CN105087588A - Plant embryo and aleurone layer specific promoter OsEmb3 and corresponding acquiring method - Google Patents
Plant embryo and aleurone layer specific promoter OsEmb3 and corresponding acquiring method Download PDFInfo
- Publication number
- CN105087588A CN105087588A CN201510604681.7A CN201510604681A CN105087588A CN 105087588 A CN105087588 A CN 105087588A CN 201510604681 A CN201510604681 A CN 201510604681A CN 105087588 A CN105087588 A CN 105087588A
- Authority
- CN
- China
- Prior art keywords
- osemb3
- plant
- aleurone layer
- seqidno
- specific promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention provides plant embryo and aleurone layer specific promoter OsEmb3 and a corresponding acquiring method. The plant embryo and aleurone layer specific promoter OsEmb3 contains the DNA sequence shown in SEQ ID No:1 or a homologue and a derivate thereof. The promoter can drive the exogenous gene to be specifically expressed at the parts of the embryo and the aleurone layer. The plant embryo and aleurone layer specific promoter OsEmb3 can be combined with the gene with the capacity of improving the character of the embryo of the plant for use, specifically, the plant embryo and aleurone layer specific promoter OsEmb3 and the gene with the character improved are connected to be guided into the plant, and the plant embryo and aleurone layer specific promoter OsEmb3 drives the gene with the character improved to be specifically expressed at the part of the embryo without causing influences on other parts of the plant, and therefore, from both the aspects of environment safety and food safety, the plant embryo and aleurone layer specific promoter OsEmb3 has an extremely high commercial value.
Description
Technical field
The present invention relates to biotechnology and plant genetic engineering field.Specifically, the present invention relates to a kind of plant embryos and aleurone layer specific expression promoter and corresponding acquisition methods, this promotor can be used in paddy rice adjustment and control system, drive target gene to express at embryo and aleurone layer position.
Background technology
Orderly and the result that is particular expression under the effect of extraneous environmental factor of the growing of organism, numerous genes that physiological process is all organism.Normal and the regular expression of gene ensure that the normal growth of plant is grown.In recent years, molecular biological research shows that the regulation and control on transcriptional level are the initial steps in gene expression regulation, is also one of important way of gene expression regulation.Gene promoter controls gene and expresses under specific tissue, specific etap and certain envrionment conditions.Thus, separation, identified gene promotor, space-time specificity expression feature and the mechanism of action thereof of understanding promotor have become the main contents studying gene expression regulation.
Tissue-specific promoter also claims organ specific promoters, and the downstream gene that such promotor regulates and controls often only is expressed at some specific organ or tissue position, and shows the characteristic of Growth adjustment.At present, favourable in plant materials for the ease of foreign gene, play a role efficiently, people start research organization's specificity promoter, take advantage of a situation functional element and the mechanism of action analyzed in specific promoter more and more, and select as required or artificial constructed suitable promotor, realize the timing to exogenous gene expression, fixed point, quantitative three-dimensional accuracy controlling.Such as, the application that tissue-specific promoter is studied at plant breeding, plant bioreactor etc. wins initial success.The promotor obtaining specificity expression's characteristic in a organized way is also find a kind of effective way of correlation function gene.In addition, in plant genetic engineering research, also need that there is tissue specificity High-expression promoter, make external source goal gene can in specific tissue high expression.
Embryo is formed in angiosperm sexual reproduction, has important biological significance in development of plants.The growth of embryo starts from zygote, through the differentiation and development stage of proembryo and embryo, finally reaches ripe.Merge the diploid zygote formed, both maintained the relative stability of species heredity, again for occurring in offspring that new inherited character, newly variation provide the foundation, for research plant genetic and breeding provide important theoretical foundation.Thus, be separated, identify rice embryo specificity promoter, understand space-time specificity feature and the machine-processed main contents having become the initiation and development of Study On Rice embryo of correlated expression thereof of embryo neural specific gene expression.To functional study and the qualification of the specific expressed promotor of rice embryo, will be conducive to realizing foreign gene high expression in specific tissue of transgenic plant.
In recent years about the specific research of rice paddy seed increases gradually, but because in embryonic development process known at present, particular molecule mark is less, the report with the functional gene of embryo specifically expressing pattern is also few, therefore the research of rice paddy seed specificity promoter is still mainly concentrated on endosperm specificity promoter, picture alcohol soluble protein gene promotor, Globulin gene promoter etc., and have report less to the research of embryo-specific promoter.The research such as Kuwano confirms promoters driven genes involved specifically expressing (PlantBiotechJ, 2009,7:96-105) in seed embryo of paddy rice Ole18 gene.Wu etc., by the expression pattern analysis of different storage protein genes involved in paddy rice, therefrom identify the paddy rice globin promoter Glb (PlantCellPhysiol, 1998,39:885-889) that expression intensity in a rice embryo is higher.If select embryo-specific high strength to express promotor, contribute to the synthesis of timing directed regulation and control external source useful proteins, both save energy, ensure that plant normal physiological activity is interference-free, the storage level of external source useful proteins in seed can be improved again simultaneously.Simultaneously, utilize embryo specific promoter can improve the expression of foreign gene in plant embryos and accumulation level, also can improved seed quality, import in seed and formulate health function new variety by having the albumen of physiologically active or small peptide, utilize seed to produce useful foreign protein or edible vaccine as bio-reactor, increase agricultural-food science and technology added value etc.Therefore, embryo specific promoter and be applied as and disclose the process of whole Embryos Development of Plant and the research of mechanism, utilizes bio-technology improvement seed quality, molecular medicine farm etc. researchs to lay a good foundation, has great application prospect.
Summary of the invention
Therefore, in order to the needs of the process and study mechanism that meet Embryos Development of Plant, the object of this invention is to provide a kind of plant embryos and aleurone layer specific promoter OsEmb3 and corresponding acquisition methods.
Specifically, the invention provides a kind of plant embryos and aleurone layer specific promoter OsEmb3, described plant embryos and aleurone layer specific promoter OsEmb3 can drive foreign gene specific expressed in the embryo and aleurone layer of plant.
Preferably, described plant embryos and aleurone layer specific expression promoter OsEmb3 comprise the DNA sequence dna shown in SEQIDNo:1 or the DNA sequence dna with complementary shown in SEQIDNo:1, or form by the DNA sequence dna shown in SEQIDNo:1 or with the DNA sequence dna of complementary shown in SEQIDNo:1.SEQ ID No: the DNA sequence dna shown in 1, for deriving from the EMBRYO IN RICE specific expression promoter of Japanese fine paddy rice (OryzasativaLcv.Nipponbare), is called OsEmb3 or promotor OsEmb3 herein.
Preferably, described plant embryos and aleurone layer specific promoter OsEmb3 comprise the variant of the DNA sequence dna shown in SEQIDNo:1, homologue or derivative.The nucleotide sequence that described plant embryos and aleurone layer specific promoter OsEmb3 can be hybridized with the complementary dna sequence of sequence shown in the DNA sequence dna shown in SEQIDNo:1 or SEQIDNo:1 under being also included in high high stringency conditions.
On the other hand, the invention provides a kind of expression cassette, recombinant expression vector or transformant, it is characterized in that, described expression cassette, recombinant expression vector or transformant comprise described plant embryos specific expression promoter OsEmb3.In described recombinant expression vector, described plant embryos specific expression promoter is connected to the upstream of gene order to be expressed; Preferably, gene to be expressed improves plant for having, and especially paddy rice is at the gene of the proterties ability at embryo position.More preferably, this recombinant expression vector, for the sequence shown in SEQIDNo:1 and OsEmb3 or promotor OsEmb3 are implemented in the recombinant expression vector obtained in pCAMBIA1391, is called pCAMBIA1391-OsEmb3 herein.
The present invention also provides the application of a kind of above-mentioned promotor in the proterties improving plant embryos position.Described plant embryos specific expression promoter OsEmb3 expresses at plant embryos position for driving foreign gene.Described plant is monocotyledons, such as paddy rice, wheat, corn, barley, jowar or oat, is preferably paddy rice.
On the other hand, the invention provides a kind of method obtaining described promotor, described method comprises the steps:
Step (1) prepares forward primer, and the nucleotide sequence of described forward primer is as shown in SEQIDNo:2;
Step (2) prepares reverse primer, and the nucleotide sequence of described reverse primer is as shown in SEQIDNo:3;
Step (3) with the fine DNA sequence dna of rice varieties Japan for template, utilize described forward primer and described reverse primer, adopt high-fidelity DNA polymerase to carry out pcr amplification to the object fragment in the fine DNA sequence dna of Japan, the nucleotide sequence of this object fragment is as shown in SEQIDNo:1;
Step (4) adds A to described object fragment and connects PGEM-T-Easy carrier;
Step (5), utilizes this vector intestinal bacteria XL-Blue competent cell, competent cell is activated, and then is transferred in the competent cell of activation by object fragment;
Step (6) picking mono-clonal bacterium liquid upgrading grain, double digestion checking is carried out with BamHI and EcoRI, checked order by positive colony through qualification, verify that correct clone is object fragment---the promotor OsEmb3 that will obtain, its nucleotide sequence is as shown in SEQIDNo:1;
Step (7), utilizes AXYGEN glue to reclaim test kit and reclaims described object fragment.
The DNA sequence dna of the promotor provided in the present invention is as shown in SEQIDNo:1, it should be noted that in SEQIDNo:1, " ATTTTTCCGTCACATCGTTTCA " of sequence the beginning part is the retention sequence obtaining the forward primer used in promotor process, amounts to 22bp; " GCTGCAGGTGTGCTCGATCCCC " of sequence end part is the retention sequence (corresponding sequence of this retention sequence and reverse primer is complementary) obtaining the reverse primer used in promotor process, amounts to 22bp; In this DNA sequence dna, remaining part is then available from the DNA sequence dna in the fine paddy rice of Japan.It is emphasized that mentioned promotor both can refer to above-mentioned whole DNA sequence dna herein, also can refer to the DNA sequence dna after removing above-mentioned primer retains sequence.
The present inventor utilizes the separating clone OsEmb3 upstream region of gene from the fine paddy rice of Japan (OryzasativaLcv.Nipponbare) of the reverse primer shown in the forward primer shown in SEQIDNo:2 and SEQIDNo:3 to comprise the DNA sequence dna of the 1972bp of transcription initiation site, and verifies it.
Technique effect
Promotor OsEmb3 of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter.This promotor can concentrate expression in the embryo position of regulatory gene in plant, has significant value in actual applications.Can be expressed in plant by this promoters driven foreign gene, can improve and improve the characteristic of paddy rice, thus cultivate desirable transgenic plant kind.
Accompanying drawing explanation
Below, describe embodiment of the present invention in detail by reference to the accompanying drawings, wherein:
Fig. 1 is schematic diagram OsEmb3 promotor be implemented in pCAMBIA1391 vector plasmid, wherein in Fig. 1, A is pCAMBIA1391 schematic diagram, in Fig. 1, B is pCAMBIA1391-OsEmb3 schematic diagram, illustrated therein is the Gus genetic expression utilizing OsEmb3 promoters driven to be positioned at its downstream;
Fig. 2 is the result schematic diagram of promotor of the present invention being carried out to digestion verification;
The vertical section (e) of root (a), stem (b), leaf (c), sheath (d) and mature seed of the ripe plant (90 days) of Fig. 3 and the Gus colored graph of cross section (f).The blueness representing reporter gene Gus activity does not all occur in the nutritive issues such as root, stem, leaf; In seed, Gus only has expression in protoblast and gluten cell, and does not obviously express in endosperm.As can be seen from the figure OsEmb3 promotor is that an embryo and gluten cell Idiotype express promotor (scale=2.5mm).
Embodiment
Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiments are only for illustration of the present invention, its scope do not limited the present invention in any way.
Experimental technique in following embodiment, if no special instructions, is ordinary method.Medicinal raw material used in following embodiment, reagent material etc., if no special instructions, be commercially available purchase product.
The acquisition of the OsEmb3 promotor containing restriction enzyme site
1, vegetable material
The mature seed of the fine paddy rice of Japan, is given birth to skill room by academy of agricultural sciences of Anhui Province paddy rice and is preserved.
2, bacterial strain and plasmid
The coli strain of this institute is XL1-blue; Agrobacterium tumefaciens is EHA105, and academy of agricultural sciences of Anhui Province paddy rice gives birth to skill room and deposited; Plant expression vector pCAMBIA1391 is purchased from Australian CAMBIA company
3, reagent and medicine
Clorox (NaClO, effective chlorine density 4%), Tween20 available from Sigma.Hygromycin B is purchased from Roche company; Extraction of plasmid DNA adopts the little extraction reagent kit of Axygen plasmid; DNA fragmentation reclaims test kit purchased from TIANGEN company.Primer synthesis and order-checking are completed by Beijing Liuhe Huada Genomics Technology Co., Ltd; KOD exo+ polymerase and quantitative PCR kit are purchased from the precious Bioisystech Co., Ltd of Dalian TaKaRa; PEASY-Tsimple and DNAmarker-Trans2K is purchased from Transgen company; Restriction enzyme is purchased from NEB company; T
4dNA ligase is purchased from Promega company.
4, gene clone
According to gene order design primer (consistent with the record in NCBI) of OsEmb3 in sequence table SEQ IDNo.1, with the DNA of object fragment for template, KOD-plus high-fidelity enzyme is adopted to carry out pcr amplification.Reaction system and program as follows:
Above-mentioned listed left side is by being added reagent, and right side is reaction conditions and time.
Then, reclaim the fragment that clip size is close with goal gene fragment length size, carry out adding A and connecting carrier T, for subsequent transformation E.colistrain XL1 blue.
5, transform
(1) LB (not containing microbiotic) and X-gal solid medium is prepared.
(2) from-80 DEG C of refrigerator-freezers, take out intestinal bacteria XL-blue competent cell, melt in ice bath.In aseptic centrifuge tube, add 2 μ l connect product, wherein a pipe adds 2 μ lH
2o in contrast.Get 50 μ l competent cells and be connected product and mix gently, in ice bath, place 20min.
(3) to said mixture 42 DEG C of thermal shock 90s, then ice bath 2min immediately.Add 950 μ lLB liquid nutrient mediums, 37 DEG C of shaking table shaking culture 1h;
(4) 12000r/min, centrifugal 1min, gained precipitation is resuspended with 100 μ lLB.Get and be applied on solid medium in right amount, be inverted for 37 DEG C and cultivate 16-20h, some bacterium colonies are white, and what have becomes blueness, and the bacterium colony choosing white carries out PCR qualification, and the bacterium colony of white is the intestinal bacteria inserting object fragment.
6, plasmid extracting method in a small amount
Extract corresponding plasmid with AXYGEN plasmid DNA small volume of reagent box, concrete operation method is as follows: when first time uses, all joined in BufferS1 by the RNaseA in test kit, mixing, 4 DEG C of storages.
(1) that gets about 4mL incubated overnight contains colibacillary LB liquid, and hereinafter referred to bacterium liquid, the centrifugal 30s of 12000 × g, abandons supernatant.
(2) add 250 μ lBufferS1 suspended bacterial precipitations, suspend and need evenly, should not leave small bacteria block.
(3) add 250 μ lBufferS2, spin upside down 4-6 time lentamente, mix and make the abundant cracking of thalline, until form bright solution.This step is no more than 5min.
(4) add 350 μ lBufferS3, gentle also spinning upside down fully mixes 6-8 time, the centrifugal 10min of 12000 × g.
(5) supernatant in aspiration step 4 also transfers to adsorption column, and the centrifugal 1min of the static 2min of room temperature, 12000 × g, abandons filtrate.
(6) adsorption column is put back to centrifuge tube, add 500 μ lBufferW1, the centrifugal 30s of 12000 × g, abandons filtrate.
(7) adsorption column is put back to centrifuge tube, add 700 μ lBufferW2, the centrifugal 30s of 12000 × g, abandons filtrate; Wash once with 500 μ lBufferW2 more in the same way.Abandon filtrate.
(8) adsorption column is put back in 2mL centrifuge tube, the centrifugal 2min of 12000 × g.
(9) moved into by adsorption column in new 1.5mL centrifuge tube, in adsorption column film, add 60 μ l deionized waters, room temperature leaves standstill 2min.The centrifugal 1min of 12000 × g.The solution eluted is come back to the central authorities of adsorption film, after backwashing once, obtains cloned plasmids DNA.
7, qualification is cut to the enzyme of cloning vector
Plasmid DNA digestion with restriction enzyme.The position of electrophoresis observation endonuclease bamhi and size, to judge whether identified plasmid has the size of exogenous sequences insertion and Insert Fragment.Endonuclease reaction system is 20 μ l, and component is as follows:
After said components mixing, put 37 DEG C of reaction 2-4h.Electrophoresis observation enzyme cuts result, as Fig. 2.
8, plant expression vector construction
According to the CDS sequences Design amplimer of fine gene OsEmb3 Japanese in NCBI; The primer building plant expression vector is as follows:
Forward primer: GGATCCATTTTTCCGTCACATCGTTTCA
Reverse primer: GAATTCGGGGATCGAGCACACCTGCAGC
Carry out pcr amplification to clone correct plasmid above for the primer of template band restriction enzyme site respectively, the system of amplification and program, with use cDNA gene clone, add A and connect T transformation of E. coli, choose correct carrier T positive colony extraction plasmid.Carry out enzyme with restriction enzyme BamHI and EcoRI to the plasmid and pCAMBIA1391 plasmid that contain object fragment to cut, reclaim object fragment respectively and be connected with the large fragment of 1391 plasmids.Connect object fragment and 1391 carrier large fragments with progemaT4 ligase enzyme, 4 DEG C of refrigerator overnight connect 16-18h, will connect product conversion intestinal bacteria.Verify correct through bacterium colony PCR screening recon and double digestion, send Beijing Liuhe Huada Genomics Technology Co., Ltd to carry out checking order and this gene order comparison in will check order gained sequence and NCBI.Verify that correct clone is the promotor that will obtain, its nucleotide sequence as shown in SEQIDNo:1, and extracts its plasmid for transformation Agrobacterium.
9, the preparation of Agrobacterium competent cell
(1) taking out the frozen Agrobacterium EHA105 bacterial strain of glycerine from-80 DEG C of Ultralow Temperature Freezers, rule at the YEB substratum containing 10 μ g/mLRif, cultivating 2-3d to growing single bacterium colony for 28 DEG C.
(2) picking list colony inoculation contains the YEB substratum of 10 μ g/mLRif in 10mL, 28 DEG C, 210r/min incubated overnight.
(3) gained bacterium liquid being all transferred to 250mL contains in 28 DEG C in the YEB substratum of 10 μ g/mLRif, and 210r/min continues to cultivate about 4h, and centre measures an OD value at set intervals, cultivates OD600 to 0.5-0.7.
(4) bacterium liquid is divided equally in 6 50mL centrifuge tubes, leave standstill 30min on ice, then in 4 DEG C, the centrifugal 5min of 4000r/min.
(5) supernatant is abandoned, by centrifuge tube back-off on aseptic filter paper, to remove net surplus bacterium liquid.
(6) 100mMCaCl of 3mL precooling is added
2resuspended thalline.
(7) resuspended bacterium liquid is concentrated on 2 centrifuge tubes, trim, 4 DEG C, the centrifugal 5min of 4000r/min.
(8) supernatant is abandoned, by centrifuge tube back-off on aseptic filter paper, to remove net surplus bacterium liquid;
(9) 100mMCaCl of 5mL precooling is added
2resuspended thalline.
(10) 50% glycerine of 5mL precooling is added, mixing.
(11) ice bath 10min, often pipe 100 μ l is sub-packed in sterile centrifugation tube, after liquid nitrogen freezing, is stored in Ultralow Temperature Freezer, for subsequent use.
10, plant expression vector transform Agrobacterium tumefaciens EHA105
(1) Agrobacterium competent cell is taken out from-80 DEG C of Ultralow Temperature Freezers, thawed on ice, after adding 2 μ g expression vector plasmid DNA mixings, ice bath 30min;
(2) liquid nitrogen flash freezer 1min is proceeded to rapidly;
(3) add the 1mLYEP substratum (not containing microbiotic) of 30 DEG C of preheatings after taking out from liquid nitrogen again, cultivate 4h in 30 DEG C of shaking table 120r/min;
(4) the centrifugal 1min of 4000r/min, abandons supernatant;
(5) add 150 μ lYEP substratum resuspended, bacterium liquid is spread evenly across on the YEP solid plate substratum containing 50 μ g/mLKan and 10 μ g/mLRif;
(6) 28 DEG C of constant incubators cultivate 2-3d to growing single bacterium colony, carry out bacterium colony PCR qualification.
(7) bacterium colony of the picking positive shakes bacterium, and it is for subsequent use to preserve bacterium liquid with glycerine.
(8) process above reclaimed all adopts AXYGEN to reclaim test kit.
Utilize the step reclaiming test kit recovery as follows:
(1) fragment of acquisition is joined in sepharose, under ultraviolet lamp, cut the sepharose containing target DNA, exhaust gel surface liquid with paper handkerchief.Calculated for gel weight, this weight is as a gel volume.
(2) add the BufferDE-A of 3 gel volumes, in 75 DEG C of heating after mixing, period constantly rocks, until blob of viscose melts completely.
(3) BufferDE-B of 0.5 BufferDE-A volume is added, mixing.When the DNA fragmentation be separated is less than 400bp, the Virahol of 1 gel volume need be added again.
(4) mixed solution in aspiration step 3, transfers to DNA and prepares in pipe, and DNA prepares pipe and is placed in 2mL centrifuge tube, the centrifugal 1min of 12000 × g.Abandon filtrate.
(5) again put back in 2mL centrifuge tube by preparation pipe, add 500 μ lBufferW1, the centrifugal 30s of 12000 × g, abandons filtrate.
(6) putting back 2mL centrifuge tube by preparing pipe, adding 700 μ lBufferW2, the centrifugal 30s of 12000 × g, abandons filtrate.Wash once with 500 μ lBufferW2 more in the same way, the centrifugal 1min of 12000 × g.
(7) put back in 2mL centrifuge tube plasmid by preparing pipe, the centrifugal 2min of 12000 × g.
(8) be placed in clean 1.5mL centrifuge tube by preparing pipe, add 25-35 μ l deionized water preparing film central authorities, room temperature leaves standstill 2min.12000 × g centrifugal 1min eluted dna fragment.
Promoters driven Gus reporter gene is utilized to express in paddy rice
Step 1: Agrobacterium is situated between different rice transformation
(1) the rice paddy seed sterilized water soaked overnight under 30 DEG C of dark conditions after callus induction sterilization, being peeled by embryo with scalper is placed on inducing culture, 12 embryos evenly placed by every ware, 2-3 week evoked callus is placed, to growing faint yellow particulate state callus under 30 DEG C of dark conditions.
(2) preculture selects particulate state from inducing culture, callus not with scab is placed on new inducing culture, under 30 DEG C of dark conditions, cultivate 3-5d.
(3) to infect and pre-incubated callus is transferred in 50mL sterile tube by Dual culture, add the Agrobacterium bacterium immersion bubble 20min of plant expression vector, pour out bacterium liquid, and with aseptic filter paper, remaining bacterium liquid is blotted.After callus is evenly sprinkling upon on Dual culture substratum, under 23 DEG C of dark conditions, cultivate 2-3d.
(4) recover the callus of Dual culture to be transferred on recovery media.3-5d is cultivated under 23 DEG C of dark conditions.
(5) screening is selected from screening culture medium and is not with bacterial plaque color vivid in faint yellow granular resistant embryogenic calli, and 30, every ware is inoculated in screening culture medium, cultivates 2-3 week under 30 DEG C of dark conditions, to growing new resistance particulate state callus.
(6) break up each transformation event (being bred all callus produced during screening by callus) select three independently embryo callus to a certain region of division culture medium, cultivate 3-4 week under 30 DEG C of illumination cultivation room (16h illumination/8h is dark) conditions, treat that seedling grows.
(7) two healthy and strong seedling replantings are selected to root media in each region of taking root, and 30 DEG C of tissue culture room photoperiods (16h illumination/8h is dark) are cultivated about three weeks, carry out identifying and transplanting to field.
Step 2, Gus histochemical stain
Gus can react with chromogenic substrate X-Gluc, manifests blueness, thus can be studied expression level and the expression pattern of Gus qualitatively by histochemical stain.
(1) preparation of Gus dyed substrate
50mL0.5M phosphoric acid buffer (pH7.0), the 50 μ l100mM Tripotassium iron hexacyanides, 50 μ l100mM yellow prussiate of potash, 1mL0.5MEDTA, 250 μ l1mmg/mLX-Gluc.
(2) staining procedure
A, dyeing: be dipped into by testing sample in Gus dye liquor, place 24h-36h in 37 DEG C of insulation cans.
B, decolouring: add 100% alcohol immersion until decolour completely.The available solution containing 30% glycerine and 70% ethanol is preserved.
C, clap record under the microscope.
Carry out Gus dyeing as stated above, as shown in Figure 3, the blueness representing reporter gene Gus activity does not all occur result in the nutritive issues such as root, stem, leaf; In seed, Gus only has expression in protoblast and gluten cell, and does not obviously express in endosperm.These data show that OsEmb3 promotor is that an embryo and gluten cell Idiotype express promotor.
In the present embodiment, the preparation of damping fluid, reagent, microbial culture based formulas, E. coli competent is see " Molecular Cloning: A Laboratory guide " (third edition).
Specific description of embodiments of the present invention does not above limit the present invention, and those skilled in the art can make various change or distortion according to the present invention, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.
Claims (8)
1. plant embryos and an aleurone layer specific promoter OsEmb3, is characterized in that, described plant embryos and aleurone layer specific promoter OsEmb3 can drive foreign gene specific expressed in the embryo and aleurone layer of plant.
2. plant embryos according to claim 1 and aleurone layer specific promoter OsEmb3, it is characterized in that, described plant embryos and aleurone layer specific promoter OsEmb3 comprise the DNA sequence dna shown in SEQIDNo:1 or the DNA sequence dna with complementary shown in SEQIDNo:1, or described plant embryos and aleurone layer specific promoter OsEmb3 are formed by the DNA sequence dna shown in SEQIDNo:1 or with the DNA sequence dna of complementary shown in SEQIDNo:1.
3. a plant embryos and aleurone layer specific promoter OsEmb3, it is characterized in that, described plant embryos and aleurone layer specific promoter OsEmb3 comprise the variant of the DNA sequence dna shown in SEQIDNo:1, homologue or derivative, the nucleotide sequence that described plant embryos and aleurone layer specific promoter OsEmb3 can be hybridized with the complementary dna sequence of sequence shown in the DNA sequence dna shown in SEQIDNo:1 or SEQIDNo:1 under being also included in high high stringency conditions.
4. expression cassette, recombinant expression vector or a transformant, is characterized in that, described expression cassette, recombinant expression vector or transformant comprise plant embryos described in claim 1,2 or 3 and aleurone layer specific promoter OsEmb3.
5. an application for the plant embryos specific expression promoter described in claim 1,2 or 3, is characterized in that, described plant embryos specific expression promoter OsEmb3 expresses at the embryo position of plant for driving foreign gene.
6. application according to claim 5, it is characterized in that, described application comprises described plant embryos specific expression promoter OsEmb3 is connected to target gene upstream, and proceed in vegetable cell, and then cultivate corresponding transgenic plant, described gene to be expressed improves plant for having, and especially paddy rice is at the gene of the proterties ability at embryo position.
7. an acquisition methods of plant embryos specific expression promoter OsEmb3 according to claim 1, it is characterized in that, described method comprises the steps:
Step (1) prepares forward primer, and the nucleotide sequence of described forward primer is as shown in SEQIDNo:2;
Step (2) prepares reverse primer, and the nucleotide sequence of described reverse primer is as shown in SEQIDNo:3;
Step (3) with the fine DNA sequence dna of rice varieties Japan for template, utilize described forward primer and described reverse primer, adopt high-fidelity DNA polymerase to carry out pcr amplification to the object fragment in the fine DNA sequence dna of Japan, the nucleotide sequence of this object fragment is as shown in SEQIDNo:1;
Step (4) adds A to described object fragment and connects PGEM-T-Easy carrier;
Step (5) utilizes the vector intestinal bacteria XL-Blue competent cell after connecting, and competent cell is activated, and then is transferred in the competent cell of activation by object fragment;
Step (6) picking mono-clonal shakes bacterium liquid upgrading grain, and carry out double digestion checking, checked order by positive colony through qualification, verify that correct clone is object fragment---the promotor OsEmb3 that will obtain, its nucleotide sequence is as shown in SEQIDNo:1;
Step (7) utilizes glue to reclaim test kit and adds described object fragment.
8. the acquisition methods of plant embryos specific expression promoter OsEmb3 according to claim 7, it is characterized in that, described amplification program comprises:
Step (3-1) carries out denaturation 5min at 95 DEG C;
Step (3-2) 95 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 2min30s;
Step (3-3) repeating step (3-1) and step (3-2) 35 circulation;
Step (3-4) 72 DEG C extends 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510604681.7A CN105087588B (en) | 2015-09-21 | 2015-09-21 | Plant embryos and aleurone specific promoter OsEmb3 and corresponding acquisition methods |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510604681.7A CN105087588B (en) | 2015-09-21 | 2015-09-21 | Plant embryos and aleurone specific promoter OsEmb3 and corresponding acquisition methods |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105087588A true CN105087588A (en) | 2015-11-25 |
| CN105087588B CN105087588B (en) | 2018-01-05 |
Family
ID=54568921
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510604681.7A Expired - Fee Related CN105087588B (en) | 2015-09-21 | 2015-09-21 | Plant embryos and aleurone specific promoter OsEmb3 and corresponding acquisition methods |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087588B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113322258A (en) * | 2021-06-29 | 2021-08-31 | 湖北师范大学 | Rice aleurone layer specific expression promoter pNFYA1 and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1025249A1 (en) * | 1997-10-22 | 2000-08-09 | Aventis Cropscience S.A. | Novel seed specific promoters based on plant genes |
| EP1180154A1 (en) * | 1999-05-17 | 2002-02-20 | Institut National De La Recherche Agronomique (Inra) | PROMOTER OF THIOREDOXINE TaTrxh2 IN WHEAT |
| WO2003000905A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Identification and characterization of plant genes |
| CN102250894A (en) * | 2010-05-20 | 2011-11-23 | 中国科学院植物研究所 | Specific expression promoter for plant embryo and application thereof |
| CN102925480A (en) * | 2012-11-02 | 2013-02-13 | 浙江大学 | Plant expression vector for suppressing rice 2-PGK gene expression and method for culturing low phytic acid rice |
-
2015
- 2015-09-21 CN CN201510604681.7A patent/CN105087588B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1025249A1 (en) * | 1997-10-22 | 2000-08-09 | Aventis Cropscience S.A. | Novel seed specific promoters based on plant genes |
| EP1180154A1 (en) * | 1999-05-17 | 2002-02-20 | Institut National De La Recherche Agronomique (Inra) | PROMOTER OF THIOREDOXINE TaTrxh2 IN WHEAT |
| WO2003000905A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Identification and characterization of plant genes |
| CN102250894A (en) * | 2010-05-20 | 2011-11-23 | 中国科学院植物研究所 | Specific expression promoter for plant embryo and application thereof |
| CN102925480A (en) * | 2012-11-02 | 2013-02-13 | 浙江大学 | Plant expression vector for suppressing rice 2-PGK gene expression and method for culturing low phytic acid rice |
Non-Patent Citations (1)
| Title |
|---|
| 黄昕颖等: "水稻种子特异表达启动子Ole18的克隆、序列分析及功能验证", 《南方农业学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113322258A (en) * | 2021-06-29 | 2021-08-31 | 湖北师范大学 | Rice aleurone layer specific expression promoter pNFYA1 and application thereof |
| CN113322258B (en) * | 2021-06-29 | 2022-04-05 | 湖北师范大学 | Rice aleurone layer specific expression promoter pNFYA1 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105087588B (en) | 2018-01-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107012147B (en) | Drought and/or high-salt induction promoter SlWRKY8P from tomato and application thereof | |
| CN108795943B (en) | Plant specific expression promoter POssalt2 and application thereof | |
| CN107815452A (en) | A kind of specific expressed promoter of plant leaf blade and its application | |
| CN104342441B (en) | Plant non-endosperm expression promoter SAFE S1 and acquiring method thereof | |
| CN103740717B (en) | A kind of EMBRYO IN RICE specific expressing promoter and application thereof | |
| CN101875936A (en) | Promoter specifically-expressed in rice embryo and application thereof | |
| CN103205427B (en) | Peanut seed embryo specificity promoter and cloning and application thereof | |
| CN102242136A (en) | Gene influencing root system development and yield of rice and application of gene | |
| CN104357449B (en) | Method for acquiring plant stamen expression promoter STA3 and corresponding promoter | |
| CN109456969B (en) | Rice brown planthopper-harming inducible promoter and application thereof | |
| CN107058324B (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivation method | |
| CN105087588A (en) | Plant embryo and aleurone layer specific promoter OsEmb3 and corresponding acquiring method | |
| CN104293792B (en) | Paddy rice stamen and lodicules expression promoter STA4 and its application | |
| CN108795942B (en) | Rice exogenous stress induced expression promoter Psubs3 and application thereof | |
| CN102618544A (en) | Plant light inducible gene promoter and application thereof | |
| CN106148346A (en) | A kind of isolated endosperm does not express promoter SAFES6 and application thereof | |
| CN105274106A (en) | Peanut AhWRI-1 promoter and preparation method and application | |
| CN105567694A (en) | High-expression-activity rice non-seed expression promoter SAFES4 and application thereof | |
| CN111187853A (en) | Application of functional molecular marker of tomato fruit development related gene | |
| CN104762302B (en) | The strong evoked promoter CdS2 of cadmium and its application | |
| CN105132430B (en) | Corn nutritive organ-specific promoter and its application | |
| CN107142262B (en) | Rice seed specific promoter Posseed and application thereof | |
| CN103725680B (en) | Plant endosperm specificity expression promoter pENP3 and application thereof | |
| CN111454987B (en) | Application of GhNAC091 gene in improving plant photosynthesis efficiency and strong light tolerance | |
| CN104328124A (en) | Promoter capable of driving or regulating expression of gene in plant stamen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180105 Termination date: 20200921 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |