CN105602948A - Genes and method for identifying gossypium hirsutum linn. variety verticillium wilt resistance by fluorescence quantitative PCR technique - Google Patents

Genes and method for identifying gossypium hirsutum linn. variety verticillium wilt resistance by fluorescence quantitative PCR technique Download PDF

Info

Publication number
CN105602948A
CN105602948A CN201510790841.1A CN201510790841A CN105602948A CN 105602948 A CN105602948 A CN 105602948A CN 201510790841 A CN201510790841 A CN 201510790841A CN 105602948 A CN105602948 A CN 105602948A
Authority
CN
China
Prior art keywords
gene
seqidno
resistance
verticillium
verticillium wilt
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201510790841.1A
Other languages
Chinese (zh)
Other versions
CN105602948B (en
Inventor
郭宝生
王凯辉
赵存鹏
李军英
耿军义
刘素恩
王兆晓
马玉柱
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute Of Cotton Hebei Academy Of Agriculture And Forestry Sciences
Original Assignee
Institute Of Cotton Hebei Academy Of Agriculture And Forestry Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute Of Cotton Hebei Academy Of Agriculture And Forestry Sciences filed Critical Institute Of Cotton Hebei Academy Of Agriculture And Forestry Sciences
Priority to CN201510790841.1A priority Critical patent/CN105602948B/en
Publication of CN105602948A publication Critical patent/CN105602948A/en
Application granted granted Critical
Publication of CN105602948B publication Critical patent/CN105602948B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses genes and method for identifying gossypium hirsutum linn. variety verticillium wilt resistance by a fluorescence quantitative polymerase chain reaction (PCR) technique; the genes have the sequences shown in SEQ ID No:1 and SEQ ID No:2 in a sequence table. The method comprises the identification steps: (1) culturing seedlings of a to-be-tested cotton variety in a nutrition pot in a culture room; (2) culturing verticillium wilt pathogenic bacteria; (3) dipping roots, and inoculating; (4) extracting total RNA; (5) synthesizing cDNA; (6) synthesizing fluorescence quantitative PCR specific primers of a gossypium hirsutum linn. resistance related key gene and an internal reference gene GhACTIN14; (7) carrying out fluorescence quantitative PCR detection; and (8) analyzing a result. The genes and the method can identify resistance to verticillium wilt in a six-leaf stage of the gossypium hirsutum linn. variety, the identification result is reliable, the accuracy rate can reach 100%, and the operation is simple and easy to implement.

Description

Utilize gene and the method for fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium
Technical field
The invention belongs to cotton breeding field, relate to gene and the method for qualification Upland Cotton resisting verticillium, particularlySay, relate to gene and the method for utilizing fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium.
Background technology
Cotton verticillium wilt be caused by verticillium dahliae affect one of the most serious disease of Upland Cotton, due to shortageEffectively chemical prevention medicament, only has the raising that relies on cotton variety resistance to reduce production loss, and therefore cotton variety is anti-yellowingThe disease of withering qualification is the necessary means of cultivating resisting verticillium kind. Mainly contain for cotton variety resistance to verticillium wilt authentication method at presentTwo large classes, a class is field identification method, as Infected Field qualification and Artificial disease nursery qualification; One class is qualification side in indoor seedling stageMethod, dips in that bacterium method, acupuncture bacterination process, paper pot are torn end method, the bottomless alms bowl bacterium liquid of moulding waters Gen Fa and toxin qualification as naked.
In field identification method, Artificial disease nursery qualification is considered to approach most nature reality, the most reliable disease-resistant qualification sideMethod, in breeding for disease resistance process application the most general, but this authentication method is identified that disease garden limits, and is subject to the shadow of weather conditionsRing, generally need 2-3 repetitive identified just can go out result, last oversize. Greenhouse Disease garden identification also needs the time about half a year,Qualification time is long, can not accomplish early diagnosis.
Paper pot tears end method to maximum the mainly containing of application at present of indoor sprout period authenticating method, the bottomless alms bowl bacterium liquid of moulding waters root method etc.,But hinder root degree and be difficult to accomplish unified due to these methods, (simple osmanthus is good, and 2001. simple osmanthus are good, Sun Wen to cause experiment to produce errorA Ji, Ma Cun. cotton verticillium wilt Resistance Identification new method--the bottomless alms bowl bacterium liquid of moulding waters root method [J]. Cotton Science, 2001,13 (2):67-69.). And acupuncture bacterination process makes verticillium wilt pathogen force to invade cotton plant fibrovascular system, run counter to germ under field conditions (factors)Regularity of infection, make cotton self part defence system lost efficacy, can not objectively respond expert evidence resistance (history is recognized brightness. cottonThe research of flower resisting verticillium authenticate technology. Hua Zhong Agriculture University's master thesis, 2010)). Toxin identification method, needs to extract thickToxin, more loaded down with trivial details, and compared with said method, cotton seedling often show as morbidity lay particular stress on (Du Weishi, 2003, Du Weishi. cotton yellowThe disease of withering genetics of resistance and molecule marking research .[master thesis). Baoding: library of Agricultural University Of Hebei, 2003).
Guo Baosheng etc. (Guo Baosheng, wangkai brightness, Liu Suen, Zhao Cunpeng, Geng Junyi, Zhang Xiangyun, Hua Jinping. upland cotton is anti-yellowingThe disease of withering germplasm innovation and disease-resistant gene excavate. Cotton Science, 2014,26 (3): 252-259.) and research shows, plant is subject to upland cottonAfter infecting to verticillium wilt pathogen, the inner meeting of plant forms physical obstacle or biochemical obstacle contains that verticillium dahliae expands in vivoExhibition, but because the disease-resistant gene expression regulation level of different cultivars differs, thereby there is disease-resistant difference. With resistance to verticillium wilt phaseCorrelation gene mainly contains phytoalexin synthesis related gene, plant tissue's structure Buchner's bodies related gene etc. This verticillium wiltThe differential expression that bacterium is infected lower different Upland Cotton disease-resistant related genes can detect by fluorescent quantitative PCR technique((Guo Baosheng, Shi Gongyao, etc., verticillium wilt pathogen infects the variance analysis of lower cotton Dirigent-like protein gene expression. Chinese agricultureIndustry science, 2014,47 (22): 4349-4359.). Fluorescent quantitative PCR technique (BustinSA, BenesV, NolanT,PfafflMW.Quantitativereal-timeRT-PCR-Aperspective.JournalofMolecularEndocrinology, 2005,34:597-601.) be by fluorescent dye or fluorescently-labeled specific probe, to PCR productCarry out mark tracking, monitor in real time course of reaction. Along with the carrying out of PCR reaction, product is constantly accumulated, fluorescence signal intensityAlso equal proportion increases. Every through a circulation, collect first order fluorescence strength signal, so just can supervise by fluorescence intensity changeSurvey the variation of product amount.
Summary of the invention
Object of the present invention is exactly the defect for fear of above-mentioned field and indoor sprout period authenticating method, provides and utilizes fluorescenceGene and the method for quantitative PCR technique qualification Upland Cotton resistance to verticillium wilt. The present invention is in the 6 leaf phases of cotton variety seedling,Utilizing is subject to verticillium wilt pathogen to infect lower 2 the relevant key genes of resistance, i.e. phytoalexin synthesis related gene classes to upland cotton---Multidirectional resistance to poison gene and plant tissue's structure Buchner's bodies related gene---lateralorganboundariesWhether the differential expression of domainfamilyprotein transcripton fluorescent quantitation identifies Upland Cotton is resisting verticillium productKind.
Upland Cotton resisting verticillium qualification related gene, it comprises multidirectional resistance to shown in SEQ ID NO:1Transcripton gene shown in virulent gene and SEQIDNO:2.
The pcr amplification special primer of Upland Cotton resisting verticillium qualification related gene, multidirectional resistance to poison gene specialPrimer upstream sequence is shown in SEQIDNO:3, and downstream sequence is shown in SEQIDNO:4; Transcripton gene specific primer upstream sequence is shown inSEQIDNO:5, downstream sequence is shown in SEQIDNO:6.
The method of utilizing fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium, 1. the method comprises the steps:Cotton variety nutritive cube to be measured culturing room grows seedlings; 2. verticillium wilt Pathogen culture; 3. germ is soaked root inoculation: the disease of 2. cultivating by stepThe seedling that 1. bacterium bacterium liquid be bred as step is soaked root inoculation; 4. total RNA extracts: win the children that step is crossed by infection process in 3.Tender of seedling, extracts the total RNA of blade; 5. cDNA is synthetic; 6. key gene relevant to upland cotton resistance is SEQIDNO:1 and SEQGene shown in IDNO:2, and the quantitative fluorescent PCR special primer of reference gene GhACTIN14 is synthetic; 7. fluorescent quantitationPCR detects; 8. interpretation of result.
Step 1. described cotton variety nutritive cube to be measured culturing room is grown seedlings and is adopted papery nutritive cube training in plastic boxGrow seedlings in foster chamber, condition of culture: 28 DEG C of left and right of mean temperature, keep illumination 14 hours every day.
Step 3. described germ is soaked root inoculation, refers to when cotton variety seedling to be measured grew to for 6 leaf phases and starts to carry out germSoak root inoculation, germ spore concentration is 106-108The spore suspension of individual/ml.
Step 4. described total RNA is extracted, extraction be total in tender of the seedling of germ inoculation while infecting 0h and 48hRNA;
Step 5. described cDNA synthetic reaction system is total RNA2ul that step is extracted in 4., Anchoredoligo(dT)18primer(0.5ug/ul)1ul,2×TSReactionMix10ul,TranscriptRT/R1EnzymeMix1ul,gDNARemover1ul,Rnase-freewater5ul。
Step 6. described key gene relevant to upland cotton resistance and reference gene GhACTIN14 fluorescent quantitationPCR special primer synthetic, synthetic primer GC content 50%, Tm is at 60 DEG C-62 DEG C, length 18-22 nucleotides, amplified fragments80-150bp; Synthetic multidirectional resistance to poison gene specific primer sequence: upstream sequence AAGGCTGACGATAGGAGAAATG (SEQIDNO:3), downstream sequence GAAAGGTGGTGGAGCTATCTAAG (SEQIDNO:4); Synthetic lateralorganBoundariesdomainfamilyprotein transcripton gene specific primer sequence: upstream sequenceAGCTATTCAAACCCACCATGT (SEQIDNO:5), downstream sequence GGCTCTTCTGGTGGGAAATAG (SEQIDNO:6); Reference gene GhACTIN14 special primer sequence: upstream sequence CTTATGTTGCCCTGGACTATGA (SEQIDNO:7),Downstream sequence CGGAATCTCTCAGCTCCAATAG (SEQIDNO:8).
7. described fluorescence quantitative PCR detection of step, reaction system isPremixExTaqTM10ul,Special upstream primer (10pm/ul) 0.4ul of step synthetic corresponding detected gene in 6., downstream primer (10pm/ul)0.4ul, ROXReferenceDye0.4ul, sterile purified water 7.8ul, cDNA2ul. RT-PCR response procedures: denaturation95 DEG C, 30s; 95 DEG C, 5s, 60 DEG C, 34s, 40 circulations.
The examination criteria of 8. interpretation of result of step institute foundation is to utilize relative quantification 2 for quantitative fluorescent PCR data acquisition-ΔΔCtMethod, after inoculation verticillium wilt pathogen, the multidirectional resistance to poison gene of 48h relative expression quantity is doubly worth and is greater than 2 and lateralorganBoundariesdomainfamilyprotein transcripton relative expression quantity is doubly worth the disease-resistant variety that is judged to be that is less than 1; ?After inoculation verticillium wilt pathogen, the multidirectional resistance to poison gene of 48h relative expression quantity is doubly worth and is less than 1 and lateralorganboundariesDomainfamilyprotein transcripton relative expression quantity is doubly worth the susceptible variety that is judged to be that is greater than 2.
Useful technique effect of the present invention:
(1) early diagnosis. In the 6 leaf phases of upland cotton seedling, sowing cotton seed is grown seedlings in 20 days and just can be identified its resistance.
(2) reliable, accurate. The present invention discloses the disease resistance of Upland Cotton from gene expression dose, reliability is high; SimultaneouslyDetect for 2 genes, improved the qualification degree of accuracy, the qualification result degree of accuracy reaches 100%.
(3) simple and easy to do. Key gene quantitative fluorescent PCR special primer used in the present invention is synthesized by specialized company,Instrument equipment is that general Molecular Biology Lab all possesses, and agents useful for same is also common reagent, without independent preparation,According to operating procedure of the present invention, general scientific research personnel can carry out the Resistance Identification of Upland Cotton.
Brief description of the drawings
Fig. 1 is grow seedlings papery nutritive cube and the plastic box schematic diagram of use; In figure, it is 1. plastic box; 2. be nutritive cube.
Fig. 2 is disease-resistant variety Ji 79 and the susceptible germplasm TM-1 multidirectional resistance to poison gene while being subject to verticillium wilt pathogen to infect 0h-96hFluorescent quantitation relative expression quantity.
Fig. 3 is disease-resistant variety Ji 79 and the susceptible germplasm TM-1 lateralorgan while being subject to verticillium wilt pathogen to infect 0h-96hBoundariesdomainfamilyprotein transcripton gene by fluorescence quantitative relative expression quantity.
Fig. 4 is Ji 228 cotton varieties multidirectional resistance to toxoprotein gene and lateral while being subject to verticillium wilt pathogen to infect 0h, 96hThe fluorescent quantitation relative expression quantity of organboundariesdomainfamilyprotein.
Fig. 5 is Ji 122 cotton varieties multidirectional resistance to toxoprotein gene and lateral while being subject to verticillium wilt pathogen to infect 0h, 96hThe fluorescent quantitation relative expression quantity of organboundariesdomainfamilyprotein.
Fig. 6 is Ji 1096 cotton varieties multidirectional resistance to toxoprotein gene and lateral while being subject to verticillium wilt pathogen to infect 0h, 96hThe fluorescent quantitation relative expression quantity of organboundariesdomainfamilyprotein.
Fig. 7 is Handan 885 cotton varieties multidirectional resistance to toxoprotein gene and lateral while being subject to verticillium wilt pathogen to infect 0h, 96hThe fluorescent quantitation relative expression quantity of organboundariesdomainfamilyprotein.
Below in conjunction with specific embodiment, the present invention is further elaborated, but the model not limiting the present invention in any wayEnclose.
Detailed description of the invention
Following embodiment is convenient to understand better the present invention, but does not limit the present invention. Experiment in following embodimentMethod, if no special instructions, is conventional method. Test material used in following embodiment, if no special instructions, be fromRoutine biochemistry reagent shop is purchased available. Quantitative test in following examples, all arranges and repeats experiment for three times, and result is made evenAverage. Upland cotton is transcribed group sample high-flux sequence and specific fluorescence quantitative PCR special primer used by raw work bioengineeringShanghai Co., Ltd is synthetic. Primerexpress3.0 software used is AppliedBiosystems company. Resisting verticillium product(Guo Baosheng etc., it is the genetic analysis of resisting verticillium proterties that Interspecific Hybridization In Cotton gradually oozes to plant Ji 79. North China agronomy report, 2008,23 (s):240-243) provided by Hebei Prov. Academy of Agricultural &. Forest Sciences's Cotton Research Institute, TM-1 is by the Chinese Academy of Agricultural Sciences for sense verticillium wilt cotton strainCotton Research Institute provides, and (Guo Baosheng etc., it is the genetic analysis of resisting verticillium proterties that Interspecific Hybridization In Cotton gradually oozes in Ji 1096. North China agricultureJournal, 2008,23 (s): 240-243), Ji 228, Ji 122 Upland Cottons carried by Hebei Prov. Academy of Agricultural &. Forest Sciences's Cotton Research InstituteConfession, Handan 885 is provided by the Handan Agriculture academy of sciences.
The acquisition of embodiment 1, upland cotton resisting verticillium key gene
1) grow seedlings: the upland cotton resisting verticillium kind to be checked Ji 79 of the sulfuric acid lint of learning from else's experience respectively stalwartness, sense verticillium wilt strainThe seed of TM-1, adopts papery nutritive cube (seeing Fig. 1) culturing room in plastic box to grow seedlings. Seedling medium vermiculite high-temperature sterilization(121 DEG C of temperature, pressure 0.6Mpa, 1 hour), water is moistening, makes water content of substrate reach 60% of own wt and is advisable, every alms bowlSow 3, after seedling emerges, every alms bowl only stayed for 1 strain strong sprout. Nutrient solution adopts Hoagland nutrient solution (the calcium nitrate 945mg/ of 1 timesL, potassium nitrate 607mg/L, ammonium phosphate 115mg/L, magnesium sulfate 493mg/L, iron salt solutions 2.5ml/L, micro-5ml/L, pH=6.0; Iron salt solutions: ferrous sulfate heptahydrate 2.78g, disodium ethylene diamine tetraacetate (EDTANa) 3.73g, distilled water 500ml,PH=5.5; Liquid microelement: KI 0.83mg/L, boric acid 6.2mg/L, manganese sulfate 22.3mg/L, zinc sulfate 8.6mg/L, molybdenumAcid sodium 0.25mg/L, copper sulphate 0.025mg/L, cobalt chloride 0.025mg/L) infiltrate and cultivate. Rough leaf will be prepared after launchingHoagland nutrient solution, pour in the plastic box being equipped with outside papery nutritive cube, make nutrient solution by nutritive cube bottom slowlyInfiltrate matrix, Turnover Box inner bottom part nutrient solution height keeps 1cm left and right. Culturing room's condition of culture: 28 DEG C of mean temperatures left and right (daytimeTemperature 30-32 DEG C, night temperature 26-28 DEG C), keep illumination 14 hours every day.
2) Pathogen culture: (Chinese Academy of Agricultural Sciences plants by the 4 DEG C of strong pathogenicity fungus strain of cryopreserved verticillium wilt pathogen Vd991Thing protection research institute provides) be transferred in PDA plating medium, in 25 DEG C of incubators, cultivate 7-10d, then bacterium colony is broken intoThe bacterium piece of suitable size, is inoculated in and fills Czapeak ' s nutrient solution (NaNO32g,K2HPO41g,KCl0.5g,MgSO40.5g,FeSO40.01g, sucrose 30g, agar 15g, water 1000ml; 121.3 DEG C, sterilizing 20 minutes) triangular flask in,Under 110rpm/min25 DEG C of condition, after shaken cultivation 7d, 4 DEG C of refrigerations are for subsequent use.
3) germ inoculation: in the time that the seedling of Ji 79 and TM-1 kind grows to 6 true leaves, get respectively step 1) the middle Ji being bred as79 kind seedling 20 alms bowls and TM-1 kind 20 alms bowls, and be respectively divided into two groups of experimental group and control groups, every group of 10 strains. Get above-mentioned steps 2)The bacterium liquid filtered through gauze of middle cultivation, adds up filtrate spore count under the microscope, in another clean plastic box, uses nothingBacterium water is mixed with spore concentration and is about 1 × 107The spore suspension of individual/ml, immediately by the experimental group seedling band nutrition of two kindsAlms bowl proceeds in spore suspension and soaks root inoculation, washes nutritive cube spore outside and plant surface outstanding after 1 hour with pure waterSupernatant liquid, and proceeded to continuation cultivation in clean Turnover Box. Control group seedling band nutritive cube is at pure water logging root after 1 hour,Same being proceeded in clean Turnover Box continues to cultivate.
4) total RNA extracts: choose at random 5 strain experimental group and inoculated the cotton variety to be measured plant of 96 hours of infecting by germYoung leaflet tablet, utilize improvement CTAB method (Hu Genhai, analogy tree is fast. utilize the CTAB method of improvement to extract the total RNA. cotton of cotton leafAnthology report, 2007,19 (1): 69-70.) extract the total RNA of blade, use the same method simultaneously and extract the children of control group cotton plantsTotal RNA of leaflet tablet. Utilize respectively ultramicron nucleic acid-protein to measure the total rna concentration of the experimental group of extraction and control sampleInstrument detects total rna concentration, and uses ddH2O is diluted to 100ug/ml, and subzero 20 DEG C of conditions are in store for.
5) upland cotton is transcribed the acquisition of group sample high-flux sequence and resisting verticillium related gene: by step 4) in infect 96Hour RNA extract offer Shanghai bioengineering Co., Ltd, by Shanghai, bioengineering Co., Ltd utilizes IlluminaThe Hiseq2000 of company order-checking platform checks order, and by the sequence obtaining and public database carry out homology search, comparison,Annotation of gene function and classification. RNA-Seq order-checking and the work of related data preliminary analysis are completed by Shanghai bio-engineering corporation.
Totally 2.2 hundred million of effective RNA-seq data are finally obtained, data volume 21G, average length 95.12bp; Single sampleSequencing data amount is all more than 4G. Remove by splicing, redundancy, obtained 143973 Unigene. Carry out KOG(EukaryoticOrthologousGroupsofproteins, Eukaryotic homologous protein group) Function Classification is pre-Survey (in table 1), have 18544 annotated upper 25 kinds of KOG classification of Unigene. Unigene is carried out to GO (geneontologyThe database that the GeneOnotologyConsortium of gene ontology federation sets up) Function Classification prediction (in table 2),There are 47702 annotated upper GO classification of Unigene.
Table 1KOGs Function Classification
Table 2GO Function Classification
Use IDE6software to detect and select GeneralChisquared hypothesis testing side differential geneMethod, and assay is carried out to FDR (falsediscoveryrate) and correct, FDR controlled lower than 0.01, and gene isWhen high expressed amount reaches 2 times of minimum expression, think that this gene is differential gene. Gene to the differential expression filtering out doesExpression pattern cluster analysis, carries out cluster by the gene with same or similar expression behavior. Utilize Unigene sequence and all kinds ofThe GO function enrichment annotation of Unigene is done respectively in the comparison of gene function database, and (capital of a country gene and genome encyclopaedia are complete for KeggBook) metabolic pathway enrichment annotation, COG (ClusterofOrthologousGroupsofproteins, the adjacent class of albumenCluster) annotation of gene function such as function enrichment analysis. Experimental group (being infected by verticillium wilt pathogen) and control group be not (by verticillium wiltBacterium is infected) between sample the analysis of differential expression transcript show, the common Unigene252 raising of disease-resistant variety Ji 79 and TM-1Individual, independent 527 of raising in Ji 79, independent 5490 of raising of TM-1; Wherein common 144 of lowering, lower separately Ji 79485,701 of lowering separately of TM-1. And the common Unigene168 raising of the anti-sense kind that GO annotates, Ji 79255 of rise separately, independent 2582 of raising of TM-1; The common Unigene78 lowering of anti-sense kind, Ji 79 is independentLower 196, and TM-1 lowers separately 363. It is extremely aobvious that disease-resistant variety Ji 79 verticillium wilt pathogens infect rear transcript difference10 metabolic pathways of work relate generally to phenylpropyl alcohol alkane route of synthesis, galactolipin metabolism, aminobenzoic acid metabolic, flavonoids flavones and closeBecome (as table 3) such as metabolic pathway, diterpenoids metabolic pathways. To key gene screening in the extremely remarkable metabolic pathway of these differences,Find multidirectional resistance to poison gene (seeing sequence table SEQ IDNO.1) and lateralorganboundariesdomain2 genes of familyprotein transcripton (seeing sequence table SEQ IDNO.2) have important work in upland cotton resisting verticilliumWith. The expression product PDR albumen of multidirectional resistance to poison gene may be by the antimycotic Diterpenes material of transhipment endogenous involved in plantDefense reaction (SimonG., theLR34proteinresemblesATP-bindingcassettetransportersofthepleiotropicdrugresistancesubfamily.Science,2009,DOI:10.1126/science.1166453;StukkensY,BultreysA,GrecS,etal.NpPDR1,apleiotropicdrugresistance-typeATP-bindingcassettetransporterfromNicotianaplumbaginifolia,playsamajorroleinplantpathogendefense.PlantPhysiol, 2005,139 (1): 341-52). And lateralorganboundariesdomainfamilyproteinTranscripton in the jasmonate acid signal pathway of arabidopsis defense reaction, can be considered susceptible gene (ThatcherLF,PowellJJ,AitkenEA,KazanK,MannersJM.ThelateralorganboundariesdomaintranscriptionfactorLBD20functionsinFusariumwiltSusceptibilityandjasmonatesignalinginArabidopsis.PlantPhysiol,2012,160(1):407-18.)。
Table 3 disease-resistant variety Ji 79 verticillium wilt pathogens infect the extremely significant metabolic pathway of rear transcript difference
Embodiment 2: multidirectional resistance to poison gene, lateralorganboundariesdomainfamilyproteinSynthesizing of transcripton and reference gene GhACTIN14 quantitative fluorescent PCR special primer
Utilize primerexpress3.0 software (Primer_Express_v3.0_ Chinese operation manual, AppliedBiosystems company) according to embodiment 1 step 5) obtain multidirectional resistance to poison gene and lateralorganBoundariesdomainfamilyprotein transcripton and known reference gene GhACTIN14 (GenBankAccessionNumber:AY305733) nucleotide sequence designs special fluorescence quantification PCR primer, primer GC content50%, Tm is at 60 DEG C-62 DEG C, length 18-22 nucleotides, amplified fragments 80-150bp. Entrust Shanghai bio-engineering corporation completeBecome (in table 4).
The multidirectional resistance to poison gene of table 4, lateralorganboundariesdomainfamilyprotein transcribeSon and reference gene GhACTIN14 quantitative fluorescent PCR special primer sequence
Embodiment 3: the multidirectional resistance to poison gene of key gene relevant to upland cotton resistance and lateralorganThe acquisition of boundariesdomainfamilyprotein transcripton examination criteria
The present embodiment utilizes resisting verticillium kind Ji 79 and sense verticillium wilt cotton strain TM-1 kind as the detection of calibratingSample.
1) grow seedlings: the kind of the resisting verticillium kind Ji 79 of the sulfuric acid lint of learning from else's experience stalwartness and sense verticillium wilt cotton strain TM-1Son, adopts papery nutritive cube culturing room in plastic box to grow seedlings. Seedling medium vermiculite high-temperature sterilization (121 DEG C of temperature, pressure0.6Mpa, 1 hour), water is moistening, makes water content of substrate reach 60% of own wt and is advisable, 3 of every alms bowl sowings, and seedling goes outAfter seedling, every alms bowl only stayed for 1 strain strong sprout. Nutrient solution adopts Hoagland nutrient solution (calcium nitrate 945mg/L, the potassium nitrate 607mg/ of 1 timesL, ammonium phosphate 115mg/L, magnesium sulfate 493mg/L, iron salt solutions 2.5ml/L, micro-5ml/L, pH=6.0; Iron salt solutions:Ferrous sulfate heptahydrate 2.78g, disodium ethylene diamine tetraacetate (EDTANa) 3.73g, distilled water 500ml, pH=5.5; Trace unitElement liquid: KI 0.83mg/L, boric acid 6.2mg/L, manganese sulfate 22.3mg/L, zinc sulfate 8.6mg/L, sodium molybdate 0.25mg/L,Copper sulphate 0.025mg/L, cobalt chloride 0.025mg/L) infiltrate and cultivate. After rough leaf is launched, by the Hoagland battalion of preparationNutrient solution, pours in the plastic box being equipped with outside papery nutritive cube, makes nutrient solution slowly infiltrate matrix, turnover by nutritive cube bottomCase inner bottom part nutrient solution height keeps 1cm left and right. Culturing room's condition of culture: 28 DEG C of left and right of mean temperature (temperature 30-32 DEG C of daytime, nightTemperature 26-28 DEG C), keep illumination 14 hours every day.
2) Pathogen culture: with embodiment 1 step 2).
3) germ is soaked root inoculation: in the time that kind to be measured Ji 79 and TM-1 seedling grow to 6 true leaves, get step 2) in cultivateBacterium liquid filtered through gauze, adds up filtrate spore count under the microscope, in another clean plastic box, prepares with sterilized waterBecome spore concentration to be about 1 × 107The spore suspension of individual/ml, gets step 1 immediately) in 20 alms bowl seedling bands nutritive cubes proceed to sporeIn suspension, soak root inoculation. After 1 hour, wash the spore suspension on nutritive cube outside and plant surface with pure water, and by itProceed in clean Turnover Box and continue to cultivate.
4) total RNA extracts: choosing at random respectively 5 strains, to be inoculated by germ the Ji to be measured 79 and the TM-1 cotton variety 0 that infect littleTime, the plant young leaflet tablet of 1 hour, 8 hours, 24 hours, 48 hours, 72 hours, 96 hours, utilize the CTAB method of improvement (recklesslyRoot sea, analogy tree is fast. and utilize the CTAB method of improvement to extract the total RNA. Cotton Science of cotton leaf, 2007,19 (1): 69-70.) extractThe total RNA of blade. The kind to be measured of extracting is infected to sample total rna concentration utilizes respectively ultramicron nucleic acid-protein analyzer always to detectRNA concentration, and use ddH2O is diluted to 100ug/ml, and subzero 20 DEG C of conditions are in store for.
5) cDNA is synthetic: utilize respectively step 4) in the Ji of being infected 79 of extracting and TM-1 kind 0 hour, 1 hour, 8Hour, 24 hours, 48 hours, 72 hours, 96 hours total RNA, adopt the TransScript of Beijing Quan Shijin biotech companyOne-StepgDNARemovalandcDNASynthesisSuperMix reverse transcription kit generates the first chain cDNAAs the template of quantitative fluorescent PCR, remove step 4 simultaneously) in genomic DNA in total RNA of extracting. Reaction system is: total RNA2ul,Anchoredoligo(dT)18primer(0.5ug/ul)1ul,2×TSReactionMix10ul,TranscriptRT/R1EnzymeMix1ul, gDNARemover1ul, Rnase-freewater5ul. Mixed gentlyAfter even, hatch 30min for 42 DEG C. 85 DEG C of heating 5min inactivation TransScriptRT.
6) fluorescence quantitative PCR detection: fluorescence quantitative PCR detection is used SYBRgreenPCR kit (AppliedBiosystems company) labeled reactant product. Analytical instrument is Appliedbiosystems7500realtimePCRSystem, using cotton GhACTIN14 (GenBank:AY305733) is that (Guo Baosheng etc., verticillium wilt pathogen infects lower land to interior markThe variance analysis of cotton Dirigent-like protein gene expression, Scientia Agricultura Sinica, 2014,47 (22): 4349-4359.). ReactionSystem:PremixExTaqTM10ul, it is corresponding to the special upstream primer of cls gene that embodiment 2 synthesizes(10pm/ul), the each 0.4ul of downstream primer (10pm/ul), ROXReferenceDye0.4ul, sterile purified water 7.8ul, stepSynthetic cDNA2ul in rapid 5. RT-PCR response procedures: 95 DEG C of denaturations, 30s; 95 DEG C, 5s, 60 DEG C, 34s, 40 circulations. 3Inferior technology repeats.
7) interpretation of result: utilize relative quantification 2 for quantitative fluorescent PCR data acquisition-ΔΔCtMethod (BustinSA, BenesV,NolanT,PfafflMW.Quantitativereal-timeRT-PCR-Aperspective.JournalofMolecularEndocrinology, 2005,34:597-601.), infect 0 hour testing sample gene relative expression to inoculateAmount is for being substantially doubly worth 1, and relative expression quantity is doubly worth and more than 2 is high expressed, and relative expression quantity is doubly worth below 1 and is low expression, tiesFruit is for (in table 5, Fig. 2, Fig. 3): disease-resistant variety Ji 79 and susceptible variety TM-1 inoculate while just having started many connecing 0 hour bacterium timeRelative to 2 genes of resistance to poison gene and lateralorganboundariesdomainfamilyprotein transcriptonExpression be consistent be 1, but along with the passing of verticillium wilt pathogen time of infection, there is differential expression in 2 genes. Multidirectional resistance to poisonProperty gene in disease-resistant variety Ji 79 along with the passing of verticillium wilt pathogen time of infection, expression be reduction-rising-reduce again-The trend raising again, reaches high power value 3.1 at 48h expression; And in susceptible variety TM-1 expression be also reduction-literHigh-to reduce again-trend of rising again, but never reach the high expression level that is doubly worth 2. LateralorganWhen boundariesdomainfamilyprotein transcripton gene infects along with verticillium wilt pathogen in disease-resistant variety Ji 79Between passing, expression is the trend of reduction-rising-reduce again-raise again, but doubly a value is less than 1 always, in low tableReach level; In susceptible variety TM-1, expression is also first the trend that reduce-raise-reduces again-raise, is connecing equallyKind 48h expression is doubly worth the highest, reaches 8.4 high expression level. Often to resistance to poison gene and lateralorganThe expression rule of boundariesdomainfamilyprotein transcripton gene, finds that inoculation is when 48h between anti-sense kindExpression times value difference maximum (table 5), i.e. the expression of multidirectional resistance to poison gene in disease-resistant variety Ji 79 and susceptible variety TM-1 is doublyValue difference is that 2.21, lateralorganboundariesdomainfamilyprotein transcripton gene is at disease-resistant varietyJi 79 is 7.61 with the expression times value difference in susceptible variety TM-1, so select the relative expression quantity times of two genes of inoculation 48hValue is as the index of Analysis and Identification Upland Cotton resisting verticillium. Be the disease-resistant and susceptible criteria for classifying: utilize quantitative fluorescent PCRRelative quantification 2 for data acquisition-ΔΔCtMethod, after inoculation verticillium wilt pathogen, the multidirectional resistance to poison gene of 48h relative expression quantity is doubly worth and is greater than 2Doubly be worth and be less than 1 sentence with lateralorganboundariesdomainfamilyprotein transcripton relative expression quantityBe decided to be disease-resistant variety; After inoculation verticillium wilt pathogen, the multidirectional resistance to poison gene of 48h relative expression quantity is doubly worth and is less than 1 and lateralOrganboundariesdomainfamilyprotein transcripton relative expression quantity is doubly worth the susceptible product that are judged to be that are greater than 2Kind.
Multidirectional resistance to poison base when table 5 disease-resistant variety Ji 79 and susceptible germplasm TM-1 are subject to verticillium wilt pathogen and infect 0h-96hCause and lateralorganboundariesdomainfamilyprotein transcripton gene by fluorescence quantitative differential expression
Embodiment 4, the 228 resistance to verticillium wilt qualifications of Upland Cotton Ji
Step 1), step 2), step 3), step 5), simultaneously embodiment 3 of step 7
Step 4) total RNA extracts: choose respectively 5 strain steps 3) in germ inoculation infect 0 hour, 48 hours plant children tender leafsSheet, utilize improvement CTAB method (Hu Genhai, analogy tree is fast. utilize the CTAB method of improvement to extract the total RNA. Cotton Science of cotton leaf,2007,19 (1): 69-70.) extract the total RNA of blade. The total rna concentration of extraction is utilized respectively to ultramicron nucleic acid-protein analyzerDetect total rna concentration, and use ddH2O is diluted to 100ug/ml, and subzero 20 DEG C of conditions are in store for.
Step 6) multidirectional resistance to poison gene and lateralorganboundariesdomainfamilyproteinSynthesizing with embodiment 2 of transcripton and reference gene GhACTIN14 quantitative fluorescent PCR special primer.
Step 8) interpretation of result: utilize relative quantification 2 for quantitative fluorescent PCR data acquisition-ΔΔCtMethod is analyzed (in table 6, Fig. 4),After the 228 cotton varieties inoculations verticillium wilt pathogens of Ji, multidirectional resistance to poison gene relative expression quantity is 3.21 when 48h, be greater than 2, and inoculation is yellowWhile withering after germ 48h, lateralorganboundariesdomainfamilyprotein transcripton relative expression quantity is0.81, be less than 1, according to the criterion of embodiment 3, Ji 228 is resisting verticillium kind.
Table 6 Ji 228 kinds are subject to verticillium wilt pathogen to infect latter 48 hours multidirectional resistance to poison genes and lateralorganBoundariesdomainfamilyprotein transcripton relative expression quantity
Embodiment 5: Upland Cotton Ji 122 resistance to verticillium wilt qualifications
Step 8) interpretation of result: utilize relative quantification 2 for quantitative fluorescent PCR data acquisition-ΔΔCtMethod is analyzed (in table 7, Fig. 5),After the 122 cotton varieties inoculations verticillium wilt pathogens of Ji, multidirectional resistance to poison gene relative expression quantity is 2.98 when 48h, be greater than 2, and inoculation is yellowWhile withering after germ 48h, lateralorganboundariesdomainfamilyprotein transcripton relative expression quantity is0.95, be less than 1, according to the criterion of embodiment 3, Ji 122 is resisting verticillium kind. All the other steps are with embodiment 4.
Table 7 Ji 122 kinds are subject to verticillium wilt pathogen to infect latter 48 hours multidirectional resistance to poison genes and lateralorganBoundariesdomainfamilyprotein transcripton relative expression quantity
Embodiment 6: Upland Cotton Ji 1096 resistance to verticillium wilt qualifications
Step 8) utilize relative quantification 2 for quantitative fluorescent PCR data acquisition-ΔΔCtMethod is analyzed (in table 8, Fig. 6), Ji 1096 cottonsAfter flower variety inoculation verticillium wilt pathogen, multidirectional resistance to poison gene relative expression quantity is 0.91 when 48h, is less than 1, and inoculation verticillium wilt pathogenWhen rear 48h, lateralorganboundariesdomainfamilyprotein transcripton relative expression quantity is 9.13,Be greater than 1, according to the criterion of embodiment 3, Ji 1096 is sense verticillium wilt kind. All the other steps are with embodiment 4.
Table 8 Ji 1096 kinds are subject to verticillium wilt pathogen to infect latter 48 hours multidirectional resistance to poison genes and lateralorganBoundariesdomainfamilyprotein transcripton relative expression quantity
Embodiment 7: Upland Cotton Handan 885 resistance to verticillium wilt qualifications
Step 8) utilize relative quantification 2 for quantitative fluorescent PCR data acquisition-ΔΔCtMethod is analyzed (in table 9, Fig. 7), Handan 885 cottonsAfter kind inoculation verticillium wilt pathogen, multidirectional resistance to poison gene relative expression quantity is 0.92 when 48h, is less than 1, and after inoculation verticillium wilt pathogenWhen 48h, lateralorganboundariesdomainfamilyprotein transcripton relative expression quantity is 7.95, largeIn 1, according to the criterion of embodiment 3, Handan 885 is sense verticillium wilt kind. All the other steps are with embodiment 4.
Table 9 Handan 885 kinds are subject to verticillium wilt pathogen to infect latter 48 hours multidirectional resistance to poison genes and lateralorganBoundariesdomainfamilyprotein transcripton relative expression quantity
Embodiment 8: Upland Cotton Ji 1096, Handan 885, Ji 228, Ji 122 resistance to verticillium wilt field test tests
Upland Cotton Ji 1096, Handan 885, Ji 228, Ji 122 field resistance to verticillium wilt qualification tests were in 2012-2014Year carries out in verticillium wilt garden, field, little An She experiment station of Cotton Inst., Academy of Agriculture and Forestry Sciences of Hebei Prov.. All identification of species are 4The moon 25 planted in the sick garden of verticillium wilt according to 4 row districts, investigated cotton verticillium wilt incidence about August 20. Each district withMachine is selected 1 row, and investigation 20 strains, carry out characterization and evaluation according to 4 grades of grade scales, and the verticillium wilt state of an illness of then calculating identification of species refers toNumber (disease refers to). Computing formula is: refer to=(∑ fx)/(n × 4) of verticillium wilt disease, the strain number that f is this rank, the value that x is appropriate level(scope from 0 to 4), n is the total strain number of investigation. According to the resistance to verticillium wilt of verticillium wilt disease index Qualitative Identification kind (Li Shezeng,Ma Ping, HuangHC, etc. disease index is divided the statistical basis of cotton variety disease resistance relatively. Cotton Science, 2003,15(6): 344-347.), verticillium wilt refer to≤20 refer to≤35 refer to for resistance to disease, verticillium wilt for disease-resistant, 20<verticillium wilt>35 for susceptible, knotReally in table 10: Ji 228, Ji 122 kind verticillium wilt refer to be respectively 18.33,18.33, all≤20, field Disease garden identification result isDisease-resistant, and Ji 1096, Handan 885 kind verticillium wilt refer to be respectively 55,61.25, all > 35, field Disease garden identification result is susceptible.The present invention and verticillium wilt garden, field qualification result are in full accord, show that the qualification result degree of accuracy of the present invention reaches 100%.
Table 10 Upland Cotton Ji 1096, Handan 885, Ji 228, Ji 122 field resistance to verticillium wilt qualifications

Claims (10)

1. Upland Cotton resisting verticillium qualification related gene, is characterized in that comprising shown in SEQ ID NO:1Transcripton gene shown in multidirectional resistance to poison gene and SEQIDNO:2.
2. the pcr amplification special primer of Upland Cotton resisting verticillium qualification related gene, is characterized in that multidirectional resistance to poison baseThe special primer upstream sequence of cause is shown in SEQIDNO:3, and downstream sequence is shown in SEQIDNO:4; On transcripton gene specific primerTrip sequence is shown in SEQIDNO:5, and downstream sequence is shown in SEQIDNO:6.
3. the method for utilizing fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium, is characterized in that comprising the steps:1. cotton variety nutritive cube to be measured culturing room grows seedlings; 2. verticillium wilt Pathogen culture; 3. germ is soaked root inoculation: 2. cultivate by stepThe seedling that 1. germ bacterium liquid be bred as step is soaked root inoculation; 4. total RNA extracts: win that step crossed by infection process in 3.Tender of seedling, extracts the total RNA of blade; 5. cDNA is synthetic; 6. key gene relevant to upland cotton resistance be SEQIDNO:1 andGene shown in SEQIDNO:2, and the quantitative fluorescent PCR special primer of reference gene GhACTIN14 is synthetic; 7. fluorescence is fixedAmount PCR detects; 8. interpretation of result.
4. the method for utilizing fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium according to claim 3, its spyLevy be step 1. described cotton variety nutritive cube to be measured culturing room grow seedlings and adopt papery nutritive cube in plastic box to cultivateGrow seedlings in chamber, condition of culture: 28 DEG C of left and right of mean temperature, keep illumination 14 hours every day.
5. the method for utilizing fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium according to claim 3, its spyLevy be step 3. described germ soak root inoculation, refer to when cotton variety seedling to be measured grew to for 6 leaf phases and start to carry out germ and soakRoot inoculation, germ spore concentration is 106-108The spore suspension of individual/ml.
6. the method for utilizing fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium according to claim 3, its spyLevy be step 4. described total RNA extract, extraction be the total RNA in tender of the seedling of germ inoculation while infecting 0h and 48h.
7. the method for utilizing fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium according to claim 3, its spyLevy be step 5. described cDNA synthetic reaction system be total RNA2ul that step is extracted in 4., Anchoredoligo(dT)18primer(0.5ug/ul)1ul,2×TSReactionMix10ul,TranscriptRT/R1EnzymeMix1ul,gDNARemover1ul,Rnase-freewater5ul。
8. the method for utilizing fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium according to claim 3, its spyLevy be step 6. described key gene relevant to upland cotton resistance and reference gene GhACTIN14 quantitative fluorescent PCRSpecial primer synthetic, synthetic primer GC content 50%, Tm is at 60 DEG C-62 DEG C, length 18-22 nucleotides, amplified fragments 80-150bp; Synthetic multidirectional resistance to poison gene specific primer sequence: upstream sequence is shown in SEQIDNO:3, and downstream sequence is shown in SEQIDNO:4; Synthetic lateralorganboundariesdomainfamilyprotein transcripton gene specific primer orderRow: upstream sequence is shown in SEQIDNO:5, and downstream sequence is shown in SEQIDNO:6; Synthetic special drawing of reference gene GhACTIN14Thing sequence: upstream sequence is shown in SEQIDNO:7, downstream sequence is shown in SEQIDNO:8.
9. the method for utilizing fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium according to claim 3, its spyLevy and be 7. described fluorescence quantitative PCR detection of step, reaction system isPremixExTaqTM10ul, stepRapid special upstream primer (10pm/ul) 0.4ul of synthetic corresponding detected gene in 6., downstream primer (10pm/ul)0.4ul, ROXReferenceDye0.4ul, sterile purified water 7.8ul, cDNA2ul. RT-PCR response procedures: denaturation95 DEG C, 30s; 95 DEG C, 5s, 60 DEG C, 34s, 40 circulations.
10. the method for utilizing fluorescent quantitative PCR technique qualification Upland Cotton resisting verticillium according to claim 3, itsThe examination criteria that is characterised in that 8. interpretation of result of step institute foundation is to utilize relative quantification 2 for quantitative fluorescent PCR data acquisition-ΔΔCtMethod, after inoculation verticillium wilt pathogen, the multidirectional resistance to poison gene of 48h relative expression quantity is doubly worth and is greater than 2 and lateralorganBoundariesdomainfamilyprotein transcripton gene relative expression quantity is doubly worth the disease-resistant product that are judged to be that are less than 1Kind; After inoculation verticillium wilt pathogen, the multidirectional resistance to poison gene of 48h relative expression quantity is doubly worth and is less than 1 and lateralorganboundariesdomainfamilyprTein transcripton gene relative expression quantity is doubly worth the susceptible product that are judged to be that are greater than 2Kind.
CN201510790841.1A 2015-11-17 2015-11-17 The gene and method of Upland Cotton resisting verticillium are identified using fluorescent quantitative PCR technique Active CN105602948B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510790841.1A CN105602948B (en) 2015-11-17 2015-11-17 The gene and method of Upland Cotton resisting verticillium are identified using fluorescent quantitative PCR technique

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510790841.1A CN105602948B (en) 2015-11-17 2015-11-17 The gene and method of Upland Cotton resisting verticillium are identified using fluorescent quantitative PCR technique

Publications (2)

Publication Number Publication Date
CN105602948A true CN105602948A (en) 2016-05-25
CN105602948B CN105602948B (en) 2018-10-30

Family

ID=55983293

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510790841.1A Active CN105602948B (en) 2015-11-17 2015-11-17 The gene and method of Upland Cotton resisting verticillium are identified using fluorescent quantitative PCR technique

Country Status (1)

Country Link
CN (1) CN105602948B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112159821A (en) * 2020-10-09 2021-01-01 西南大学 Application of corn elicitor peptide gene ZmPep1 in improving verticillium wilt resistance of plants
CN112941221A (en) * 2021-03-01 2021-06-11 河南农业大学 Application of SPL3 and miR156 genes in identification of anti-secondarydisease paulownia
CN113670862A (en) * 2021-08-11 2021-11-19 新疆农业科学院经济作物研究所 Method for rapidly screening verticillium wilt-resistant cotton varieties

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7807869B1 (en) * 2005-06-01 2010-10-05 Clemson University Research Foundation Increased resistance of plants to pathogens from multiple higher-order phylogenetic lineages
CN101870977A (en) * 2010-04-12 2010-10-27 中国科学院遗传与发育生物学研究所 Method for cultivating anti-cyanosis transgenic cotton and special expression vector thereof
CN102080080A (en) * 2010-09-28 2011-06-01 中国农业科学院棉花研究所 Molecular marker for assisted selective breeding of upland cotton with greensickness resistant traits

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7807869B1 (en) * 2005-06-01 2010-10-05 Clemson University Research Foundation Increased resistance of plants to pathogens from multiple higher-order phylogenetic lineages
CN101870977A (en) * 2010-04-12 2010-10-27 中国科学院遗传与发育生物学研究所 Method for cultivating anti-cyanosis transgenic cotton and special expression vector thereof
CN102080080A (en) * 2010-09-28 2011-06-01 中国农业科学院棉花研究所 Molecular marker for assisted selective breeding of upland cotton with greensickness resistant traits

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112159821A (en) * 2020-10-09 2021-01-01 西南大学 Application of corn elicitor peptide gene ZmPep1 in improving verticillium wilt resistance of plants
CN112159821B (en) * 2020-10-09 2022-08-05 西南大学 Application of corn elicitor peptide gene ZmPep1 in improving verticillium wilt resistance of plants
CN112941221A (en) * 2021-03-01 2021-06-11 河南农业大学 Application of SPL3 and miR156 genes in identification of anti-secondarydisease paulownia
CN113670862A (en) * 2021-08-11 2021-11-19 新疆农业科学院经济作物研究所 Method for rapidly screening verticillium wilt-resistant cotton varieties
CN113670862B (en) * 2021-08-11 2024-02-20 新疆农业科学院经济作物研究所 Method for rapidly screening verticillium wilt-resistant cotton varieties

Also Published As

Publication number Publication date
CN105602948B (en) 2018-10-30

Similar Documents

Publication Publication Date Title
Cohen et al. Monitoring physiological races of Podosphaera xanthii (syn. Sphaerotheca fuliginea), the causal agent of powdery mildew in cucurbits: factors affecting race identification and the importance for research and commerce
CN106446596B (en) To the significant relevant molecular labeling of waterlogging tolerance of chrysanthemum and its identification method and application
CN106755480A (en) A kind of SSR molecular marker I for identifying Gala apple Progeny plants and its application
CN103060318A (en) SSR (Simple Sequence Repeat) core primer group developed based on whole genome sequence of foxtail millet and application of SSR core primer group
CN103364383A (en) High-efficiency identification method for salt resistance of cotton germplasms
Suz et al. Can NPK fertilizers enhance seedling growth and mycorrhizal status of Tuber melanosporum-inoculated Quercus ilex seedlings?
CN103243092B (en) Nucleic acid, method for identifying pathotype of fungus strain and kit
CN105794631A (en) Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line
CN105602948A (en) Genes and method for identifying gossypium hirsutum linn. variety verticillium wilt resistance by fluorescence quantitative PCR technique
Ferreira Molecular analysis of genebanks for sustainable conservation and increased use of crop genetic resources.
CN103255136B (en) Nucleic acid, and method and kit used for identifying fungal strain pathogenic type
CN103205501B (en) A kind of method identifying rice blast-resistant gene of wild rice
CN110184384B (en) Method for identifying drought resistance of corn variety based on real-time quantitative PCR
CN105821135B (en) Molecular labeling and application with muskmelon downy mildew resistance gene close linkage
KR102144263B1 (en) Primer set for screening tomato resitant to Bacterial wilt, method for screening tomato resitant to Bacterial wilt
CN107868840A (en) One grow flax in the SSR molecular marker associated with full growth number of days and application
CN101407845B (en) Molecule technical method for identifying indica/japonica type of Yunnan rice old variety of Yunnan rice old variety
CN113061639A (en) Method for determining pathogenicity of pathogenic bacteria of potato verticillium wilt
CN106222255B (en) It is a kind of detect Strawberry Seedlings viability primer and its application
CN103882017A (en) Molecular marker of cucumber fusarium wilt anti-disease gene Foc-4 as well as special primer and application thereof
CN104032003A (en) Method for quantitatively detecting ustilaginoidea virens from seed-borne and soil-borne media
CN116694479B (en) Pochonia chlamydosporia and application thereof
CN102559670B (en) Primer pair for assisting in identifying Fusarium oxysporum f. sp. phaseoli and application of primer pair
CN103525833B (en) Gene, method used for identifying pathogenicity of Verticillium dahliae and kit
Liu et al. Mycorrhizal Fungal Diversity and Its Relationship with Soil Properties in Camellia oleifera. Agriculture 2021, 11, 470

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant