CN105087534A

CN105087534A - Method for improving yield of recombinant N-acetylneuraminic acid aldolase

Info

Publication number: CN105087534A
Application number: CN201510409410.6A
Authority: CN
Inventors: 李小红; 孔毅荣
Original assignee: Beijing Jiawan Biotechnology Co Ltd
Current assignee: Beijing Jiawan Biotechnology Co Ltd
Priority date: 2015-07-14
Filing date: 2015-07-14
Publication date: 2015-11-25

Abstract

The invention discloses a method for improving yield of recombinant N-acetylneuraminic acid aldolase. The gene of the N-acetylneuraminic acid aldolase provided by the invention is as shown in SEQ ID NO. 1; according to the method disclosed by the invention, an escherichia coli N-acetylneuraminic acid aldolase gene Neu5Ac is cloned onto a prokaryotic expression vector pET28a, so as to obtain a recombinant bacterium for the efficient expression of the N-acetylneuraminic acid aldolase. The method, by optimizing dissolved oxygen concentration, pH, stirring rate and feed supplement conditions of a fermentation tank, can improve the yield of enzyme to 4.5g/L, and enzymatic activity can reach 600-800U/mg. The method for improving yield of N-acetylneuraminic acid aldolase provided by the invention is simple in operation, relatively high in yield and relatively broad in application prospect and high in development value, and purity reaches or is above 98%.

Description

A kind of method improving restructuring Neu 5 Ac aldolase output

Technical field

The invention belongs to biomedical engineering field, particularly a kind of method improving Neu 5 Ac aldolase output.

Background technology

Sialic acid is one and contains 9 carbon atoms and have the acid aminosugar of pyranose structure, can regard the condenses of pyruvic acid and α hexosamine as, extensively be present in many organisms, belong to and there is not modified neuraminic acid at occurring in nature.According to the difference of linking group on 5 carbon, sialic acid can be divided three classes: N-acetyl-neuraminate, NeuGc ALPHA2-3Gal, 2-ketone-3-deoxidation-D-glycero-galacto-n-nonanoic acid.Although the amount of N-acetyl-neuraminate accounts for the overwhelming majority in mammalian body, have NeuGc ALPHA2-3Gal concurrently simultaneously.Prove at present the noticeable change along with cell surface sialic acid amount, mode of connection and type of the conversion of tumour and pernicious process.Research finds that sialic acid and polysialic acids content are higher than normal cell in malignant tumour.

Neu5Ac zymohexase (Aldolase) both can urge N-acetyl-neuraminate to resolve into pyruvic acid and ManNAc, catalyzing N-acetylmannosamine and pyruvic acid can become the condensation reaction of N-acetyl-neuraminate again under certain condition.Neu 5 Ac aldolase can be coupled with serum lactic dehydrogenase or pyruvic oxidase, with the content of N-acetyl-neuraminate in working sample with ManNAc and pyruvic acid for substrate carries out Neu5Ac enzymatic clarification, it is strong that this biocatalysis technology has substrate stereospecificity, reaction conditions is gentle, the multiple advantage such as pollution-free, have a good application prospect, we utilize microbe fermentation method High-efficient Production Neu 5 Ac aldolase, for sialic detection provides large content of starting materials.

Summary of the invention

The object of the present invention is to provide a kind of method improving Neu 5 Ac aldolase output.

The technical solution used in the present invention is:

A kind of aminoacid sequence of N-acetyl-neuraminate of recombinating is as SEQIDNO:1.

The expression method of restructuring N-acetyl-neuraminate comprises the steps:

1. 5 ' of goal gene end is added NcoI restriction enzyme site, 3 ' adds XhoI restriction enzyme site restriction enzyme site, design primer, and pcr amplification obtains Neu5A sequence;

2. the sequence of synthesis is cut from puc57 carrier, be inserted into the multiple clone site of prokaryotic expression carrier, build recombinant expression plasmid, recombinant expression plasmid is transformed into expressive host bacterium intestinal bacteria, filters out positive colony bacterium, obtain engineering bacteria;

3. prokaryotic expression carrier is pET28a (+), and expressive host is E.coliBL21 (DE3).

Restructuring N-acetyl-neuraminate fermentor tank amplifies to be produced, and step is as follows:

1. the present invention takes following technical measures to realize to amplify and produces.

2. particularly, utilize single factor experiment to determine best IPTG, dissolved oxygen, pH and temperature.

3. aforesaid method, by designing the concentration of single factor experiment determination leavening temperature and IPTG, result shows (as Fig. 1), 300ml substratum.When the concentration of IPTG is 0.1mol/L, when inducing temperature is 28 DEG C, production of enzyme is the highest.

4. aforesaid substratum LB+10%glucose.

5. following methods can be adopted particularly to verify IPTG, dissolved oxygen, pH and rotating speed in real attenuation process.

6. for reducing IPTG to the toxicity of cell, by changing fermention medium and feeding strategy raising production of enzyme.

7. aforesaid culture medium prescription is Tryptone5g/L, Yeastextract0.25g/L, (NH4) ₂sO ₄2g/L, KH ₂pO ₄7g/L, Citric acid monohydrate Food grade 0.9g/L, MgSO ₄7H ₂o0.7g/L, glucose 15g/L, micro-mother liquor: 3mL.

8. aforementioned trace element consist of HCl10g/L, FeSO ₄h ₂o2.25g/L, ZnSO ₄1.0g/L, CuSO ₄5H ₂o2g/L, CaCl ₂2H ₂o0.5g/L prepares with water.

9. aforesaid method, supplemented medium is divided into two kinds, feed supplement 1:MgSO ₄.7H2O5g/L, Yeastextract240g/L, Tryptone100g/L, glycerine 90g/L, lactose 60g/L; Feed supplement 2: glycerine 500g/L, lactose 150g/L.

10. preceding method, wherein said leavening temperature is 30-38 DEG C, pH6.5-7.5, and dissolved oxygen is 0-100%, works as OD ₆₀₀add feed supplement 1 when reaching 18, add feed supplement 2 when DO rises after inducing.Fermentation 25-30h.

11. can reach 4.5g/L (as Fig. 3) by the output of fed-batch fermentation enzyme, OD ₆₀₀can 60 be reached, with low cost, be suitable for scale operation, thus there is good industrial value.

12. detect enzyme lives, and get the centrifugal 10min of 0.5ml bacterium liquid 4000r/min, physiological saline washes 1 ~ 2 time.Thalline spends the night through-20 DEG C after process, adds 50mmol/L sodium phosphate buffer 0.5ml (pH7.5), gets 0.25ml preheating 10min after suspension, adds the Neu5Ac solution 37 DEG C reaction 10min of 0.25ml preheating.By 10% trichoroacetic acid(TCA) 0.3ml termination reaction, add 0.2ml water, add 0.2%2,4 dinitrophenylhydrazine 0.4ml shake up, and leave standstill 10min.The sodium hydroxide 1.5ml adding 3mol/L shakes up, and leaves standstill the centrifugal 5min of 15min, 12000r/min, gets supernatant liquor at 550nm colorimetric estimation absorbance value.

Accompanying drawing explanation

Fig. 1 is the schematic flow sheet of preparation Neu 5 Ac aldolase

Fig. 2 is that the SDS-PAGE of restructuring Neu 5 Ac aldolase expression product analyzes, wherein 1: broken thalline supernatant; 2: inclusion body; M:Marker.

Fig. 3 is Neu 5 Ac aldolase solubility expression amount in fermentor tank, wherein 1: fermentor tank induction induction supernatant; 2:80mm imidazoles wash-out; 3:200mm imidazoles wash-out.

Fig. 4 is the growth curve of bacterial classification in fermentor tank

Specific embodiments

Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.

Embodiment 1

The expression method of restructuring N-acetyl-neuraminate

1) bacillus coli DH 5 alpha genome is extracted

2) 5 ' of goal gene end is added NcoI restriction enzyme site (CCATGG), 3 ' adds XhoI restriction enzyme site (CTCGAG); Aim sequence is obtained by pcr amplification.

Design of primers is as follows:

F1：CATGCCATGGCAACGAATTTACGTGGCGTAATG

R1：CCGCTCGAGCCCGCGCTCTTGCATCAACTG

3) acquisition sequence NcoI and XhoI is carried out double digestion, purifying obtains goal gene, prokaryotic expression carrier pET28a, cuts process through identical enzyme, purifying large fragment gene, and be connected with the goal gene obtained after double digestion, proceed to competent cell DH5a, carry out bacterium colony PCR checking with universal primer T7/T7T, order-checking is determined successfully, extracting plasmid, obtains recombinant expression plasmid NAL-pET28a.

4) by recombinant expression plasmid NAL-pET28a; Proceed in competence expressive host bacterium E.coliBL21 (DE3), coat on LB solid medium (containing 50 μ g/ml sulphuric acid kanamycins), cultivate 16h for 37 DEG C, filtering out positive colony bacterium is engineering bacteria.

5) be seeded to by engineering bacteria in LB nutrient solution (containing 50 μ g/ml sulphuric acid kanamycins), 37 DEG C of cultivations, treat bacterium liquid OD _600nm0.5, add the IPTG that final concentration is 0.5mmol/l, cultivate 4h, 4 DEG C for 37 DEG C, the centrifugal 10min of 12000rpm is separated and reaches abduction delivering supernatant liquor and thalline.

6), after thalline BindingBuffer being washed 1 time, carrying out ultrasonic bacteria breaking on ice, centrifugal, collect supernatant liquor, 12%SDS-GAGE detects the expression amount of albumen.

7) by carrying out ultrasonic bacteria breaking, centrifugal, collect supernatant liquor, supernatant liquor is added nickel chromatography column, once add BindingBuffer, WashBuffer, last EluteBuffer carries out target protein wash-out, collect EluteBuffer eluted protein, obtain restructuring Neu 5 Ac aldolase, adopt the purity of 12%SDS-PAGE electrophoresis detection target protein.

Embodiment 2100L fermentor tank improves the method for Neu 5 Ac aldolase output

In the fermentor tank of 100L, initial medium constant volume is 60L, and inoculum size is 2%, and during the fermentation, use ammoniacal liquor control ph, culture temperature maintains 37 DEG C, and fermented liquid pH maintains 6.9.Initial sterile air air flow is 2m ³/ h, initial mixing speed is 250rpm, and initial dissolved oxygen is set to 100%, and along with the carrying out of fermentation, dissolved oxygen starts to decline, and when dissolved oxygen drops to about 20%, needs constantly adjustment air flow and rotating speed, makes dissolved oxygen maintain more than 20%, cultivate 7-8h, work as OD ₆₀₀add feed supplement 1 when reaching about 20, simultaneous temperature drops to 28 DEG C, and the later stage adds feed supplement 2, and induction 20h, the output of enzyme reaches 4.5g/L.

Claims

1. the protein as described in SEQIDNO.1.

2. gene according to claim 1 builds the genetic engineering bacterium producing N-acetyl-neuraminate through molecule manipulation.

3. engineering bacteria according to claim 2 is through optimizing fermentation medium components and fermentation parameter, improves output.

4. claim 3 requires that inoculum size is 2%, and during the fermentation, ammoniacal liquor control ph, culture temperature maintains 37 DEG C, and fermented liquid pH maintains 7.2.Initial sterile air air flow is 2.5m ³/ h, initial mixing speed is 250rpm, and initial dissolved oxygen is set to 100%, and along with the carrying out of fermentation, dissolved oxygen starts to decline, and when dissolved oxygen drops to about 20%, needs constantly adjustment air flow and rotating speed, makes dissolved oxygen maintain more than 20%, cultivate 7-8h, work as OD ₆₀₀add feed supplement 1 when reaching about 18, temperature drops to 26 DEG C, adds feed supplement 2 when DO starts to rise, induction 25h.

5. substratum according to claim 3 is Tryptone5g/L, Yeastextract0.25g/L, (NH4) ₂sO ₄2g/L, KH ₂pO ₄7g/L, Citric acid monohydrate Food grade 0.9g/L, MgSO ₄7H ₂o0.7g/L, glucose 15g/L, micro-mother liquor: 3mL.

6. micro-consisting of described in claim 3: HCl10g/L, FeSO ₄h ₂o2.25g/L, ZnSO ₄1.0g/L, CuSO ₄5H ₂o2g/L, CaCl ₂2H ₂o0.5g/L prepares with water.

7. supplemented medium described in claim 3 is divided into two kinds, feed supplement 1:MgSO ₄.7H2O5g/L, Yeastextract240g/L, Tryptone100g/L, glycerine 90g/L, lactose 60g/L; Feed supplement 2: glycerine 500g/L, lactose 150g/L.