one cotton quality trait associations | |
| CN105368927B (en) | Molecular labeling genSSR3000 and acquisition, application with capsicum CMV resistant gene close linkages | |
| CN108486273B (en) | Excavation and application of SSR (simple sequence repeat) markers on chromosome 5 and closely linked with salt-tolerant QTL (quantitative trait locus) of rice | |
| Heinonsalo et al. | Scots pine bait seedling performance and root colonizing ectomycorrhizal fungal community dynamics before and during the 4 years after forest clear-cut logging | |
| Serrano et al. | Response to Verticillium dahliae infection in a genetically diverse set of olive cultivars | |
| CN106498063A (en) | A kind of breeding method of molecular marker assisted selection orderly improvement tobacco black shank resistance | |
| CN105850722B (en) | A kind of breeding method of stabilization, homozygous tobacco chromosome Single Segment Substitution Lines in Rice | |
| CN112725521B (en) | Dendrobium chrysotoxum SSR molecular marker primer composition and application thereof | |
| CN105602948A (en) | Genes and method for identifying gossypium hirsutum linn. variety verticillium wilt resistance by fluorescence quantitative PCR technique | |
| CN108703063A (en) | It is a kind of using the polymerization improved Rice Heading blooming stage of single slice substitution line and the molecular breeding method of pustulation period heat resistance | |
| CN105368824B (en) | Molecular labeling GI1354 and acquisition, application with capsicum CMV resistant gene close linkages | |
| CN105349677B (en) | Recover round-grained rice Rice Resistance black streak dwarf site and molecule labelling method | |
| Malvolti et al. | Black locust (Robinia pseudoacacia L.) root cuttings: diversity and identity revealed by SSR genotyping: A case study | |
| CN113943732A (en) | SNP (Single nucleotide polymorphism) marker related to heat resistance of cucumber in adult stage, primer group, kit and application | |
| CN108504760B (en) | QTL excavation and application of excellent salt-tolerant resources of rice | |
| CN108410967B (en) | A kind of method of Rapid identification river camellia tradition famous-object | |
| Li et al. | Ploidy levels and DNA contents of Bougainvillea accessions determined by flow cytometry analysis | |
| CN104313143A (en) | Molecular marker closely interlocked with anti-anthracnose gene locus of common beans and detection method of molecular marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |